ID: 948592428

View in Genome Browser
Species Human (GRCh38)
Location 2:239059927-239059949
Sequence GAGAGCTCTCCGGGGGCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 178}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948592418_948592428 -4 Left 948592418 2:239059908-239059930 CCCACCCACCAGCCTGCAGGAGA 0: 1
1: 0
2: 4
3: 47
4: 398
Right 948592428 2:239059927-239059949 GAGAGCTCTCCGGGGGCCCTTGG 0: 1
1: 0
2: 3
3: 14
4: 178
948592419_948592428 -5 Left 948592419 2:239059909-239059931 CCACCCACCAGCCTGCAGGAGAG 0: 1
1: 0
2: 8
3: 62
4: 481
Right 948592428 2:239059927-239059949 GAGAGCTCTCCGGGGGCCCTTGG 0: 1
1: 0
2: 3
3: 14
4: 178
948592416_948592428 3 Left 948592416 2:239059901-239059923 CCTTGGACCCACCCACCAGCCTG 0: 1
1: 2
2: 6
3: 54
4: 481
Right 948592428 2:239059927-239059949 GAGAGCTCTCCGGGGGCCCTTGG 0: 1
1: 0
2: 3
3: 14
4: 178
948592420_948592428 -8 Left 948592420 2:239059912-239059934 CCCACCAGCCTGCAGGAGAGCTC 0: 1
1: 0
2: 1
3: 30
4: 211
Right 948592428 2:239059927-239059949 GAGAGCTCTCCGGGGGCCCTTGG 0: 1
1: 0
2: 3
3: 14
4: 178
948592421_948592428 -9 Left 948592421 2:239059913-239059935 CCACCAGCCTGCAGGAGAGCTCT 0: 1
1: 0
2: 2
3: 31
4: 285
Right 948592428 2:239059927-239059949 GAGAGCTCTCCGGGGGCCCTTGG 0: 1
1: 0
2: 3
3: 14
4: 178
948592412_948592428 27 Left 948592412 2:239059877-239059899 CCTGCAGGACAGTCCTCTGGGGG 0: 2
1: 1
2: 2
3: 24
4: 188
Right 948592428 2:239059927-239059949 GAGAGCTCTCCGGGGGCCCTTGG 0: 1
1: 0
2: 3
3: 14
4: 178
948592415_948592428 14 Left 948592415 2:239059890-239059912 CCTCTGGGGGACCTTGGACCCAC 0: 1
1: 1
2: 0
3: 17
4: 169
Right 948592428 2:239059927-239059949 GAGAGCTCTCCGGGGGCCCTTGG 0: 1
1: 0
2: 3
3: 14
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948592428 Original CRISPR GAGAGCTCTCCGGGGGCCCT TGG Intronic
900592445 1:3466058-3466080 GAGAGGTCTCTGGGGTCCCAGGG + Intronic
901637350 1:10676481-10676503 GAGGCCTCCCCGGGGGCTCTTGG - Intronic
902089659 1:13893155-13893177 GCCAGCTCCCCGGGGACCCTGGG + Intergenic
902573010 1:17359091-17359113 CAGTGCTCTCGGGGGACCCTGGG - Intronic
902607173 1:17575145-17575167 GTGACCTCTCTGGGGGCACTGGG - Intronic
902700503 1:18168933-18168955 CAGGGCTCTTCGGGGCCCCTCGG - Intronic
904587626 1:31588822-31588844 GGGAGGTCCCCGGGGGCCCCTGG + Intergenic
905207253 1:36349929-36349951 GAGAGCTCCATGGGGGCCTTGGG + Intronic
905403048 1:37716880-37716902 GAGGGCTCCTGGGGGGCCCTGGG + Exonic
905504084 1:38463148-38463170 GAGATCTCTCTGTGGGCCCTAGG + Intergenic
911219875 1:95234691-95234713 GAGTGCTCTCGGGGGGGCCTAGG - Intronic
