ID: 948592374

View in Genome Browser
Species Human (GRCh38)
Location 2:239059748-239059770
Sequence GGACAGGGAGAACACTCCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 118}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948592370_948592374 -10 Left 948592370 2:239059735-239059757 CCACTCCTCCAGAGGACAGGGAG 0: 1
1: 0
2: 6
3: 41
4: 300
Right 948592374 2:239059748-239059770 GGACAGGGAGAACACTCCTAGGG 0: 1
1: 0
2: 2
3: 11
4: 118
948592363_948592374 23 Left 948592363 2:239059702-239059724 CCAGTCAAGGAACAGATTATCCT 0: 1
1: 0
2: 3
3: 7
4: 131
Right 948592374 2:239059748-239059770 GGACAGGGAGAACACTCCTAGGG 0: 1
1: 0
2: 2
3: 11
4: 118
948592367_948592374 -7 Left 948592367 2:239059732-239059754 CCTCCACTCCTCCAGAGGACAGG 0: 1
1: 0
2: 0
3: 38
4: 299
Right 948592374 2:239059748-239059770 GGACAGGGAGAACACTCCTAGGG 0: 1
1: 0
2: 2
3: 11
4: 118
948592366_948592374 -3 Left 948592366 2:239059728-239059750 CCTACCTCCACTCCTCCAGAGGA 0: 1
1: 0
2: 0
3: 37
4: 325
Right 948592374 2:239059748-239059770 GGACAGGGAGAACACTCCTAGGG 0: 1
1: 0
2: 2
3: 11
4: 118
948592364_948592374 3 Left 948592364 2:239059722-239059744 CCTGATCCTACCTCCACTCCTCC 0: 1
1: 0
2: 2
3: 36
4: 484
Right 948592374 2:239059748-239059770 GGACAGGGAGAACACTCCTAGGG 0: 1
1: 0
2: 2
3: 11
4: 118
948592362_948592374 24 Left 948592362 2:239059701-239059723 CCCAGTCAAGGAACAGATTATCC 0: 1
1: 0
2: 0
3: 13
4: 121
Right 948592374 2:239059748-239059770 GGACAGGGAGAACACTCCTAGGG 0: 1
1: 0
2: 2
3: 11
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948592374 Original CRISPR GGACAGGGAGAACACTCCTA GGG Intronic
900081653 1:863044-863066 GGGGATGGAGAACTCTCCTAGGG + Intergenic
901528815 1:9841150-9841172 GGTCAGGGTGAACACTCTGAGGG + Intergenic
908381924 1:63605010-63605032 CGACAATGTGAACACTCCTATGG - Intronic
915634504 1:157176883-157176905 GCACAGGCAGAACACCCCGAAGG - Intergenic
918918872 1:190678819-190678841 GTAGAGGGAGAACAGTACTAGGG - Intergenic
919367939 1:196688839-196688861 AGACAGGCAGATCACTCGTAAGG - Intronic
920783186 1:209014388-209014410 GGAGAGCCAGAACACTCCCAAGG - Intergenic
1064861823 10:19835044-19835066 GAACAGAGAGAACAATCCTGGGG + Intronic
1065816405 10:29487091-29487113 CGTCAGGAAGAACACTCCTCCGG + Intronic
1065949207 10:30636646-30636668 GAACAGGGAGCTCAGTCCTAAGG - Intergenic
1066220731 10:33335028-33335050 GGACGGGGAGAGCACTCGGAGGG - Intronic
1067057858 10:43062785-43062807 AGACAGGGAGAACACACCCTAGG + Intergenic
1069487607 10:68834304-68834326 GGAGAGGAAGAACAGTGCTAGGG + Intronic
1069647125 10:70008734-70008756 GGACAGAGTGATGACTCCTAAGG - Intergenic
1073961588 10:108936569-108936591 GATCAAGCAGAACACTCCTAAGG - Intergenic
1074123162 10:110508289-110508311 GGACAGGGAGAACAAGTCAAGGG - Intronic
