ID: 948593285

View in Genome Browser
Species Human (GRCh38)
Location 2:239064491-239064513
Sequence CAACAGAAGGGGAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1703
Summary {0: 1, 1: 0, 2: 11, 3: 149, 4: 1542}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948593271_948593285 14 Left 948593271 2:239064454-239064476 CCTCCGCCGTCTCTGATGCTGCC 0: 1
1: 0
2: 3
3: 22
4: 266
Right 948593285 2:239064491-239064513 CAACAGAAGGGGAGGGAGGAAGG 0: 1
1: 0
2: 11
3: 149
4: 1542
948593273_948593285 8 Left 948593273 2:239064460-239064482 CCGTCTCTGATGCTGCCCCTCAC 0: 1
1: 0
2: 5
3: 42
4: 397
Right 948593285 2:239064491-239064513 CAACAGAAGGGGAGGGAGGAAGG 0: 1
1: 0
2: 11
3: 149
4: 1542
948593276_948593285 -8 Left 948593276 2:239064476-239064498 CCCTCACATCGGCCTCAACAGAA 0: 1
1: 0
2: 0
3: 8
4: 75
Right 948593285 2:239064491-239064513 CAACAGAAGGGGAGGGAGGAAGG 0: 1
1: 0
2: 11
3: 149
4: 1542
948593267_948593285 25 Left 948593267 2:239064443-239064465 CCCAGGTCCCACCTCCGCCGTCT 0: 1
1: 0
2: 0
3: 16
4: 192
Right 948593285 2:239064491-239064513 CAACAGAAGGGGAGGGAGGAAGG 0: 1
1: 0
2: 11
3: 149
4: 1542
948593270_948593285 17 Left 948593270 2:239064451-239064473 CCACCTCCGCCGTCTCTGATGCT 0: 1
1: 0
2: 1
3: 13
4: 226
Right 948593285 2:239064491-239064513 CAACAGAAGGGGAGGGAGGAAGG 0: 1
1: 0
2: 11
3: 149
4: 1542
948593275_948593285 -7 Left 948593275 2:239064475-239064497 CCCCTCACATCGGCCTCAACAGA 0: 1
1: 0
2: 0
3: 11
4: 168
Right 948593285 2:239064491-239064513 CAACAGAAGGGGAGGGAGGAAGG 0: 1
1: 0
2: 11
3: 149
4: 1542
948593269_948593285 18 Left 948593269 2:239064450-239064472 CCCACCTCCGCCGTCTCTGATGC 0: 1
1: 0
2: 0
3: 3
4: 120
Right 948593285 2:239064491-239064513 CAACAGAAGGGGAGGGAGGAAGG 0: 1
1: 0
2: 11
3: 149
4: 1542
948593277_948593285 -9 Left 948593277 2:239064477-239064499 CCTCACATCGGCCTCAACAGAAG 0: 1
1: 0
2: 0
3: 9
4: 68
Right 948593285 2:239064491-239064513 CAACAGAAGGGGAGGGAGGAAGG 0: 1
1: 0
2: 11
3: 149
4: 1542
948593272_948593285 11 Left 948593272 2:239064457-239064479 CCGCCGTCTCTGATGCTGCCCCT 0: 1
1: 0
2: 1
3: 32
4: 304
Right 948593285 2:239064491-239064513 CAACAGAAGGGGAGGGAGGAAGG 0: 1
1: 0
2: 11
3: 149
4: 1542
948593268_948593285 24 Left 948593268 2:239064444-239064466 CCAGGTCCCACCTCCGCCGTCTC 0: 1
1: 0
2: 0
3: 23
4: 337
Right 948593285 2:239064491-239064513 CAACAGAAGGGGAGGGAGGAAGG 0: 1
1: 0
2: 11
3: 149
4: 1542

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948593285 Original CRISPR CAACAGAAGGGGAGGGAGGA AGG Intronic
900419139 1:2548032-2548054 CAGGGGGAGGGGAGGGAGGAGGG + Intergenic
900626459 1:3610901-3610923 CAAAAGAAGGGGAGAGTGGGAGG + Intronic
