ID: 948591649

View in Genome Browser
Species Human (GRCh38)
Location 2:239054306-239054328
Sequence GGTCGGTGCCAGAACTCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 113}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948591645_948591649 -4 Left 948591645 2:239054287-239054309 CCAGGACCTGCTGCTTGAGGGTC 0: 1
1: 0
2: 2
3: 16
4: 199
Right 948591649 2:239054306-239054328 GGTCGGTGCCAGAACTCAGAGGG 0: 1
1: 0
2: 0
3: 4
4: 113
948591637_948591649 30 Left 948591637 2:239054253-239054275 CCTCTGAGATAGGCTGCGTGCCA 0: 1
1: 0
2: 0
3: 9
4: 88
Right 948591649 2:239054306-239054328 GGTCGGTGCCAGAACTCAGAGGG 0: 1
1: 0
2: 0
3: 4
4: 113
948591647_948591649 -10 Left 948591647 2:239054293-239054315 CCTGCTGCTTGAGGGTCGGTGCC 0: 1
1: 0
2: 1
3: 7
4: 120
Right 948591649 2:239054306-239054328 GGTCGGTGCCAGAACTCAGAGGG 0: 1
1: 0
2: 0
3: 4
4: 113
948591644_948591649 -3 Left 948591644 2:239054286-239054308 CCCAGGACCTGCTGCTTGAGGGT 0: 1
1: 0
2: 0
3: 9
4: 196
Right 948591649 2:239054306-239054328 GGTCGGTGCCAGAACTCAGAGGG 0: 1
1: 0
2: 0
3: 4
4: 113
948591640_948591649 5 Left 948591640 2:239054278-239054300 CCCTTGCACCCAGGACCTGCTGC 0: 1
1: 0
2: 2
3: 31
4: 273
Right 948591649 2:239054306-239054328 GGTCGGTGCCAGAACTCAGAGGG 0: 1
1: 0
2: 0
3: 4
4: 113
948591641_948591649 4 Left 948591641 2:239054279-239054301 CCTTGCACCCAGGACCTGCTGCT 0: 1
1: 0
2: 4
3: 50
4: 376
Right 948591649 2:239054306-239054328 GGTCGGTGCCAGAACTCAGAGGG 0: 1
1: 0
2: 0
3: 4
4: 113
948591639_948591649 10 Left 948591639 2:239054273-239054295 CCACGCCCTTGCACCCAGGACCT 0: 1
1: 0
2: 2
3: 22
4: 289
Right 948591649 2:239054306-239054328 GGTCGGTGCCAGAACTCAGAGGG 0: 1
1: 0
2: 0
3: 4
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948591649 Original CRISPR GGTCGGTGCCAGAACTCAGA GGG Intronic
900538062 1:3188670-3188692 AGTCGGTGCCCGAACTCGCAAGG - Intronic
901220603 1:7581514-7581536 GCTGGGTGCCAGAAATCAGGAGG + Intronic
903192284 1:21663513-21663535 GCTCGGTGCCAGAACTGCCAGGG - Intronic
904277796 1:29395479-29395501 GGGCAGAGCCAGAACTCAGCGGG + Intergenic
904441304 1:30533818-30533840 GGTCAGTGGCAGATTTCAGATGG - Intergenic
907258023 1:53195062-53195084 GGTAGGGGTCAGAATTCAGAAGG + Intergenic
917450220 1:175141770-175141792 GGTCTGTGCCCAAACTCAGAGGG - Intronic
922908763 1:229197821-229197843 GGTCCCTGCCAGCCCTCAGATGG - Intergenic
924409075 1:243784573-243784595 GCCTGGTGCCAGAACTCGGAGGG - Intronic
1073325316 10:102641484-102641506 GGTAGGGGCCAGAACACACAGGG - Intergenic
1075225330 10:120624050-120624072 GTTCGGTGGCAGAACAGAGAGGG + Intergenic
1076622186 10:131797710-131797732 GGTGGGTGCCAGCATACAGATGG - Intergenic
1077040712 11:520757-520779 GGACGGAGACAGAACTCAGGCGG - Intergenic
1078758693 11:14234578-14234600 GGCCAGTGCCAGCACACAGAAGG + Intronic
1079463818 11:20709030-20709052 GATAGGTGGCAGAACTCAGGTGG + Intronic
1080696377 11:34606312-34606334 GGTAGGTGCCAGGTCACAGAGGG + Intergenic
1083332832 11:61906956-61906978 GGGCGGTCCCAGAACTCTCATGG - Intronic
1083949657 11:65947061-65947083 GGTCGGCGCCAGCCCCCAGAGGG - Intronic
1084426895 11:69088991-69089013 GGTCTGTGCCCGAGCTCAGCGGG + Intronic
1085434842 11:76491481-76491503 GGAAGGTGTCAGAACTCAGGCGG - Intronic
1091993809 12:4977237-4977259 TGCCGGTGCCACCACTCAGAAGG - Intergenic
1092885125 12:12918213-12918235 GGTCCCAGCCAGTACTCAGAAGG - Intergenic