1074152326 10:110768262-110768284 GGAGAGGGAGAACTTTCTTATGG + Intronic
1074261640 10:111859723-111859745 GAACACAGAGAACATTCCTAGGG - Intergenic
1077129007 11:960152-960174 GGACAGGCAGAACACAGCTTGGG + Intronic
1080140749 11:28916999-28917021 GGACAGGAACAACACACCTGGGG + Intergenic
1082774742 11:57236470-57236492 GGACTTGGAGAACACCACTAAGG - Exonic
1084345021 11:68541268-68541290 GAGCAGGCAGAGCACTCCTAAGG - Intronic
1085887555 11:80537961-80537983 AGAGAGGGAGAACACTTATAAGG - Intergenic
1089307839 11:117537825-117537847 GGCCAGGAAGAACCCTCCTCTGG + Intronic
1089574887 11:119435018-119435040 GGACAGTGAAATCACTCCTGTGG - Intergenic
1091601885 12:1922644-1922666 GGGCAGGGAGAGCACTCGGAGGG + Intergenic
1096225725 12:49865713-49865735 GGACAGGGAGAAGATACCAACGG - Intergenic
1096787287 12:54024478-54024500 AGACAGGGAGAACACAACTAAGG + Intronic
1100790101 12:98120815-98120837 GGACAGGAAGAACACTGCTATGG + Intergenic
1101137508 12:101759726-101759748 GGCCAGAGAGAACAATCCTGAGG - Intronic
1102287104 12:111666750-111666772 GGTCAGGGAGCACACACTTATGG + Intronic
1106234821 13:27852891-27852913 GGACAGTGAGAACATCCCTCTGG - Intergenic
1106363097 13:29050531-29050553 GGAGAGGGAGAGCACCCCTGGGG - Intronic
1114728517 14:24965230-24965252 GGAGAGGGAGAAAACCCCCAAGG + Intronic
1120302113 14:82721132-82721154 GTACAGGGAGAACAGTCCTGTGG - Intergenic
1121604098 14:95227687-95227709 CGCCAGGGAAAACACTCCTTGGG + Intronic
1123028451 14:105439531-105439553 GGACAGCGAGAAGGCTCCCAGGG - Intronic
1124004523 15:25785342-25785364 GGACAGGGAGAACATGGCGAGGG + Intronic
1125510494 15:40290106-40290128 GAAAAGGGAGAAAACCCCTAGGG + Intronic
1129010392 15:72410837-72410859 GAACAGGGAGATAGCTCCTATGG + Intergenic
1130854651 15:87830625-87830647 GCACAGGTAGAATTCTCCTATGG + Intergenic
1137491851 16:48939470-48939492 GGACAGCGAGACCATTCCCAAGG - Intergenic
1137920715 16:52485834-52485856 GTCCAGGGAAAACACTCCAAAGG - Intronic
1138625580 16:58249000-58249022 GGACGGGGAGACTTCTCCTAGGG - Intronic
1140733332 16:77875884-77875906 AGACAGGGAGAACACTGGTTTGG + Intronic
1142142275 16:88477972-88477994 GAACAGGGAGAACAGACCTGGGG + Intronic
1142753967 17:2004649-2004671 GGCCAGGGAGAAGTCCCCTAAGG - Intronic
1143385608 17:6528397-6528419 GGGGAGGGAGAACACCCTTAGGG - Intronic
1147572850 17:41582158-41582180 GGACTGGGAGAAAAGTCCTGGGG - Intergenic
1149057551 17:52383784-52383806 GAACTTGGAGAACACTCCTATGG + Intergenic
1152476360 17:80521060-80521082 GGACAGGGAGACCTCTGCTTTGG - Intergenic
1152722417 17:81929447-81929469 GGACAGGGAGACAGGTCCTAGGG - Intergenic
1156619266 18:38829733-38829755 GGACAGGAAGAACATTACAAGGG - Intergenic
1157414308 18:47489375-47489397 GGACAAGGAGACCACCCCTTGGG + Intergenic