900670082 1:3846889-3846911 GGAAAGAAAGGGAGGGAGGAAGG + Intronic
900830117 1:4959865-4959887 AGACAGAAGGGGAGGGGGAAGGG + Intergenic
900882944 1:5394825-5394847 TAAAAGAAAGGGAGGAAGGAAGG + Intergenic
900919330 1:5660841-5660863 CACCAGCCTGGGAGGGAGGAAGG + Intergenic
900932793 1:5747511-5747533 CAGCAGGAAGGGAGGAAGGAGGG + Intergenic
901074609 1:6545682-6545704 CCACAGAAGAGGATGAAGGAAGG + Intronic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
901199030 1:7456275-7456297 AAGAAGAATGGGAGGGAGGAAGG + Intronic
901336529 1:8454091-8454113 CACCAGAGTGGGAGGAAGGATGG - Intronic
901756337 1:11443773-11443795 CACCAGGAGGGGTGGGATGATGG - Intergenic
901938663 1:12645294-12645316 CAAAAGGAGGGAAGGAAGGAAGG - Intronic
902123073 1:14184311-14184333 GAAGAGAAGGCGAGGGAGGGAGG - Intergenic
902261054 1:15225172-15225194 CAAAAAAAGGGAAGGAAGGAAGG + Intergenic
902619436 1:17642361-17642383 CAGATGAAGGGGAGGGAGGTAGG + Intronic
902700281 1:18167656-18167678 CAGCAGAAGGAAAGGGTGGACGG - Intronic
902709687 1:18230293-18230315 CAAGAGTGGGGGAGAGAGGAGGG - Intronic
902754430 1:18539960-18539982 GAAGGGAAGGGAAGGGAGGAAGG + Intergenic
902762284 1:18590028-18590050 CACCAGGAGGAGAAGGAGGAGGG - Intergenic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
902905982 1:19557793-19557815 GAACAGAAGGGGAAGGGGAAGGG - Intergenic
903080889 1:20811455-20811477 CAAGAGAAGAGGAGGCAAGAAGG + Intronic
903270874 1:22187492-22187514 GAAGAGAAGGGGCTGGAGGAAGG - Intergenic
903892316 1:26577878-26577900 TATGAGAAGGGCAGGGAGGATGG - Intergenic
903926472 1:26834109-26834131 GACCAGAAGGGGAGGAAGAACGG - Intronic
904073095 1:27816982-27817004 GGAAGGAAGGGGAGGGAGGAAGG + Intronic
904372443 1:30058412-30058434 CAGGGGAAGGGGAGGGAGGGTGG - Intergenic
904440130 1:30524611-30524633 GAAGGGAAGGGAAGGGAGGAAGG + Intergenic
904534461 1:31190081-31190103 CAACAGAAGAGGAGAGAAGAGGG + Intronic
904566757 1:31432947-31432969 AGACTGCAGGGGAGGGAGGAAGG - Exonic
904807272 1:33140861-33140883 AAGGAGAAGGGGAGAGAGGAGGG - Intergenic
904813291 1:33178146-33178168 CAGGAGAGGGAGAGGGAGGAAGG - Intronic
904816930 1:33210783-33210805 CAAAATAAAGGGATGGAGGAAGG - Intergenic
904960995 1:34332715-34332737 CAACAGGAGGGAAGGCAGCACGG - Intergenic
905166123 1:36084315-36084337 CAACAGTAGGCGAGGGCGGAGGG + Intronic
905178784 1:36154384-36154406 CAAGACAAGGGGTGGGAGGTGGG + Intronic
905343997 1:37299163-37299185 AGACAGAACAGGAGGGAGGAGGG - Intergenic
905553931 1:38866783-38866805 GGACAGGAGGGGAGGGAGGTGGG - Intronic
905842058 1:41189562-41189584 CACCAGAAGAAGGGGGAGGAAGG + Intronic
905898154 1:41562515-41562537 GAAGGGAAGGGAAGGGAGGAAGG - Intronic