1093995300 12:25634729-25634751 GTTTTGTGCCAGTACTCAGAGGG - Intronic
1094345904 12:29468945-29468967 GGCTGGTGCTAGAACTGAGAAGG + Intronic
1095487514 12:42700199-42700221 TGTAGGAGGCAGAACTCAGATGG - Intergenic
1100702400 12:97162320-97162342 GGTCTGTGCCATAAATCACATGG - Intergenic
1101846365 12:108366285-108366307 CGTCCGTTCCTGAACTCAGAAGG - Intergenic
1103254288 12:119527477-119527499 GATAGGTCCCAGAAGTCAGAGGG + Intronic
1105892173 13:24689629-24689651 GGTCCCTTCCAGAACCCAGAAGG - Intronic
1107453888 13:40536830-40536852 GGTAGGTGCCAGCAGTCACATGG - Intergenic
1107997989 13:45879645-45879667 GGTTGGTGTGAGGACTCAGAAGG + Intergenic
1110519911 13:76463474-76463496 GGTTGATGTTAGAACTCAGAGGG - Intergenic
1112407991 13:99137738-99137760 GGTGGGGGACATAACTCAGAAGG + Intergenic
1112440105 13:99418836-99418858 GGTGGGGGCCAGAATTCAGGGGG + Intergenic
1115480632 14:33857846-33857868 GGGCAGAGCCAGATCTCAGAGGG - Intergenic
1115728056 14:36238712-36238734 GGGAGGTGCCAGTCCTCAGATGG + Intergenic
1117297779 14:54394771-54394793 GGTCTCTGCCAGCACACAGAGGG + Intergenic
1117340489 14:54787728-54787750 AGTCTGTGCCAGAACTGACAAGG - Intronic
1120881914 14:89420178-89420200 GGTGGGTGCTAAAAGTCAGAAGG - Intronic
1120906455 14:89625227-89625249 GGCCTGAGCCAGAACTGAGAAGG - Intergenic
1121465959 14:94115739-94115761 GGTCGGTGCGTGGGCTCAGAAGG - Intronic
1122920071 14:104876406-104876428 GGGAGGAGCCAGAACTGAGAGGG - Intronic
1132087425 15:98919769-98919791 GGACTCTGCCAGAACTCAGTAGG - Intronic
1132888652 16:2193870-2193892 GGAAGGTCCCAGAACTGAGAAGG + Intronic
1133288808 16:4704437-4704459 GGTCTGTCCCAGAGCTCAGCTGG - Intronic
1137676508 16:50306264-50306286 GGATGCTGCCAGAACCCAGAAGG - Intronic
1142224209 16:88869747-88869769 GGCCGGGGCCCGAGCTCAGAGGG - Intergenic
1142761377 17:2043828-2043850 GGTCGATGCCAGACCTTAGGTGG + Intergenic
1142849133 17:2695884-2695906 GGACGGGGCCAGAGCTCAGTGGG - Intronic
1143642025 17:8204591-8204613 GGTGGGTGTCAGAGCTGAGAGGG + Intergenic
1148072279 17:44915378-44915400 GGCGGGTGCCAGGACCCAGACGG + Exonic
1151321626 17:73356150-73356172 GTTCGGTGCCAGAAATGAGGTGG - Intronic
1155446707 18:25920748-25920770 GTTTGGTGCTAGAAATCAGATGG - Intergenic
1156232144 18:35164115-35164137 GGTCGGAGGCAGAACTCTAAAGG - Intergenic
1157732938 18:50020449-50020471 GGTAGGATCCAGAGCTCAGATGG - Intronic
1162564071 19:11435518-11435540 GGGCGGTGCCAGAGCCGAGACGG - Intronic
1163633883 19:18429668-18429690 GGTGGGGGCCAGAGCCCAGAGGG + Intronic
1165425773 19:35744711-35744733 GGGCGGGGCCTGAGCTCAGAGGG + Exonic
1166109100 19:40611900-40611922 GGCCGGTGTGAGAACACAGAAGG + Exonic
926744524 2:16139769-16139791 GGTGGCTCCCAGAACCCAGAGGG - Intergenic
932714196 2:74089794-74089816 GGTGGGTGCCAGGGCTCAGCAGG + Intronic
935103521 2:100019077-100019099 GGCTGGTGCCTGAAGTCAGAAGG + Intronic
936454891 2:112665485-112665507 AGGCAGTGCCAGAACTCTGAGGG - Intergenic
937469032 2:122159419-122159441 GCTCAGAGCCAGATCTCAGAAGG + Intergenic
937656203 2:124379698-124379720 GGGCGCTGCCAGACCTCACAAGG - Intronic
938884225 2:135626440-135626462 GGTGGGAACCAGAACTCAGTGGG + Intronic
939535917 2:143428336-143428358 GGTCAGTGCCAGAGCACACAGGG + Intronic
939996935 2:148928554-148928576 GGTCGGTGCCACATCACACAGGG - Intronic
942201626 2:173577199-173577221 GGTTGTTTCCAGAACTCTGACGG - Intergenic
946657210 2:221961243-221961265 GGTAGGGGCCAGAACACACAGGG + Intergenic
