ID: 948587707

View in Genome Browser
Species Human (GRCh38)
Location 2:239029618-239029640
Sequence CCGGGAAAACAGGCCCTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948587694_948587707 28 Left 948587694 2:239029567-239029589 CCTGTCCATACGGTACAACAGCA No data
Right 948587707 2:239029618-239029640 CCGGGAAAACAGGCCCTGAGAGG No data
948587695_948587707 23 Left 948587695 2:239029572-239029594 CCATACGGTACAACAGCATCAAT No data
Right 948587707 2:239029618-239029640 CCGGGAAAACAGGCCCTGAGAGG No data
948587693_948587707 29 Left 948587693 2:239029566-239029588 CCCTGTCCATACGGTACAACAGC No data
Right 948587707 2:239029618-239029640 CCGGGAAAACAGGCCCTGAGAGG No data
948587698_948587707 -2 Left 948587698 2:239029597-239029619 CCGGCCAGGAGTAGCCCCGTGCC No data
Right 948587707 2:239029618-239029640 CCGGGAAAACAGGCCCTGAGAGG No data
948587701_948587707 -6 Left 948587701 2:239029601-239029623 CCAGGAGTAGCCCCGTGCCGGGA No data
Right 948587707 2:239029618-239029640 CCGGGAAAACAGGCCCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948587707 Original CRISPR CCGGGAAAACAGGCCCTGAG AGG Intergenic
No off target data available for this crispr