ID: 948591568

View in Genome Browser
Species Human (GRCh38)
Location 2:239053956-239053978
Sequence GCTCACCTGCTCCCAGAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 163}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948591568_948591577 3 Left 948591568 2:239053956-239053978 CCTATCTCTGGGAGCAGGTGAGC 0: 1
1: 0
2: 1
3: 12
4: 163
Right 948591577 2:239053982-239054004 GGGATTGTCGCTGGGGCTGAGGG 0: 1
1: 0
2: 1
3: 19
4: 221
948591568_948591576 2 Left 948591568 2:239053956-239053978 CCTATCTCTGGGAGCAGGTGAGC 0: 1
1: 0
2: 1
3: 12
4: 163
Right 948591576 2:239053981-239054003 GGGGATTGTCGCTGGGGCTGAGG 0: 1
1: 0
2: 1
3: 31
4: 357
948591568_948591581 29 Left 948591568 2:239053956-239053978 CCTATCTCTGGGAGCAGGTGAGC 0: 1
1: 0
2: 1
3: 12
4: 163
Right 948591581 2:239054008-239054030 TTCTGCCTGGGCCCTCACAGAGG 0: 1
1: 0
2: 2
3: 24
4: 311
948591568_948591580 17 Left 948591568 2:239053956-239053978 CCTATCTCTGGGAGCAGGTGAGC 0: 1
1: 0
2: 1
3: 12
4: 163
Right 948591580 2:239053996-239054018 GGCTGAGGGGTCTTCTGCCTGGG 0: 1
1: 0
2: 0
3: 148
4: 1745
948591568_948591573 -6 Left 948591568 2:239053956-239053978 CCTATCTCTGGGAGCAGGTGAGC 0: 1
1: 0
2: 1
3: 12
4: 163
Right 948591573 2:239053973-239053995 GTGAGCTGGGGGATTGTCGCTGG 0: 1
1: 0
2: 1
3: 6
4: 103
948591568_948591575 -4 Left 948591568 2:239053956-239053978 CCTATCTCTGGGAGCAGGTGAGC 0: 1
1: 0
2: 1
3: 12
4: 163
Right 948591575 2:239053975-239053997 GAGCTGGGGGATTGTCGCTGGGG 0: 1
1: 0
2: 0
3: 11
4: 146
948591568_948591574 -5 Left 948591568 2:239053956-239053978 CCTATCTCTGGGAGCAGGTGAGC 0: 1
1: 0
2: 1
3: 12
4: 163
Right 948591574 2:239053974-239053996 TGAGCTGGGGGATTGTCGCTGGG 0: 1
1: 0
2: 0
3: 4
4: 90
948591568_948591579 16 Left 948591568 2:239053956-239053978 CCTATCTCTGGGAGCAGGTGAGC 0: 1
1: 0
2: 1
3: 12
4: 163
Right 948591579 2:239053995-239054017 GGGCTGAGGGGTCTTCTGCCTGG 0: 1
1: 0
2: 3
3: 23
4: 243
948591568_948591578 4 Left 948591568 2:239053956-239053978 CCTATCTCTGGGAGCAGGTGAGC 0: 1
1: 0
2: 1
3: 12
4: 163
Right 948591578 2:239053983-239054005 GGATTGTCGCTGGGGCTGAGGGG 0: 1
1: 0
2: 0
3: 20
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948591568 Original CRISPR GCTCACCTGCTCCCAGAGAT AGG (reversed) Intronic
900613411 1:3553851-3553873 GCCCACCTGTTCCCAGAAGTTGG - Intronic
901488143 1:9579662-9579684 GCATTCCTTCTCCCAGAGATAGG + Intronic
903008262 1:20312657-20312679 ACCCACCTGGTCCCAGAGCTGGG + Intronic
903194852 1:21677943-21677965 TCTCACCTTCCCCCATAGATAGG + Intergenic
903448422 1:23436991-23437013 GCTCACCTGCATCCAGTGCTCGG - Exonic
903985476 1:27224557-27224579 ACTAACCTGCTCCCTGAGAGAGG + Intergenic
904408919 1:30313140-30313162 GCTCAGCAGCCCCCAGTGATAGG - Intergenic
904852417 1:33468843-33468865 GCTCCCTTGCTGCCACAGATTGG + Intergenic
905463119 1:38134137-38134159 GCTCCCCTGCCCCCATGGATGGG + Intergenic
905464836 1:38145337-38145359 GCTGACCTGCAACCAAAGATGGG + Intergenic