947703949 2:232259446-232259468 GGTCAGGGCCAGCAATCAGAGGG + Intronic
947791021 2:232869402-232869424 GGGCGCTGACAGAACTCTGAGGG + Intronic
947999080 2:234552938-234552960 GGTGGGTGCCTGTACTCAGGAGG + Intergenic
948591649 2:239054306-239054328 GGTCGGTGCCAGAACTCAGAGGG + Intronic
1170570514 20:17629730-17629752 TGCCAGTGCCAGAACTCAGTGGG - Intronic
1170884043 20:20322695-20322717 GGAAGATGCCAGAACTCTGAGGG - Intronic
1170959118 20:21009437-21009459 GGATGGGGCCAGAATTCAGATGG - Intergenic
949847748 3:8389239-8389261 AGTAGGTCCCAGAACACAGAAGG + Intergenic
950528795 3:13540525-13540547 GGGTGGGGCCAGAACCCAGAAGG + Intergenic
950637178 3:14323497-14323519 GGTGGCTGCCAGCCCTCAGATGG - Intergenic
961016885 3:123475440-123475462 TGCCTGTGCCAGGACTCAGAGGG + Intergenic
963751426 3:149183811-149183833 GGTAGAGGCCAGGACTCAGATGG - Intronic
969260723 4:6031578-6031600 GGTCGGGGACAGAGCTCAGAGGG + Intronic
975322914 4:73028346-73028368 GGTCTTTTCCAGTACTCAGATGG - Intergenic
978260637 4:106753263-106753285 GGTAGCAGCCAGGACTCAGAGGG - Intergenic
985038044 4:185861166-185861188 GGTCAGTGCCTGAACTCCAAAGG + Intronic
990993569 5:61708538-61708560 GGTAACTGACAGAACTCAGATGG + Intronic
991439121 5:66627918-66627940 GGTGGGGGGCAGAACACAGATGG - Intronic
994479774 5:100319730-100319752 GGTCTGTGCCAGGACTATGAGGG - Intergenic
995438726 5:112166205-112166227 GGTCACTGCCAGAACTCTGGTGG + Intronic
996887699 5:128377814-128377836 GGTCGATGCGTGAACACAGATGG - Exonic
999183709 5:149689746-149689768 GGGAGGTGTCAGAACTAAGATGG + Intergenic
999836635 5:155380478-155380500 AGTCTGGGCCAGAAATCAGAAGG - Intergenic
1000885425 5:166743175-166743197 GGTCGGGGGGAGAAGTCAGATGG + Intergenic
1001234396 5:170017310-170017332 GATGGGTGCCAAAACTCACAAGG + Intronic
1002890531 6:1327729-1327751 GGTAGGTGCCAGAAATAAGTAGG + Intergenic
1005994626 6:30923751-30923773 AGTCGGTGTCAGAAGGCAGAGGG + Intronic
1008430796 6:51414375-51414397 GGTGGGTAACAGAACACAGAGGG + Intergenic
1008602867 6:53112692-53112714 GGCCAGTGCCACACCTCAGAAGG + Intergenic
1018711399 6:166500365-166500387 GGTGGCTGCCAGGGCTCAGATGG + Intronic
1018874258 6:167806193-167806215 GGTGGGTGCCAGGACTCTGAAGG + Intergenic
1021503421 7:21354616-21354638 GGCAGGTCCCAGATCTCAGATGG - Intergenic
1035724719 8:1817470-1817492 GGACGCTGCCTGAGCTCAGAGGG - Intergenic
1035817851 8:2561067-2561089 GGTGGGTGCAGGGACTCAGAAGG - Intergenic
1037486873 8:19356319-19356341 GGTTGGTGCCACCATTCAGAAGG - Intronic
1037519407 8:19665428-19665450 GTCCGGGGCCAAAACTCAGAAGG + Intronic
1039232582 8:35464960-35464982 GATAAGTGCCAGAACTCATATGG - Intronic
1043326041 8:79052811-79052833 GGTAGGTACCAGAACTGAGAGGG - Intergenic
1046169337 8:110485221-110485243 GGCCGGTGCCAGCACTCACTTGG - Intergenic
1046739250 8:117811161-117811183 GTTTGTTGCCAGGACTCAGATGG + Intronic
1047310877 8:123690817-123690839 AGTCAGTGCCAGAGCACAGAGGG - Intronic
1049112046 8:140652533-140652555 GGTAGGTGCCAGAACTGGGTTGG - Intergenic
1056581314 9:87889475-87889497 GGTCCATCCCAGAACTCAGCAGG - Intergenic
1056926510 9:90839170-90839192 GGTGGGTGCCAGTCCTGAGAAGG + Intronic
1060729357 9:126027465-126027487 CCTCGGTGCAAGAACTCAGCAGG - Intergenic
1062578046 9:137217688-137217710 GGTCAGTGCCAGAGCTCTGGTGG + Intergenic
1193891935 X:87058408-87058430 GGTTGGTACCAGATCTTAGAAGG + Intergenic
1197756497 X:129999139-129999161 GGTCTGGGACAGAAATCAGAGGG - Intronic