905942963 1:41878825-41878847 CAGGAGATGGGGAGGAAGGAAGG - Intronic
906040362 1:42784416-42784438 CAACAGATGGGATGGGAAGAAGG - Intronic
906186831 1:43868741-43868763 GAACAGAAGGCGTGGGAGAAAGG - Intronic
906223264 1:44099917-44099939 GAAAAGAAAGGGAGGGAGGGAGG + Intergenic
906509696 1:46403925-46403947 GAAAAGAAAGGGAGGGAGGGAGG + Intronic
906538488 1:46565907-46565929 AGAGAAAAGGGGAGGGAGGAAGG - Intronic
906626766 1:47332013-47332035 GAAAAGAAGGGTAGGAAGGATGG + Intergenic
906673676 1:47677894-47677916 GACCAGGAGGGGAGGAAGGATGG - Intergenic
907246741 1:53113816-53113838 CAGCAGAAGGGGTGAGAGGCAGG - Intronic
907360930 1:53914085-53914107 TAACAGAATGGCAGGGAAGATGG - Intergenic
907394837 1:54181922-54181944 CAACAGGGAGGGAAGGAGGACGG + Intronic
907401137 1:54225669-54225691 CAGCTACAGGGGAGGGAGGAAGG + Intronic
907437368 1:54458550-54458572 CAAGAGAGAGGGAGGGAGGGAGG + Intergenic
907858487 1:58327282-58327304 AAGAAGAAAGGGAGGGAGGAAGG + Intronic
907922129 1:58923402-58923424 CAAAAGAGGGTGAGGGAGAAGGG - Intergenic
907976002 1:59432050-59432072 CACCAGGAGGGGAGAGAGGCTGG + Intronic
908152801 1:61321408-61321430 AGAGAGAAAGGGAGGGAGGAAGG + Intronic
908238418 1:62169131-62169153 CACCAGAGGGGGCGGGAGGCTGG - Intergenic
908260738 1:62337827-62337849 AAAGAGAAAGGGAGGGAGGGAGG + Intergenic
908980674 1:69953494-69953516 AAACAGTAGAGGAGGGAGAAGGG - Intronic
909249412 1:73332154-73332176 CAAGAGAAGAGAAGGGAGAAAGG - Intergenic
909433984 1:75619107-75619129 AGGAAGAAGGGGAGGGAGGAAGG + Intergenic
909602216 1:77472579-77472601 GAAAAGAAGAGGAGGGAGGGAGG + Intronic
909606839 1:77516574-77516596 AAAGAGAAGAGGAGGAAGGAAGG + Intronic
909985071 1:82151449-82151471 CAAAAGAAAGGAAGGAAGGAAGG + Intergenic
910229036 1:84967707-84967729 GAAGAGAAGGGAAGGAAGGAGGG + Intronic
910383810 1:86659731-86659753 CAAAAGAAAGGGATGGAGGAAGG + Intergenic
910532217 1:88250469-88250491 AAGGAGAAAGGGAGGGAGGAAGG + Intergenic
910709983 1:90169112-90169134 CAAAATAAAGGGATGGAGGAAGG + Intergenic
910840831 1:91559903-91559925 CCAAAGAATGGGATGGAGGATGG + Intergenic
911094381 1:94043999-94044021 AAAGGGAAGGGGAAGGAGGAAGG - Intronic
911129357 1:94373425-94373447 CATCAGAAGGGGAAGGAGAGGGG - Intergenic
911268509 1:95772752-95772774 CAACGGAAGGGGTGGGAATAAGG - Intergenic
911323742 1:96444964-96444986 CAAGAGATGTGGAAGGAGGAAGG + Intergenic
911713925 1:101109129-101109151 TAGCAAAAGGGAAGGGAGGAAGG - Intergenic
911834345 1:102596992-102597014 CAAGAAAAGGGAAGGAAGGAAGG + Intergenic
912252902 1:108029747-108029769 CAGCAGAAAGGGAGAGACGATGG + Intergenic
912408900 1:109466503-109466525 GAGCAGAGGGGGCGGGAGGAGGG + Intergenic
912696721 1:111847744-111847766 CAGCAGCTGGAGAGGGAGGATGG + Intronic
