ID: 948592186

View in Genome Browser
Species Human (GRCh38)
Location 2:239058109-239058131
Sequence TCTGGCACCCTAATTGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 83}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948592180_948592186 0 Left 948592180 2:239058086-239058108 CCACCTGGGTGCTCTGTGTCTAC 0: 1
1: 0
2: 1
3: 17
4: 212
Right 948592186 2:239058109-239058131 TCTGGCACCCTAATTGGGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 83
948592181_948592186 -3 Left 948592181 2:239058089-239058111 CCTGGGTGCTCTGTGTCTACTCT 0: 1
1: 0
2: 1
3: 18
4: 224
Right 948592186 2:239058109-239058131 TCTGGCACCCTAATTGGGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 83
948592179_948592186 1 Left 948592179 2:239058085-239058107 CCCACCTGGGTGCTCTGTGTCTA 0: 1
1: 0
2: 4
3: 15
4: 229
Right 948592186 2:239058109-239058131 TCTGGCACCCTAATTGGGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948592186 Original CRISPR TCTGGCACCCTAATTGGGGC TGG Intronic
903888569 1:26555266-26555288 TCTGACCCCCAAACTGGGGCTGG - Intronic
912498006 1:110103641-110103663 TCTGGCACCAGAATTGGGGGTGG - Intergenic
915036715 1:152933896-152933918 TCTGGGACCTTATTTGGGCCTGG + Intergenic
915070148 1:153259975-153259997 TCTGGCACCCGCATAGGGGCAGG + Intronic
915127895 1:153678682-153678704 TCTGGCACACTCCCTGGGGCAGG + Exonic
922464275 1:225835948-225835970 TCTGGCACCCTGCCCGGGGCTGG + Intronic
1070446857 10:76513684-76513706 TCTGGCCCTTTAAGTGGGGCAGG + Intronic
1076063662 10:127431579-127431601 CCTGGCACCATCATTGGTGCAGG + Intronic
1076269537 10:129139470-129139492 TCTGGCACCCAAATTGCCTCTGG - Intergenic
1077317796 11:1927101-1927123 TCTGGCTTGCTAACTGGGGCAGG - Intronic
1078006390 11:7535682-7535704 GCTGGCATCCAAATTGGAGCCGG - Intronic
1083750111 11:64756150-64756172 TCAGTCACCCTGATTGGTGCAGG + Intronic
1086364839 11:86098449-86098471 TCTGGCTCCTTCATTTGGGCTGG + Intergenic
1089348199 11:117805275-117805297 TCTGCCACCCTCACTGGGGCTGG - Intronic
1096878962 12:54651883-54651905 TCTGGCATCCTCACTGGGGCTGG - Intergenic
1098197982 12:68022439-68022461 TCTGGCAGCTTAACTGAGGCTGG - Intergenic
1105004236 12:132711046-132711068 TCTGGGACCCCAACTGGGACAGG + Exonic
1111574372 13:90132207-90132229 TCTGGCACCATTGCTGGGGCTGG - Intergenic
1116313676 14:43359701-43359723 TGTGACACCCTCTTTGGGGCCGG - Intergenic
1118410313 14:65470727-65470749 CCTGGCACCCTCAGTGGGGTGGG + Intronic
1119157838 14:72427961-72427983 TCTGCCACCTAAATTGGGGTTGG - Intronic
1121133930 14:91477566-91477588 TCTGCCACCTTAATTGGGCTTGG - Intronic
1122051396 14:99063031-99063053 TCTGGCAATCAAAATGGGGCTGG - Intergenic
1130872618 15:87983311-87983333 TGTGGCACCCTGACTGGGGTGGG - Intronic
1131681170 15:94725355-94725377 TCTGGCCCCAGAATTGGAGCAGG - Intergenic
1131763175 15:95646307-95646329 TCTGGCACCCTGACTGTGCCAGG + Intergenic
1133131094 16:3676467-3676489 TCTGGCACCCGATTTGGAGCTGG - Intronic
1135136061 16:19885831-19885853 TCCGGCACCCCATATGGGGCTGG + Intronic
1136491952 16:30614370-30614392 TCTAGCCTCCTAATTGTGGCTGG + Intronic
1139348182 16:66317994-66318016 TCTGGGACCCTAATCTGGCCTGG + Intergenic
1142408416 16:89903883-89903905 CCTGGCAGCCTCCTTGGGGCTGG + Intronic
1143581418 17:7829669-7829691 TCTGGCACCCCAAATTGTGCTGG + Intronic
1143787262 17:9265287-9265309 TCTGGGGCCCAGATTGGGGCAGG + Intronic
1145007294 17:19344848-19344870 TCTGGCTCCCTCCTTGGGGTTGG - Intronic
1145896477 17:28461068-28461090 CAGGGCACCCTGATTGGGGCTGG + Intronic
1146280117 17:31539257-31539279 TCTGGCAGCCTAAGTTGGGAAGG - Intergenic
1148020458 17:44549808-44549830 TCTGGCAGGCTCATTGGAGCAGG + Intergenic
1150515518 17:65806099-65806121 TATAGCACCCTAATTGAGACTGG - Intronic