1158411078 18:57206516-57206538 GGACAGGGATAAGACTACTGTGG - Intergenic
1160526892 18:79543619-79543641 GGACAGGGAGACCAGGCCTGGGG + Intergenic
1160554716 18:79717804-79717826 CGACAGGGAGAACAGCCCTGCGG + Exonic
1162573446 19:11485515-11485537 GGACAGGGAGGAGGCTCCTAGGG + Intronic
1167019640 19:46863628-46863650 GGAAGGGAAGGACACTCCTAGGG - Intergenic
1168492480 19:56822224-56822246 GGACTTGGAGAACACTGCTGTGG - Intronic
926672015 2:15585549-15585571 GGACATGGAGGACCATCCTATGG + Intergenic
927198846 2:20566156-20566178 TGACAGGGAGTTCACTCCTTGGG + Intronic
929738584 2:44577716-44577738 GGAGAGGGAGAATATTCCTTTGG + Intronic
931128094 2:59299739-59299761 TGTCAGGGAGCACCCTCCTAAGG + Intergenic
933162899 2:79045375-79045397 TATCAGGTAGAACACTCCTATGG + Intergenic
938732171 2:134155149-134155171 GGAAAGAGAGCACTCTCCTAGGG - Intronic
939564546 2:143771586-143771608 GGATAGGGAGAACCATCATATGG - Intergenic
939706322 2:145457871-145457893 GGATAGGGAAAACTCTCTTAGGG - Intergenic
939870418 2:147520444-147520466 AGGCAGGGAGAACAACCCTAAGG - Intergenic
939870781 2:147523758-147523780 GGACATGGAGAAAACTGCTCTGG - Intergenic
939952540 2:148491993-148492015 GGACAGGGAGAATGCTTCCAGGG - Intronic
943141993 2:183993848-183993870 GGGCAGGAAGAGAACTCCTACGG - Intergenic
943903374 2:193469678-193469700 GGGCAGACACAACACTCCTAAGG + Intergenic
945197794 2:207253485-207253507 GGAGAGAGAGAACTCTCCTCTGG - Intergenic
946292013 2:218752667-218752689 GAACAGGGAGCACACCCCTGGGG - Intronic
947363480 2:229370029-229370051 GGACAGTGAGAAGAGTCCTGTGG - Intronic
947909456 2:233791712-233791734 GCACAGGGAGAACAATCTCAAGG + Intronic
948592374 2:239059748-239059770 GGACAGGGAGAACACTCCTAGGG + Intronic
1169951988 20:11055094-11055116 GGAAAGGGACAACACTCCCATGG - Intergenic
1173177205 20:40773428-40773450 GGACAGGGAGAGGAAGCCTAAGG - Intergenic
1174429887 20:50460156-50460178 GGCCATGGAGAACACTCCTGTGG + Intergenic
1175822652 20:61918630-61918652 GGACAAGGAGACCACCCCTGGGG + Intronic
1175878789 20:62244404-62244426 GGGCAGGGAGAGCACTCCAAGGG - Intronic
1176376850 21:6091071-6091093 GGGCAGGGAAAACACACCAAGGG - Intergenic
1179746625 21:43447173-43447195 GGGCAGGGAAAACACACCAAGGG + Intergenic
1180981941 22:19882689-19882711 GGACAGGCCGAGCACTCCTGAGG + Intronic
1181632213 22:24157185-24157207 GGCCAGGTTGAACACCCCTAGGG - Intronic
1184852984 22:47131490-47131512 GGGCAGGGGGAACACTCCTGTGG - Intronic
949099428 3:126338-126360 GGACAGGATGAAATCTCCTAGGG + Intergenic
952750858 3:36823827-36823849 GGACAGGAGGATCACTCCTGTGG - Intergenic
952959419 3:38580235-38580257 CAACAGGGAGAACACTCCTGGGG + Intronic
953301625 3:41782806-41782828 TGCCAGGGAGAACATTCTTATGG - Intronic
956843419 3:73160689-73160711 GTACACCGAGAACCCTCCTAGGG + Intergenic