913466407 1:119147791-119147813 AAACAGAAGGGGAAGCAGAACGG - Intergenic
913467186 1:119155130-119155152 CAAAATAAAGGGATGGAGGAAGG - Intergenic
913484372 1:119320274-119320296 GAAAAGGAAGGGAGGGAGGAAGG - Intergenic
913942964 1:125125205-125125227 CAAAATAAAGGGATGGAGGAAGG + Intergenic
914058627 1:144187754-144187776 GAAAAGAAGGAGAGGGAAGAAGG - Intergenic
914120522 1:144778617-144778639 GAAAAGAAGGAGAGGGAAGAAGG + Intergenic
914676532 1:149910768-149910790 GCACAGAAGAAGAGGGAGGAGGG + Intronic
914897181 1:151687126-151687148 AGACAGAAAGGGAGGGAGGGAGG - Intronic
914992678 1:152512236-152512258 TAAGAGAAGGGAAGGGAAGATGG - Intronic
915073128 1:153288692-153288714 GCACAGAAAGGGAGGGAGAATGG - Intergenic
915076653 1:153313170-153313192 CACCAGCAGGGGCAGGAGGAAGG + Intergenic
915281105 1:154822708-154822730 CAAGGGCAGGGGAGGGAGGCAGG + Intronic
915323258 1:155067601-155067623 AAACAGAAGTGGGGAGAGGATGG - Intronic
915468540 1:156112557-156112579 CACCAGAAGCAGAGGCAGGAGGG - Intronic
915532166 1:156508956-156508978 CATCAGCAGTGGAGGGAGGTGGG + Intergenic
915536096 1:156536475-156536497 TAGGAGAAGGGGAGAGAGGATGG + Intronic
915724927 1:158010719-158010741 CAGGCAAAGGGGAGGGAGGAGGG - Intronic
915893356 1:159791856-159791878 ACAGAGAAGGGGAGGGAGTAGGG - Intergenic
916058254 1:161082593-161082615 TACCAGAAGGAGAGGGAAGAAGG + Intronic
916192728 1:162194762-162194784 ACACAGAAGGGGAGGCAAGAGGG + Intronic
916212870 1:162372879-162372901 CCACAGAGTGGGAGGGAGGCTGG - Intronic
916588090 1:166165825-166165847 AAACAAAAGCGTAGGGAGGAGGG + Intronic
916593359 1:166215986-166216008 CAAAAGGAGGGAAGGTAGGAGGG - Intergenic
917534273 1:175863248-175863270 GGACAGAAGGGGAGGAAAGAGGG - Intergenic
917653455 1:177102198-177102220 TTAAATAAGGGGAGGGAGGAAGG + Intronic
917917567 1:179718871-179718893 CTCCAAAAGGGGAGGGAAGAGGG - Intergenic
917921411 1:179753720-179753742 AAATAGAAGGCGAGGCAGGATGG + Intronic
917928759 1:179809608-179809630 CAGCACAGGGGCAGGGAGGAGGG + Intronic
918015349 1:180628328-180628350 CAACAGAGGGAGAAGGAAGAAGG - Intergenic
918018287 1:180659486-180659508 CAACAGAGAGGGAGGAAGGGAGG - Intronic
918120086 1:181530706-181530728 CAGCAGAAGGGATGGGAGGAAGG - Intronic
918221977 1:182443747-182443769 CAGCAGAATGGGAGGCATGAAGG - Intergenic
918394297 1:184097954-184097976 AGAAAGAAGGGGAGGGAGGGAGG + Intergenic
918469966 1:184861726-184861748 AAGGAGAAGGGGAGGGAGGAAGG + Intronic
918612068 1:186504225-186504247 CAAGGGCAGTGGAGGGAGGAGGG + Intergenic
918621099 1:186606781-186606803 AAAGAGAGAGGGAGGGAGGAAGG - Intergenic
919003043 1:191859620-191859642 AAACAGAAGGAGAGAGAGGAAGG - Intergenic
