ID: 948589223

View in Genome Browser
Species Human (GRCh38)
Location 2:239038729-239038751
Sequence CACTGGATTCAGGGTCCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948589215_948589223 -6 Left 948589215 2:239038712-239038734 CCCAGTAAGGATCCTCCCACTGG No data
Right 948589223 2:239038729-239038751 CACTGGATTCAGGGTCCCCCTGG No data
948589205_948589223 29 Left 948589205 2:239038677-239038699 CCCCCTTCCCTTCTCCGTGTGTC No data
Right 948589223 2:239038729-239038751 CACTGGATTCAGGGTCCCCCTGG No data
948589206_948589223 28 Left 948589206 2:239038678-239038700 CCCCTTCCCTTCTCCGTGTGTCT No data
Right 948589223 2:239038729-239038751 CACTGGATTCAGGGTCCCCCTGG No data
948589208_948589223 26 Left 948589208 2:239038680-239038702 CCTTCCCTTCTCCGTGTGTCTCC No data
Right 948589223 2:239038729-239038751 CACTGGATTCAGGGTCCCCCTGG No data
948589217_948589223 -7 Left 948589217 2:239038713-239038735 CCAGTAAGGATCCTCCCACTGGA No data
Right 948589223 2:239038729-239038751 CACTGGATTCAGGGTCCCCCTGG No data
948589211_948589223 15 Left 948589211 2:239038691-239038713 CCGTGTGTCTCCTCTTCTGTCCC No data
Right 948589223 2:239038729-239038751 CACTGGATTCAGGGTCCCCCTGG No data
948589214_948589223 -5 Left 948589214 2:239038711-239038733 CCCCAGTAAGGATCCTCCCACTG No data
Right 948589223 2:239038729-239038751 CACTGGATTCAGGGTCCCCCTGG No data
948589210_948589223 21 Left 948589210 2:239038685-239038707 CCTTCTCCGTGTGTCTCCTCTTC No data
Right 948589223 2:239038729-239038751 CACTGGATTCAGGGTCCCCCTGG No data
948589213_948589223 5 Left 948589213 2:239038701-239038723 CCTCTTCTGTCCCCAGTAAGGAT No data
Right 948589223 2:239038729-239038751 CACTGGATTCAGGGTCCCCCTGG No data
948589207_948589223 27 Left 948589207 2:239038679-239038701 CCCTTCCCTTCTCCGTGTGTCTC No data
Right 948589223 2:239038729-239038751 CACTGGATTCAGGGTCCCCCTGG No data
948589209_948589223 22 Left 948589209 2:239038684-239038706 CCCTTCTCCGTGTGTCTCCTCTT No data
Right 948589223 2:239038729-239038751 CACTGGATTCAGGGTCCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948589223 Original CRISPR CACTGGATTCAGGGTCCCCC TGG Intergenic
No off target data available for this crispr