ID: 948580711

View in Genome Browser
Species Human (GRCh38)
Location 2:238985916-238985938
Sequence TCGTGGTGCTGCAGTGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948580705_948580711 2 Left 948580705 2:238985891-238985913 CCTGTACCAGGAAGGGTCCCTCG No data
Right 948580711 2:238985916-238985938 TCGTGGTGCTGCAGTGAGCCAGG No data
948580698_948580711 28 Left 948580698 2:238985865-238985887 CCTCCCAAGAAAGCTCCGAGACA No data
Right 948580711 2:238985916-238985938 TCGTGGTGCTGCAGTGAGCCAGG No data
948580700_948580711 24 Left 948580700 2:238985869-238985891 CCAAGAAAGCTCCGAGACAAAAC No data
Right 948580711 2:238985916-238985938 TCGTGGTGCTGCAGTGAGCCAGG No data
948580697_948580711 29 Left 948580697 2:238985864-238985886 CCCTCCCAAGAAAGCTCCGAGAC No data
Right 948580711 2:238985916-238985938 TCGTGGTGCTGCAGTGAGCCAGG No data
948580699_948580711 25 Left 948580699 2:238985868-238985890 CCCAAGAAAGCTCCGAGACAAAA No data
Right 948580711 2:238985916-238985938 TCGTGGTGCTGCAGTGAGCCAGG No data
948580707_948580711 -4 Left 948580707 2:238985897-238985919 CCAGGAAGGGTCCCTCGGCTCGT No data
Right 948580711 2:238985916-238985938 TCGTGGTGCTGCAGTGAGCCAGG No data
948580702_948580711 13 Left 948580702 2:238985880-238985902 CCGAGACAAAACCTGTACCAGGA No data
Right 948580711 2:238985916-238985938 TCGTGGTGCTGCAGTGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948580711 Original CRISPR TCGTGGTGCTGCAGTGAGCC AGG Intergenic
No off target data available for this crispr