919199238 1:194331286-194331308 CAAGAGGAAGGGAGAGAGGAGGG + Intergenic
919509796 1:198447734-198447756 GAAGAGAAAGGGAGGGAGGGAGG - Intergenic
919583838 1:199410767-199410789 CAAGGGAAGGTGAGGGAGCAGGG - Intergenic
919712010 1:200738637-200738659 GAAAAGGAAGGGAGGGAGGAGGG - Intergenic
919765909 1:201127272-201127294 ACCCAGAAGGGGAGGGAGGAGGG + Intergenic
919787178 1:201266436-201266458 TAAAAGAAAGGAAGGGAGGAAGG - Intergenic
919991041 1:202709020-202709042 CAGCAGTAGGGGAGGGAGAAGGG + Intronic
920063269 1:203244069-203244091 AAGAAGAAGGGGAGGAAGGAGGG + Intronic
920098731 1:203503322-203503344 GAAGAGAAGGGGAGAGAGGAAGG - Intronic
920144284 1:203844827-203844849 CAGAAAAAGGGGAGGGAGGAGGG - Intronic
920364157 1:205439344-205439366 CAAAGGAAGGGGTTGGAGGATGG + Intronic
921072156 1:211669878-211669900 CAGAAGAAGGGGAGGGGTGATGG - Intronic
921095589 1:211884801-211884823 CAGCTGATGGGGAAGGAGGATGG - Intergenic
921363435 1:214351617-214351639 CAGCAGCAGGCGAGGGAAGATGG + Exonic
921468864 1:215524696-215524718 TACTAGAAGGGGAGGGAGGAGGG - Intergenic
921566946 1:216732842-216732864 AAAAAAAAGGGGGGGGAGGAGGG + Intronic
922063658 1:222115458-222115480 CATTAGAAAAGGAGGGAGGAAGG - Intergenic
922436527 1:225612840-225612862 CAAAAAAAAGGGGGGGAGGAGGG + Intronic
922625826 1:227041293-227041315 CTAGAGAAGGGGAAGGAGGGAGG - Intronic
922723284 1:227909791-227909813 AGGCAGGAGGGGAGGGAGGAGGG + Intergenic
922723315 1:227909872-227909894 AGGCAGGAGGGGAGGGAGGAGGG + Intergenic
922790177 1:228306881-228306903 CAGCTGCAGGGGAGGGAGCAGGG - Exonic
922883904 1:229003491-229003513 CAGGGGGAGGGGAGGGAGGAAGG + Intergenic
922887060 1:229028289-229028311 GGAAGGAAGGGGAGGGAGGAAGG + Intergenic
923037214 1:230292638-230292660 CAAGAGAAGGAGAGAGAGGAAGG - Intergenic
923566508 1:235080410-235080432 AAAGAGAAGGGAAGGGAGGCAGG + Intergenic
923681787 1:236124381-236124403 CAACAGAAGAGTAGTCAGGAAGG - Intergenic
924039679 1:239972059-239972081 AAAGAGAAAAGGAGGGAGGAAGG + Intergenic
924052152 1:240090166-240090188 CAAAAGAAGGGAAAGAAGGAGGG - Intronic
924064908 1:240210998-240211020 AGGAAGAAGGGGAGGGAGGAAGG - Intronic
924583602 1:245342719-245342741 AAGAAGAAGGGGAGGGAGGGAGG + Intronic
1062927584 10:1328309-1328331 TAACAGCAGTGGAGGGTGGAAGG + Intronic
1062958960 10:1558512-1558534 CCACAGAAGGGGACAGAGGTGGG - Intronic
1062958975 10:1558571-1558593 CCACAGAAGGGGACAGAGGTGGG - Intronic
1062998455 10:1891139-1891161 CAACAGGAAGGAAGGAAGGAAGG - Intergenic
1063138403 10:3236608-3236630 CAAAGGAAGGGGACGGAGAACGG - Intergenic
1063207592 10:3849155-3849177 AAAAAGGAAGGGAGGGAGGAAGG - Intergenic
1063484308 10:6404920-6404942 GAAGGGAAGGGAAGGGAGGAAGG - Intergenic