912724346 1:112045427-112045449 GGGAACTCTCTGGGGGCCCTGGG + Intergenic
914704927 1:150162686-150162708 AAGTGCCCTCCGGAGGCCCTAGG + Intronic
914902436 1:151717994-151718016 GGGGGCTCTCCTGGGGCTCTGGG + Intronic
915106087 1:153535924-153535946 GAGTTCTCTCCAGGAGCCCTGGG - Exonic
915623051 1:157097901-157097923 CAGAGGTCTCTGGTGGCCCTCGG + Exonic
917916630 1:179708789-179708811 GGGAGCCCTCAGGGGGCCTTGGG - Intergenic
920190155 1:204188576-204188598 GAGAGATCTTGGGGGACCCTCGG + Intergenic
922794278 1:228332312-228332334 GGGAGCTCTCTGGGGTCCCATGG + Intronic
923765644 1:236890264-236890286 GTGAGCTGTCCAGGGGCCGTGGG + Intronic
924260386 1:242223501-242223523 CACAGCTCTGCTGGGGCCCTGGG - Intronic
924656975 1:245981347-245981369 GAGAGCCCTCTGGGAGCCCTGGG + Intronic
924825164 1:247531148-247531170 GGGAGGGCTCCGGGGGCTCTGGG + Exonic
1066058397 10:31701773-31701795 GACAGCACTCCGGGGGGCCTGGG + Intergenic
1067124781 10:43506899-43506921 TACAGCTCACCAGGGGCCCTGGG - Intergenic
1070911963 10:80126865-80126887 GAGAGCTCTCAGTGAGCACTGGG - Intergenic
1071431837 10:85612695-85612717 CAAAGGTCTCCGGGGGACCTTGG + Intronic
1071523617 10:86345858-86345880 GTGAGCTGTCCAGGGTCCCTGGG - Intronic
1072294110 10:93993630-93993652 GAGAGCGCTCCTGGGGCGCCCGG - Intergenic
1072451379 10:95541871-95541893 GAGAGCACTGCGGGGGTCATGGG - Intronic
1076125656 10:127971829-127971851 GAAAGCTCTCCTGGTGCCCATGG - Intronic
1076633875 10:131870201-131870223 GTGAGCTCTGTGGGGGTCCTTGG + Intergenic
1077322568 11:1948832-1948854 GAGCCCTGTCCTGGGGCCCTGGG + Intronic
1077323100 11:1951113-1951135 GAGTGCCCTCAGGGGGGCCTGGG + Intronic
1077334657 11:1997936-1997958 GTGGGCCCTGCGGGGGCCCTCGG - Intergenic
1077533185 11:3106828-3106850 TGGTGCTCTCCTGGGGCCCTGGG - Intronic
1083164494 11:60875182-60875204 GTGAGCTCTCCGGGGCCAGTGGG + Exonic
1083756031 11:64792128-64792150 CAGAGCTCTGAGGGTGCCCTGGG + Intronic
1083887813 11:65581341-65581363 GTGAGGTTTCCGGGGGCCTTGGG - Exonic
1085767884 11:79299379-79299401 GAGTGCGCTCCTGGGGCACTGGG - Intronic
1090398683 11:126435063-126435085 GACAGGTCTCTGGGGTCCCTAGG + Intronic
1091355523 11:134934782-134934804 GAGAGCTCACAGGGGGTCCAAGG + Intergenic
1202805585 11_KI270721v1_random:4145-4167 GAGCCCTGTCCTGGGGCCCTGGG + Intergenic
1202806085 11_KI270721v1_random:6308-6330 GAGTGCCCTCAGGGGGGCCTGGG + Intergenic
1202817640 11_KI270721v1_random:53118-53140 GTGGGCCCTGCGGGGGCCCTCGG - Intergenic
1100330054 12:93573152-93573174 GCGTGCTCTCCGCGGTCCCTTGG - Intronic
1102547361 12:113666411-113666433 GGGAGCTCTCGGGGAGCACTTGG + Intergenic
1104169931 12:126270401-126270423 GTGTCCTCTCCGTGGGCCCTTGG - Intergenic