957049622 3:75401426-75401448 GGACAGTTAGAACAATCCCATGG + Intergenic
959573029 3:107906116-107906138 GGCCAAGGAGAGCACTCCCAGGG + Intergenic
960941973 3:122940817-122940839 GGATAGGGAGAGCTCTGCTAAGG - Intronic
961363005 3:126380005-126380027 GGAAAGGGAGAACACTCATAGGG - Intergenic
964131888 3:153298356-153298378 GGGAAGGGAGAAGCCTCCTATGG + Intergenic
964548758 3:157863714-157863736 GGTCAGGGCTAAGACTCCTATGG - Intergenic
964763132 3:160153283-160153305 TGACAGGGAGAAAACTGATATGG - Intergenic
965585254 3:170312410-170312432 GGGCAGGCAGATCACTCCTGAGG + Intergenic
970176497 4:13344975-13344997 GGACACTGTCAACACTCCTATGG + Intergenic
970304110 4:14713510-14713532 GGACAGCCAAAACACTCCTGAGG + Intergenic
976911470 4:90312324-90312346 GGACAGAGAGAGCAGTCATATGG + Intronic
980060461 4:128123259-128123281 GGACAGGCAGAGAACTGCTAAGG - Intronic
989480943 5:41929346-41929368 GGGCAGGGATAAACCTCCTAGGG + Intronic
990841248 5:60081988-60082010 GGATGGGGAGAACTCTCCTTTGG - Intronic
991278529 5:64882221-64882243 GGAAAGGGAGAAGAGTCCAAGGG + Intronic
991654706 5:68892541-68892563 GGGCAGGCAAAACACTCCCATGG + Intergenic
993461164 5:88183984-88184006 GGACAGGCAGAATAATCCTCTGG + Intergenic
995859957 5:116630297-116630319 GGACAGGGAAATTACTCCTAGGG - Intergenic
998365478 5:141628073-141628095 GCCCAGGCAGAACACTCCTGAGG + Intronic
1002323001 5:178386808-178386830 GAACAGGACGCACACTCCTATGG + Intronic
1003017041 6:2476409-2476431 AGACAGGGAGAGCACATCTATGG + Intergenic
1005926525 6:30449928-30449950 GCAGAGGGAGAAATCTCCTAAGG + Intergenic
1010125320 6:72425248-72425270 GGACAGGCAGAACTTTCATAAGG + Intergenic
1013830976 6:114272623-114272645 GCTCAGGGAGAACTCTCCTGTGG - Intronic
1015315797 6:131814772-131814794 GGACACAGAGAACACTTCTCTGG - Intronic
1015650528 6:135452864-135452886 GGTCAGGGAAAACATTCCTGAGG - Intronic
1018217217 6:161540123-161540145 AAACAGTGAGAACAATCCTAAGG - Intronic
1022921718 7:35022943-35022965 GGACAGGGAAATCTCTCCGAGGG - Intronic
1025244908 7:57309551-57309573 GGCCATGGAGAATACTCCTGGGG - Intergenic
1029446630 7:100616691-100616713 TGAGAGGGAGAAGACTCCCAGGG - Intergenic
1035523616 8:294506-294528 GGGGATGGAGAACTCTCCTAGGG - Intergenic
1036699036 8:10999148-10999170 GGACAGGGATTTCAGTCCTAAGG + Intronic
1038831130 8:31062045-31062067 GAACAGGGAGAAGAATCCCAAGG - Intronic
1039715837 8:40107846-40107868 GGACAGGGAGATCACTTGAATGG - Intergenic
1040728820 8:50417805-50417827 GGAAAGGGAGAAAACACATAAGG - Intronic
1048340641 8:133536197-133536219 GGACAGGGAGAGCACACATGAGG + Intronic
1189773761 X:44451742-44451764 GGAGAGGGAGAACTCTCATAGGG - Intergenic
1192148559 X:68697865-68697887 AGTCAGGGAGAACATTCCTGGGG - Intronic
1197900782 X:131369120-131369142 GGACATGGAGAAGGCTCCAAAGG + Intronic