1152021867 17:77783993-77784015 TCTGGCACCCAGTTTGGGGGTGG + Intergenic
1152809810 17:82376055-82376077 TCTGGCACCTGATGTGGGGCAGG + Intergenic
1160906747 19:1455290-1455312 TCCCGCACCCTGAGTGGGGCGGG - Intronic
1163739717 19:19003948-19003970 TCTGGCACTCTACTTGCTGCTGG - Intronic
1163745233 19:19042948-19042970 TGTGGCACCCCCAGTGGGGCGGG - Intronic
1166179077 19:41094503-41094525 TCTAGAACACTAATGGGGGCAGG - Intronic
928000687 2:27520729-27520751 TCTAGCACCCAAATTGAGGTGGG + Intronic
929427272 2:41856085-41856107 TCTGGCACCTGCTTTGGGGCAGG + Intergenic
935244209 2:101204175-101204197 TCTGGCCCCCTAAGCTGGGCAGG - Intronic
947813833 2:233022896-233022918 CCTCGCATCCTAATTGGGCCAGG + Intergenic
948515405 2:238500256-238500278 TCTTGCCCCCAAAGTGGGGCTGG - Intergenic
948592186 2:239058109-239058131 TCTGGCACCCTAATTGGGGCTGG + Intronic
949075460 2:242055032-242055054 TCCGGGAACCTAACTGGGGCTGG - Intergenic
1170693345 20:18635057-18635079 TCTAGCTCCCTAATTGTGGTTGG + Intronic
1172272203 20:33660964-33660986 TCTGCCACCCTGAGAGGGGCTGG - Intronic
1173723892 20:45283542-45283564 CCTGGCACCCAACTTGAGGCTGG + Intergenic
1173908038 20:46642908-46642930 TCTGCCAGCCTAATGTGGGCAGG + Intronic
1176302533 21:5105372-5105394 TCTGGCACCATAACTGTGGGAGG + Intergenic
1178406898 21:32331901-32331923 TCTGACACCCCAGTGGGGGCAGG - Intronic
1179854494 21:44156551-44156573 TCTGGCACCATAACTGTGGGAGG - Intergenic
1180856362 22:19048390-19048412 TCAGCCTCCCTATTTGGGGCTGG - Intronic
1182144519 22:27989065-27989087 ACTGGGCCCCTAAGTGGGGCAGG + Intronic
950126966 3:10515587-10515609 TCTGGGACCTCAGTTGGGGCTGG - Intronic
954946209 3:54426621-54426643 TTGTGCACACTAATTGGGGCTGG - Intronic
956705047 3:71992434-71992456 TCTGGAGACCTAATTGGAGCTGG + Intergenic
960767090 3:121144743-121144765 TCTTCCACCCTAATAAGGGCTGG - Intronic
962041786 3:131714898-131714920 TCTGTCATCATAAGTGGGGCTGG - Intronic
966880187 3:184345658-184345680 CCTGGCCCCCTAATGGGGCCTGG + Intronic
975455452 4:74585097-74585119 TCTGCCACCCTGATGGGGGATGG + Intergenic
976266467 4:83190190-83190212 TCTGGCACCCAAAGTAGGGGTGG - Intergenic
976839605 4:89416434-89416456 TCTGGCACCCAAAATAAGGCTGG - Intergenic
978456040 4:108892986-108893008 TATCCCACCCTAATTGGTGCCGG - Intronic
979417426 4:120460767-120460789 TTTGGTACCCTAATGGTGGCTGG + Intergenic
982009460 4:151092797-151092819 TCTGGCACCTTAATTAAGTCTGG - Intergenic
988368936 5:30342114-30342136 TCTTGCACCGTCATTGAGGCTGG + Intergenic
989550785 5:42733799-42733821 TATTGCCCCCTAATTGAGGCAGG - Intergenic
1005316030 6:24603711-24603733 TGTGGCAGCCTAATGGGGGCAGG + Intronic
1005655596 6:27933259-27933281 TCTGGCTCCTTATCTGGGGCTGG + Intergenic
1012473603 6:99597532-99597554 TCTGGCACCACAATAGGGGAGGG + Intergenic
1018750968 6:166805448-166805470 TCTGGCCCCCAAGTTGGGGGAGG - Intronic
1024381709 7:48704208-48704230 TCTGACACCCTAATCTGGACAGG - Intergenic
1026580470 7:71611975-71611997 ACTTGCACCCAAATTGTGGCTGG - Intronic
1028422894 7:90653196-90653218 TCTAGAAGCCTAAGTGGGGCTGG - Intronic
1032069938 7:128798211-128798233 TCTGGAACCCTATTTTCGGCCGG - Intronic
1041077177 8:54179238-54179260 TCTGGCACCCTGACTGGGTGGGG + Intergenic
1046395478 8:113633656-113633678 CCTGGCACCCTCAGTGGGGTGGG + Intergenic
1047697114 8:127415053-127415075 TCTGGGAGCCTAACGGGGGCTGG - Intronic
1047709591 8:127538427-127538449 ACTGGCCCCCAAATTGGGGAAGG - Intergenic
1050005757 9:1128660-1128682 TCTCGCATCTTAATTGGGGAAGG - Intergenic
1054970492 9:71080285-71080307 GCTAGCACCCTAATGGTGGCAGG + Intronic
1197658645 X:129145834-129145856 TTTATCACCCTAATTGTGGCAGG - Intergenic
1201347467 Y:13000512-13000534 TCTGGCATCCAACGTGGGGCCGG - Intergenic