1107660569 13:42635095-42635117 GAGAGCTCACCGAGAACCCTTGG - Intergenic
1107959081 13:45543080-45543102 GAGAGGTGTCCCGGGGCCCCTGG - Intronic
1107964888 13:45589281-45589303 CACAGCTCTCCATGGGCCCTGGG + Intronic
1112344455 13:98577550-98577572 GAGAGCGCCCCGTGGGGCCTCGG + Intronic
1112705373 13:102061811-102061833 GTGATCTCTCCGTGTGCCCTAGG - Intronic
1113905713 13:113818282-113818304 CAGGGCTCTCCTGGGGCCCAGGG + Intergenic
1114042610 14:18692944-18692966 GAGAGCTCTCAGTGAGCACTGGG - Intergenic
1114459116 14:22875704-22875726 GGGAGCTCTCAGGGGGCCCAGGG - Exonic
1114482240 14:23043055-23043077 GAGAGCTCTCTGTGGGGCCAGGG + Exonic
1114553625 14:23548844-23548866 GAGAGCACTGCGGGGGCGCCGGG - Intronic
1121225825 14:92321447-92321469 GAGAGCTAGCCAAGGGCCCTTGG - Intergenic
1122695681 14:103551005-103551027 GAGGGCCCTCCTGGGGCTCTGGG + Intergenic
1122922718 14:104886595-104886617 GTTGGCTCCCCGGGGGCCCTTGG - Exonic
1124626790 15:31312339-31312361 CAGAGCTCACCAGGGGGCCTTGG - Intergenic
1125246741 15:37649279-37649301 GAGAGCTTTCCTTGGGCACTTGG - Intergenic
1125591871 15:40859294-40859316 GGGAGCTCTCGGGGGTCACTAGG + Intergenic
1130169762 15:81499080-81499102 GAGAAATCTCAGGTGGCCCTAGG + Intergenic
1131486514 15:92825398-92825420 GATAGCTTTCCGTGGGCCTTTGG - Intergenic
1131833079 15:96366577-96366599 TAGAGCTCTCCGGTGCGCCTGGG + Intergenic
1132814607 16:1819783-1819805 GAGAGCACTCCCGGGTCACTGGG + Intronic
1133220697 16:4317993-4318015 GAGAACTCCCCAGGGGGCCTGGG - Intronic
1133258926 16:4536046-4536068 GAGAGCTCTGCAGAGGACCTTGG - Intronic
1133598164 16:7312905-7312927 CGGAGCTCTCTGGGGGCCCCAGG + Intronic
1133743275 16:8667758-8667780 GAGAGCTCTTGGGGAGCTCTTGG - Intergenic
1134178721 16:12030429-12030451 AAGAGCTGTCCAGGGGACCTGGG - Intronic
1135065793 16:19308741-19308763 GGGAGCCCTCCTGGAGCCCTGGG + Intronic
1135305467 16:21364172-21364194 AAGAGCTGTCCAGGGGACCTGGG - Intergenic
1136063868 16:27745896-27745918 GAGAGCTGGCTGGGGGCCCACGG - Intronic
1136302205 16:29343324-29343346 AAGAGCTGTCCAGGGGACCTGGG - Intergenic
1136451343 16:30355813-30355835 GAGAGCCGTCCAGGGGCCCCAGG - Intergenic
1136483708 16:30557988-30558010 GAGAGCGCTCAGGTGGCCGTAGG + Exonic
1138334993 16:56246019-56246041 GAGATCTCTGCAGGGCCCCTGGG + Intronic
1141034634 16:80616621-80616643 GGGACCTCTCTGGGGGCCCCAGG - Intronic
1141635934 16:85313713-85313735 GAGAGCTGTCCGGGAGCCTCTGG + Intergenic
1141672077 16:85497414-85497436 TAGAGCCCTCCAGGGGCCCACGG + Intergenic
1141821791 16:86451190-86451212 GAAAGCTCTGGGGGGACCCTGGG - Intergenic
1142040485 16:87890423-87890445 AAGAGCTCACCTGGAGCCCTCGG + Intronic