907501310 1:54883578-54883600 CCCCACCTGCTCCCAGAGCCCGG + Intronic
915137158 1:153740635-153740657 TCTCACCCCTTCCCAGAGATTGG + Exonic
915308867 1:154997271-154997293 TCTCACCTGGTCCCAGTGATGGG + Intergenic
919362159 1:196609018-196609040 GCCCCCCTCCTCCCAGAGAAGGG - Exonic
920263966 1:204708159-204708181 CCCCACCTGCTCACAGGGATGGG + Intergenic
922415417 1:225417894-225417916 GATCACTTGATCCCAGAAATTGG + Intronic
923260380 1:232262239-232262261 GCTCACTTGAACCCAGAAATGGG - Intergenic
923523061 1:234750975-234750997 GATCGCCTGGTCCCACAGATAGG + Intergenic
1064811513 10:19204913-19204935 GCTCAGCTGCTCCCACTGACAGG - Exonic
1065092935 10:22252794-22252816 GATCGCCGGCTCCCAGAGAGTGG - Intergenic
1067777690 10:49175284-49175306 GCCACCCTGCTCCCAGAGGTGGG + Intronic
1070660291 10:78300797-78300819 GCTCAGCTGCTCCCTGGGAGAGG - Intergenic
1071181588 10:82990894-82990916 TCTATCCTGCTCCCAGAGATAGG - Intergenic
1073193356 10:101668143-101668165 GCTCACCTACCCCCGCAGATAGG + Intronic
1077167222 11:1149124-1149146 GCCCACCTGCTCCTGGAGCTGGG + Intergenic
1078098316 11:8313716-8313738 GCTCACATGCTCCCTGTGGTGGG - Intergenic
1083101679 11:60313616-60313638 GCACAACTGCTTCCAGACATTGG - Intergenic
1083277685 11:61606443-61606465 GCCCACCCCCTCCCAGAGCTGGG - Intergenic
1083343500 11:61973932-61973954 GCTTTCCTGCCCCCAGAGAAGGG + Intergenic
1090379870 11:126318975-126318997 GCCCAACTGCTCTCAGAGGTGGG - Intronic
1092263231 12:6963316-6963338 GCCCACCTGCCCCCAGAGAGTGG - Intergenic
1092750339 12:11713012-11713034 TCCCACCTGCTACCTGAGATGGG + Intronic
1095427785 12:42095888-42095910 TCTCCCCTGCTCCCAGACAAGGG - Intronic
1106089672 13:26579084-26579106 GCTCACCTGAGCCCGGAGTTTGG - Intronic
1106586264 13:31058832-31058854 GCTCACCTGCTCCAGAACATGGG - Intergenic
1106838186 13:33658835-33658857 CCTCTCCTCTTCCCAGAGATTGG - Intergenic
1112020623 13:95368080-95368102 CCACACCCGCTCCCAGAGCTAGG + Intergenic
1112787220 13:102964655-102964677 CTTCACATGCTACCAGAGATGGG - Intergenic
1113640299 13:111952534-111952556 GCTCACCTGCTCCCACTCAATGG + Intergenic
1114163406 14:20193893-20193915 GCTCTCCTGCTCCCACTGAGGGG - Intergenic
1114632080 14:24165507-24165529 GCTCACATCCTCCCAGTGCTAGG - Intronic
1116102539 14:40459770-40459792 GCTCACAGACTCCCAGAGAAAGG - Intergenic
1118319355 14:64743980-64744002 GCTCACTTCTTCCCAGAGAGAGG + Exonic
1121251677 14:92504436-92504458 GTTCACCTCCTCCCAGAATTGGG - Intergenic
1122722933 14:103732222-103732244 GCCCACCTGCACCCAGGGCTGGG - Intronic
1122941877 14:104985115-104985137 GCTCAGCTGCACCCACAGAGGGG + Intergenic
1124346966 15:28929489-28929511 GCCCATCAGCTCCCAGTGATAGG - Intronic
1128499538 15:68218239-68218261 GTTCACCTGCTTCCAGACACAGG + Intronic
1128701471 15:69807522-69807544 TCTCACCTTCTCCCAGAGGATGG - Intergenic
1129114197 15:73356081-73356103 GCTCACCTGCTCACACAGGAAGG + Intronic
1129393129 15:75230484-75230506 GCTCAAATGCTCCCAGTGACAGG - Intergenic