1063510630 10:6642051-6642073 GAATAGAAGGGGAGGCAGGTTGG - Intergenic
1063605370 10:7518752-7518774 AAAGAGAGAGGGAGGGAGGAAGG + Intergenic
1063674166 10:8125130-8125152 CAACAGAAACAAAGGGAGGAGGG + Intergenic
1063713135 10:8500166-8500188 AAAGAGAGAGGGAGGGAGGAAGG - Intergenic
1063718817 10:8557579-8557601 TAAAAGAATGGGAGGGTGGAAGG + Intergenic
1063754995 10:8997600-8997622 AGAGAGAATGGGAGGGAGGAAGG - Intergenic
1063854196 10:10228904-10228926 CAACAGAAATGGAGAGGGGAAGG + Intergenic
1063921982 10:10942443-10942465 CAACAGAAAGGCAGGGACTAAGG - Intergenic
1064088293 10:12362252-12362274 TATCAGAAGGTCAGGGAGGAGGG - Intronic
1064450082 10:15434342-15434364 AAAGAGAAGGGGGGGAAGGAAGG - Intergenic
1064479601 10:15726144-15726166 AAACAGAAAGGAAGGGAGGGAGG + Intergenic
1064525233 10:16249268-16249290 TACTAGAAGGGGAGGGAGGATGG + Intergenic
1064569781 10:16680612-16680634 AAAGGGAAGGGGAGGGAGGGAGG + Intronic
1064753820 10:18557335-18557357 GAACAGAATGGAATGGAGGATGG + Intronic
1064755580 10:18569555-18569577 CAATAGAATGGAAGGGAGAATGG - Intronic
1064921154 10:20519938-20519960 CATCAGAAGGGTAGAAAGGAGGG - Intergenic
1065077130 10:22091554-22091576 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1065087187 10:22190413-22190435 CTACAGAGGGGGAAGGAGGCAGG - Intergenic
1065088287 10:22203031-22203053 CAAGAGGAGGGAAGGAAGGAGGG - Intergenic
1065202898 10:23331212-23331234 GAAGGGAAGGGAAGGGAGGAGGG + Intronic
1065421978 10:25555050-25555072 GGAAAGAAGGGGAGGGAGGGAGG + Intronic
1065759088 10:28965013-28965035 CAAGAGGAGGGGAGAGAGGAGGG - Intergenic
1065791301 10:29263253-29263275 AGAGAGAAGGGGAGGGAGGGAGG + Intergenic
1066272537 10:33837549-33837571 CAGCAGAAGGGGAGCCAGAAAGG - Intergenic
1066371526 10:34821991-34822013 AAAGAAAAGGGGAGGGAGGAAGG + Intergenic
1066380778 10:34899614-34899636 AAACAGATGGGGTGGAAGGAGGG + Intergenic
1066523382 10:36247959-36247981 GAAAAGAAGGGAAGGAAGGAAGG - Intergenic
1067078675 10:43202127-43202149 CAACTTAAGGGGAAGGAAGAAGG - Intronic
1067269594 10:44778647-44778669 CACCAGTAGGGGTGGGAGGAGGG - Intergenic
1067408287 10:46043416-46043438 AGACAGAAAGGGAGGGAGGGAGG - Intronic
1067702521 10:48583988-48584010 GGACAGAAGGGGAAGGAGTAGGG - Intronic
1067991526 10:51218866-51218888 GAGAAGAAGGGGAGGAAGGAAGG + Intronic
1068266359 10:54655207-54655229 CAAAAAAAAGGAAGGGAGGAAGG + Intronic
1068343096 10:55734537-55734559 AAAAAGAAAGGGAGGGAGGGAGG + Intergenic
1068830661 10:61491198-61491220 AAGGAGAAGGGAAGGGAGGAAGG + Intergenic
1068897193 10:62219057-62219079 CAAAAGAAGGGGAGGAGGAAGGG - Intronic
1068912143 10:62389668-62389690 CAGCAGAGAGGAAGGGAGGAAGG + Intronic