1142228240 16:88887720-88887742 GACACCTCCCCGGGTGCCCTGGG - Intronic
1143269625 17:5666018-5666040 GAGAGCTCTCCGGCTGCTGTTGG - Intergenic
1143371859 17:6445219-6445241 GAGACCTCTGTAGGGGCCCTGGG + Exonic
1148023641 17:44570002-44570024 GACAGTTCTCCGGGTGGCCTTGG - Intergenic
1148203988 17:45768182-45768204 GTGAGCTGTCCAGGGTCCCTGGG + Intergenic
1148845417 17:50527144-50527166 GAGAGCTGTCTGGGTGCCTTTGG - Intronic
1149232565 17:54552855-54552877 GAGAACTCTCAGGGGGCCATTGG - Intergenic
1150281629 17:63932413-63932435 ACCAGCTCTCCGGGGACCCTGGG + Intergenic
1150693478 17:67384306-67384328 GAAAACTCTCTGGGGACCCTGGG - Intronic
1152097317 17:78279462-78279484 GTCAGCTCTCAGGGGGCCCCAGG + Intergenic
1152276184 17:79358933-79358955 GCGAGCCCTCTGGGGGCACTTGG - Intronic
1152391447 17:80006166-80006188 GAGAGCGCTCCTGGTGCTCTGGG - Intronic
1155474833 18:26227039-26227061 GAGAGCACTCCGGTGGCCCTGGG + Exonic
1157716942 18:49894331-49894353 GGGGGGTCTCCAGGGGCCCTTGG + Intronic
1162506590 19:11089651-11089673 GGGAGCCCCCGGGGGGCCCTTGG + Intronic
1167988784 19:53340385-53340407 GAGAGGTCTGCAGGGGCCATGGG - Intronic
1168115702 19:54220457-54220479 GAGAGCTCTCCTGGGGGCCTGGG + Intronic
1168118689 19:54240203-54240225 GAGAGCTCTCCTGGGGGCCTGGG + Intronic
926806773 2:16718387-16718409 GTGAGCTCTCCGTGTGTCCTTGG + Intergenic
930421967 2:51165381-51165403 GTGGGCTCTGTGGGGGCCCTTGG + Intergenic
932009248 2:67958880-67958902 GACAGCTCTCTGGGTGGCCTTGG - Intergenic
934837726 2:97605632-97605654 GAGAGCCCTCGTGGGGGCCTGGG + Intergenic
937871839 2:126791826-126791848 GACAGTTCTCCGGGTGGCCTTGG - Intergenic
937979420 2:127605933-127605955 GAGAGCTCTCTGGGGCGGCTGGG + Intronic
937999150 2:127718946-127718968 CACAGCTCTCCTGGAGCCCTGGG + Intronic
938288422 2:130136949-130136971 GGGAGCTGTCTGGGGGCCCAGGG + Intergenic
938468106 2:131535987-131536009 GGGAGCTGTCTGGGGGCCCAGGG - Intergenic
940211633 2:151261556-151261578 GACGGCTCTCCGGGGCCCCCGGG + Intronic
942298084 2:174536543-174536565 GAGGGCTCTCAGGACGCCCTGGG + Intergenic
942657173 2:178226097-178226119 TAGAGCTCTCAGTGGGCCCTAGG - Intronic
946419711 2:219557923-219557945 GAGGACTCGGCGGGGGCCCTCGG + Exonic
947535960 2:230940611-230940633 GTGAGCTCTCAGGGGTCACTGGG + Intronic
948201235 2:236130918-236130940 GAGAGCCCTGCTGGGACCCTTGG - Exonic
948592387 2:239059798-239059820 CACAGCTCTCCTGGGGGCCTTGG + Intronic
948592428 2:239059927-239059949 GAGAGCTCTCCGGGGGCCCTTGG + Intronic
948660701 2:239504859-239504881 CAGAGCCTTCCGGGGGCCCCAGG + Intergenic
948901263 2:240957914-240957936 GAAAGCCCTCCTGGGGCCCTGGG + Intronic