1132233117 15:100199804-100199826 GCTCACCTGGTCCCAGCCCTAGG - Intronic
1132393167 15:101453486-101453508 GCTCACCTCCTCCCTGACATGGG - Intronic
1132433354 15:101778034-101778056 GATAACCTGGTCCCACAGATGGG - Intergenic
1132760642 16:1507115-1507137 CCTCACCTGCGCCCAGGGATGGG + Intronic
1133385833 16:5369682-5369704 GCACACCTGCTTTCAGAGGTGGG + Intergenic
1137061210 16:35793067-35793089 TCTCACCTGTGCCCAGAGACTGG + Intergenic
1138442236 16:57042025-57042047 GCTCAGCTGCTCCCAGGGCTGGG + Exonic
1141275397 16:82583266-82583288 GCTCACCTCTTCCCAGAGGCTGG - Intergenic
1141766136 16:86061077-86061099 GCTCACATGCTCCTAGGAATGGG - Intergenic
1141800392 16:86304102-86304124 CCTCACCAGCTCCCAGAAACCGG - Intergenic
1141819302 16:86434062-86434084 GCTCTCCTCCTCCCAGGTATCGG - Intergenic
1144374692 17:14627457-14627479 GCTCACTTGCTGCCAGAGAGAGG + Intergenic
1145904072 17:28506863-28506885 GCTCCCCAGCTCCCAGAGCTGGG - Intronic
1146275713 17:31514392-31514414 GCCCACCAGCTCCCAGAGGCAGG - Intronic
1147374698 17:40016615-40016637 GCTCACCTGCTGCCAGATGGTGG - Exonic
1151360208 17:73584221-73584243 GCACACCTTCTCCCAGTGCTAGG + Intronic
1152500434 17:80705011-80705033 TGTCACCTGCTCCCATAGGTGGG - Intronic
1154324890 18:13382862-13382884 GCTCTCCTGCTGCCAGTGTTGGG + Intronic
1158158291 18:54450552-54450574 GGTCTCATGTTCCCAGAGATAGG - Intergenic
1159169921 18:64752954-64752976 CTTCCCCTGCTCCCAGACATTGG + Intergenic
1160557788 18:79737183-79737205 GCTCACCTGCTCCTTGTGACTGG + Intronic
1163400844 19:17091636-17091658 CCTCTCCTGCTCCCACAGGTGGG - Intronic
1163519652 19:17784357-17784379 GCTCATCGGCTCTCACAGATTGG - Intronic
1164399265 19:27891549-27891571 GCACACCTGCTCCCAGAGGCTGG + Intergenic
1164449088 19:28344446-28344468 GCTCACTGGCTCCCAGAGCACGG + Intergenic
1165739722 19:38198026-38198048 GCTCACCCTCTCCCAGCCATAGG + Intronic
1167294032 19:48639123-48639145 GCCCACCTGCTCCCAGGGGCGGG - Intronic
1168123312 19:54267250-54267272 ACTCAGTTGCTCCCAGAGCTCGG + Intronic
1168326232 19:55539850-55539872 GCACAGCTGCTGCCAGACATTGG - Intergenic
1168695279 19:58400741-58400763 CCTCATCTGCTCCCTGAGGTTGG - Intergenic
926991946 2:18689595-18689617 GCCCACCTGGTCCCAGAGGTAGG - Intergenic
927199142 2:20567761-20567783 GCTCAGCTACTCCCAGGGACTGG - Intronic
929086815 2:38176221-38176243 CCTCTCTTCCTCCCAGAGATGGG - Intergenic
930860767 2:56070740-56070762 TCTCTTCTGCTCCCAGAGCTAGG + Intergenic
932285063 2:70524953-70524975 GCTCACCTGGGCCCAGAGGATGG - Intronic
932493405 2:72135054-72135076 GCTGACCTGACCCCTGAGATGGG - Intronic
932558956 2:72850642-72850664 GCTCTGCTGCTCCCTGAGGTGGG + Intergenic
934529273 2:95075075-95075097 CGTCACCTGCTCCCAGGGTTGGG - Intergenic
935070754 2:99691746-99691768 GCTCACCTGCTGTCAGTGACAGG + Intronic
938090051 2:128425558-128425580 GCTGGCCAGCTCCCCGAGATGGG + Intergenic
948369597 2:237480290-237480312 GCACACGTGCTCCCAGGAATAGG + Intergenic
948591568 2:239053956-239053978 GCTCACCTGCTCCCAGAGATAGG - Intronic