1173823488 20:46032858-46032880 GAGAGCTCTTCTGAGACCCTGGG + Intronic
1175238025 20:57526434-57526456 GAGGGCCCTCAGGGGGCGCTGGG + Intergenic
1176056505 20:63151760-63151782 GGGTGCTCTCCGAGGGGCCTTGG - Intergenic
1176257922 20:64162284-64162306 GGGAGCTCCCAGGGCGCCCTAGG + Intronic
1176673710 21:9757545-9757567 GACAGCTCTCCAGGTGGCCTTGG - Intergenic
1178588917 21:33892981-33893003 GAGAGCTATCCTGGGGGCCAAGG + Exonic
1181168388 22:20995139-20995161 GAGAGCACTCTGGGGTCCCATGG - Intronic
1181977392 22:26740580-26740602 GAGAGTTCAGCGGGGCCCCTGGG - Intergenic
1183453076 22:37906903-37906925 GAGCCCTCTTTGGGGGCCCTGGG + Intronic
1184809783 22:46823480-46823502 GAGAACTCACCCAGGGCCCTGGG - Intronic
1185314134 22:50171461-50171483 GAGGCCTCTCCGGGTGCACTGGG + Intronic
953031889 3:39185062-39185084 CAGGGCTCTCAGGGGCCCCTTGG + Exonic
954291854 3:49654048-49654070 GAGAACTCTGCTGTGGCCCTTGG - Exonic
954613165 3:51956729-51956751 GAGAACTCTCAGGTGGCCCCTGG - Exonic
961523362 3:127481137-127481159 GAGAGCTCTTTGGGGTTCCTAGG + Intergenic
964927793 3:161978707-161978729 TACAGCTCTCAGGAGGCCCTAGG + Intergenic
965609907 3:170532737-170532759 GGCAGCTCTCAGAGGGCCCTTGG + Intronic
971480922 4:27114423-27114445 GAGAGCTGTACGCAGGCCCTGGG - Intergenic
984598021 4:181693694-181693716 GAGAGCTCTCCGTGGTGCCTAGG + Intergenic
985401000 4:189594124-189594146 GACAGCTCTCCAGGTGGCCTTGG + Intergenic
987086855 5:14478457-14478479 GAAAGGACTCAGGGGGCCCTGGG + Intronic
987293076 5:16526141-16526163 GAGAGCTCTCCCGATGCCCATGG + Intronic
989121796 5:38011788-38011810 AAGAACTTTCCTGGGGCCCTGGG + Intergenic
995048058 5:107671819-107671841 GAGAGCTCACCCCGGGCTCTTGG - Intergenic
997528379 5:134567782-134567804 GAGGGCTCTCTGGGGGCAATAGG - Intronic
1001088803 5:168721776-168721798 GTGAGCTGGACGGGGGCCCTGGG + Intronic
1002197787 5:177510434-177510456 GTGACCTCTCCGGGGCCCCCTGG - Intronic
1004705733 6:18122263-18122285 GTGAGGGCTCCGGGGGCGCTGGG + Exonic
1005813382 6:29532314-29532336 GGCTGCTCTCTGGGGGCCCTGGG + Intergenic
1006537218 6:34709530-34709552 GACAGCTGGCAGGGGGCCCTCGG + Intergenic
1007180167 6:39923774-39923796 GAGGGCTGTCAGGGGGACCTGGG + Intronic
1007950363 6:45866804-45866826 GAGAGCTCTGGAGGGGTCCTTGG + Intergenic
1013416622 6:109931408-109931430 GAGAGATCTCAGAGGGCTCTTGG + Intergenic
1013843649 6:114425638-114425660 GAGAGCGTTCCCGGGGCTCTGGG + Intergenic
1019472881 7:1230442-1230464 GAGAGCTCTTCAGAGGCCCTCGG - Intergenic
1019510264 7:1414187-1414209 GAGGCCTTGCCGGGGGCCCTGGG + Intergenic
1019578838 7:1750266-1750288 GTGAGCTCCCCGGGGGGCCGGGG - Intergenic