948752770 2:240142037-240142059 CCTCACCTGCCCCCTGAGCTGGG + Intronic
948897869 2:240935563-240935585 GCCCACCTGCTCCTGGAGCTGGG - Intronic
1169066749 20:2698196-2698218 GCTCACCTGCCCCAGGAAATTGG - Intronic
1170781979 20:19434010-19434032 GTTAACCAGCTCCTAGAGATAGG - Intronic
1175599942 20:60265176-60265198 GCTCACAAGCTCACAGAGAAAGG - Intergenic
1176223875 20:63983249-63983271 GGTCAGCTGCTCCCAGAGACTGG - Intronic
1180594440 22:16964104-16964126 CCCCTCCAGCTCCCAGAGATCGG + Intronic
1180884978 22:19236044-19236066 GATCACCTGAGCCCAGAGGTCGG - Intronic
1182029451 22:27146260-27146282 GCACACCAGCTCCATGAGATAGG + Intergenic
1182183711 22:28378559-28378581 GATCACCTGACCCCAGAGGTTGG + Intronic
1182421719 22:30251692-30251714 GCTCTCCAGGGCCCAGAGATGGG - Intergenic
1183157162 22:36084488-36084510 CCCCACCTGGTCCCAGAAATGGG - Intergenic
1183364009 22:37397708-37397730 GCCGACCTGAACCCAGAGATCGG + Intronic
1184557587 22:45241347-45241369 GGTCACCTGCTCCCAGAAGGTGG + Intergenic
1184767622 22:46579820-46579842 CCTCCCCAGCTCCCCGAGATGGG - Intronic
949922304 3:9012700-9012722 ACTCCCCTGCTTCCTGAGATGGG + Intronic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
953745085 3:45567972-45567994 GCTCACCATCTCCAAGAGGTGGG + Intronic
954107996 3:48419571-48419593 CCTCACCAGCTCCCAGAGCCCGG + Exonic
954157394 3:48694113-48694135 GCTCCTCTGCACCCAGAGCTGGG - Intronic
954706442 3:52483262-52483284 GCTCAGCTGCTCCCCGGGACAGG - Intronic
961745265 3:129060522-129060544 CCTCACCTGCTCCCAGAAGGTGG - Intergenic
962337909 3:134553855-134553877 GCACACTTGCTCCTAGAGAATGG - Intronic
965524245 3:169699709-169699731 TCTCATCTGCTCACAGCGATGGG + Intergenic
969866442 4:10079628-10079650 ACTCAACTGCTCCCAGACAGTGG + Intronic
971425381 4:26510256-26510278 GCTCCCTTTCTCCCAGAGCTGGG + Intergenic
972374800 4:38460273-38460295 CCCCACCGCCTCCCAGAGATGGG + Intergenic
973775044 4:54234150-54234172 GCGCACCAGCTCCCGGTGATGGG + Intronic
975354780 4:73389006-73389028 TTTCTCCTTCTCCCAGAGATAGG + Intergenic
976303741 4:83538992-83539014 GCTCAGATGCTCCCAAACATAGG - Intronic
981298201 4:143156811-143156833 GCTGAACTGGGCCCAGAGATGGG - Intergenic
982082823 4:151807177-151807199 TCACATCTGCTCCCCGAGATGGG + Intergenic
982337360 4:154255514-154255536 GCTCACCAGCTCCTACAGGTTGG - Exonic
983296330 4:165873498-165873520 GCTCAGCTGCCACCAGAGCTCGG - Exonic
985053205 4:186013271-186013293 GTTCACCAGTTCCCAGAGACGGG - Intergenic
986995297 5:13601005-13601027 ACTCAGCTGCTCCCAGGAATTGG + Intergenic
987021563 5:13878016-13878038 TCCCGTCTGCTCCCAGAGATAGG - Intronic
990033645 5:51292474-51292496 CCTCTCCTGACCCCAGAGATAGG + Intergenic
992230060 5:74655039-74655061 GCTCACCTGCTCCCATGGCCTGG - Intronic
999090556 5:148932144-148932166 GCTTAGCTGCTCCCAGGGCTGGG + Intronic
1000319928 5:160126179-160126201 GATCACCTGCTCCCAGACCAAGG + Intergenic
1012061610 6:94491172-94491194 CCTGCTCTGCTCCCAGAGATAGG + Intergenic
1014820734 6:125986316-125986338 GCTCACCAGCTACCAGCGCTGGG + Intergenic
1017947048 6:159104349-159104371 GCTCACATCCTCCCAGGCATGGG - Intergenic
1019915167 7:4128479-4128501 TCTGAACTGCTCCCTGAGATCGG - Intronic
1022923977 7:35042185-35042207 TCTCACCTGCCCCCAGACACAGG + Intergenic
1022945454 7:35279519-35279541 TCTCACCTGCTCCCAGAGAATGG - Intergenic
1024533468 7:50411305-50411327 CCTCCCCTACTCCCAGAGAAAGG + Intergenic
1024996657 7:55277846-55277868 GTTCACCTGGTGACAGAGATGGG + Intergenic
1025052339 7:55741702-55741724 GCTCTTCTGCTGCCAGAGCTGGG - Intergenic
1025052732 7:55743250-55743272 GCTCTTCTGCTGCCAGAGCTGGG - Intergenic
1025129293 7:56367385-56367407 GCTCTTCTGCTGCCAGAGCTGGG - Intergenic
1025130012 7:56370236-56370258 GCTCTTCTGCTGCCAGAGCTGGG - Intergenic
1025130318 7:56371486-56371508 GCTCTTCTGCTGCCAGAGCTGGG - Intergenic
1025130638 7:56372784-56372806 GCTCTTCTGCTGCCAGAGCTGGG - Intergenic
1025130954 7:56374078-56374100 GCTCTTCTGCTGCCAGAGCTGGG - Intergenic
1026624042 7:71976546-71976568 GCTGAGATGTTCCCAGAGATGGG + Intronic
1027221078 7:76214297-76214319 GCTCACCTGTTCCCAGGGCAAGG + Intronic
1029515543 7:101020930-101020952 CCTCACCTGCCCCCAGAGAAGGG + Intronic
1029822292 7:103157958-103157980 TCTCACCTGCCCCCAGACACAGG + Intergenic
1030689160 7:112515123-112515145 TCTGACCTCCTCCCAGAGTTTGG + Intergenic
1032024647 7:128431379-128431401 GCTCACTTCCTCCCCGAGCTGGG + Intergenic
1035738819 8:1909874-1909896 GCTCACCTGCTCACACTGCTGGG + Intronic
1036634808 8:10541539-10541561 GCTCACCTGATTACAGAGACTGG - Intronic
1037493143 8:19414263-19414285 GTTCACCCTCTGCCAGAGATAGG - Intronic
1039771213 8:40688886-40688908 GCTCATCCTCTCCCAGAGGTGGG - Intronic
1041271525 8:56113800-56113822 GCACACCTGCTCCCAGTCAATGG + Exonic
1041730031 8:61053627-61053649 CCTCCCCTGGTCACAGAGATTGG + Intergenic
1043600211 8:81928564-81928586 GCACAGCTGCTGCCAGAGGTTGG - Intergenic
1048376128 8:133823975-133823997 TCTCAGCTTCTGCCAGAGATTGG + Intergenic
1050133823 9:2441056-2441078 GCTCTCCTTCTCCTAGGGATGGG + Intergenic
1051560907 9:18438958-18438980 ACTCCCCTGCTGCCAGTGATGGG + Intergenic
1057545553 9:96017707-96017729 GCTCAGCTGCATACAGAGATGGG - Intergenic
1058974705 9:110115132-110115154 CCTCAGCTGCTCCCAGAGTCTGG + Intronic
1060409239 9:123389233-123389255 GCTCACTTCCTCCCAGAGGCTGG + Intronic
1060556190 9:124508215-124508237 GCCCATCTGGGCCCAGAGATTGG - Intergenic
1061911198 9:133725906-133725928 CCTTTCCTGCTCCCAGAGACAGG - Intronic
1062065757 9:134525401-134525423 CCTCACATGATCCCAGAGAGAGG + Intergenic
1191777393 X:64830435-64830457 ACTCACATGCTCCCACAGTTGGG + Intergenic
1195582878 X:106528686-106528708 GCCCATCTGCTCTCAGAGACAGG + Intergenic
1196456070 X:115892614-115892636 GCCCGTCTTCTCCCAGAGATTGG + Intergenic
1196967714 X:121076686-121076708 CCCCATCTGCTCCCAGATATAGG + Intergenic
1197372494 X:125641901-125641923 GCTCAAGTGCTGGCAGAGATTGG + Intergenic
1197634012 X:128893702-128893724 GCACACCTTCACCCAGACATGGG + Intergenic