1023013581 7:35944045-35944067 GAGGGCTGTCAGGGGGTCCTAGG + Intergenic
1023034153 7:36116132-36116154 GTGTGCTCTCCAGGGGCCCAGGG + Intergenic
1024989512 7:55222048-55222070 GATCGCTCTCAGGGAGCCCTGGG - Intronic
1026276274 7:68879856-68879878 GAGAGGTTTCTGGGGGGCCTAGG - Intergenic
1026828237 7:73596855-73596877 GAGATCTTACCGGGGACCCTGGG + Exonic
1026953540 7:74362966-74362988 GAGAGCTGTTAGGAGGCCCTAGG + Intronic
1029859755 7:103557142-103557164 GAGATCTCTCTGGGGTACCTAGG + Exonic
1034412247 7:150947668-150947690 GGCGGCTCTCCGGGGGGCCTGGG + Exonic
1036447494 8:8834832-8834854 GTGAGTTCACTGGGGGCCCTGGG - Intronic
1037653485 8:20862334-20862356 GTCAGCTCTCTGGTGGCCCTAGG + Intergenic
1037876547 8:22551608-22551630 GAGGGCTCCCCGGGGACCCTCGG + Intronic
1039467933 8:37797169-37797191 GAGTGCTCAGCGGGGGCCCGGGG - Intronic
1041280952 8:56211098-56211120 GTGAGTTCTCCGGGGGTCCGGGG - Intronic
1048011921 8:130464700-130464722 AAGAGCTCTCCAGGGGACCCAGG - Intergenic
1048339561 8:133528237-133528259 GTGTGGTCTCTGGGGGCCCTAGG - Intronic
1048558363 8:135505383-135505405 GAGAGCTCTCAAGGGTCCCAAGG - Intronic
1048867536 8:138771841-138771863 AAGAGCTCTCCGCAGGCCCCGGG - Intronic
1049084658 8:140469415-140469437 GTCAGCTCTCCAGGGGCGCTGGG + Intergenic
1049354662 8:142181837-142181859 CAGAGCTCTCGGAGGGCCCGTGG + Intergenic
1049434311 8:142579416-142579438 GAGGGCTCTCTGTGGGACCTGGG + Intergenic
1049441281 8:142610917-142610939 GAGAGGTCTCCGGGGGCTCGGGG - Intergenic
1049732055 8:144183571-144183593 TAGAGCTCTCCAGTGGCCCCTGG + Intronic
1053010006 9:34627770-34627792 GAGAGCCGTCCAGGGGCCCAGGG - Exonic
1053429726 9:38034069-38034091 GAGAGAGCTTCAGGGGCCCTGGG - Intronic
1056555710 9:87685525-87685547 GAGCACTCTCTGTGGGCCCTGGG + Intronic
1057227981 9:93302459-93302481 GAAAGCTCTCCCCAGGCCCTAGG - Intronic
1060552820 9:124493663-124493685 GAGAGCTCTGCGTAGGCCCGGGG - Intronic
1061213378 9:129206264-129206286 GAGAGCCCTCCAGGCCCCCTGGG + Intergenic
1061495928 9:130974152-130974174 CAGAACTCCCCGGGGGCCGTGGG + Intergenic
1062038277 9:134392397-134392419 CAGGACTCTCCGGGGCCCCTTGG + Intronic
1062372993 9:136249654-136249676 GTGAGCTCTCCCAGCGCCCTGGG + Intergenic
1062480609 9:136749160-136749182 GAGAGCTCTCAAGGGGCCTTGGG - Intergenic
1185612100 X:1398904-1398926 GTGAGCCCTACGGAGGCCCTGGG + Intergenic
1187881824 X:23854327-23854349 GTGAGCACTCCGGGGAGCCTGGG + Intronic
1190757673 X:53414941-53414963 GAAAGCTCTCCTTGGGTCCTGGG - Intronic
1195681024 X:107546768-107546790 CAGAGCTGTCTGGAGGCCCTTGG + Intronic
1201620676 Y:15953671-15953693 GAGAGCTCTCCCAGACCCCTGGG + Intergenic