1069481547 10:68787133-68787155 AAACAGAGGGAGAGGGAGAAGGG - Intronic
1069593363 10:69655364-69655386 CACCAGGAGGTGAGGGAGGAAGG + Intergenic
1069689148 10:70338194-70338216 AAACAGAAGGACAAGGAGGAGGG - Intronic
1069711956 10:70495336-70495358 CAAGAGAAGGAGAGGGAGGGAGG - Intronic
1069824079 10:71244661-71244683 CAAGAGGAGAGGAGGGAGGAGGG + Intronic
1069966936 10:72127069-72127091 CAACATAAGGGAATGGAGGGTGG + Intronic
1069973978 10:72198080-72198102 GAAGGGAAGGGGAGGGGGGAGGG + Intronic
1070112271 10:73497148-73497170 CCACGGAAGGAGAGGAAGGAAGG + Intergenic
1070459079 10:76646688-76646710 AAACAGAAGTGAAGGAAGGAAGG + Intergenic
1070495011 10:77013580-77013602 CAACAAAGGGGGAGGGAAAATGG - Intronic
1071160067 10:82735024-82735046 AAAAAGAAGGGAAGGGAAGAAGG + Intronic
1071731585 10:88253790-88253812 CAGGAGGAGGGGAGGGAGGGGGG - Intergenic
1071997075 10:91160141-91160163 CAACAGATGGAAATGGAGGAAGG - Intergenic
1072592946 10:96844133-96844155 GTACAGGAGGGGAGGGAGGGAGG - Intronic
1072842877 10:98794986-98795008 GAAAGGGAGGGGAGGGAGGAAGG + Intronic
1072879013 10:99205085-99205107 CAAAAGCAGGGAAGGTAGGAGGG + Intronic
1072908221 10:99474978-99475000 CAAGAAAAGGAGAGGGAAGAGGG + Intergenic
1072916528 10:99540506-99540528 CGACAGAAGGGGAAGGTGGAAGG + Intergenic
1073179301 10:101574292-101574314 CAGCAAAGCGGGAGGGAGGAGGG - Intronic
1073312878 10:102556746-102556768 AAAAAGGAAGGGAGGGAGGAAGG + Intronic
1073587798 10:104727423-104727445 AAACAGAAGGATAGGAAGGAGGG - Intronic
1073645517 10:105298045-105298067 AAAGAGAAAGGGAGGAAGGAAGG + Intergenic
1074087023 10:110215877-110215899 AAAAAGAGAGGGAGGGAGGATGG + Intronic
1074388087 10:113033201-113033223 CAGCAGAAGGAGGAGGAGGAAGG - Intronic
1074406605 10:113184904-113184926 CAGGAGAAGGGGAGGCAGAAAGG + Intergenic
1074522862 10:114240375-114240397 AGACAGAAGAGAAGGGAGGAGGG + Intronic
1074542182 10:114374103-114374125 CAACAGAGGAGGAGTGAGAATGG - Intronic
1074609143 10:115004468-115004490 GAAGAGAATGGAAGGGAGGAAGG - Intergenic
1075002467 10:118808698-118808720 CAGCAGAGGGGCAGGGTGGAGGG - Intergenic
1075025713 10:118981780-118981802 CAACAGTAGGGGTGGGTGGAAGG - Intergenic
1075051274 10:119184017-119184039 CAACAAAAGGGGAGGGGGGAGGG + Intergenic
1075081210 10:119385105-119385127 CAGTTGGAGGGGAGGGAGGAGGG + Intronic
1075425368 10:122337939-122337961 CCCCAGAAGGGGAAAGAGGAAGG - Intronic
1075576106 10:123578697-123578719 CCTCAGAAGGGTAGGGAGGAGGG - Intergenic
1075762132 10:124864835-124864857 CAACAGGAGGAGAGAGAGGCAGG + Intergenic
1076168996 10:128304605-128304627 CACCAGCAGTGGATGGAGGAGGG - Intergenic
1076211641 10:128651364-128651386 GAAGAGTAGGGGAGGGATGAAGG + Intergenic
1076393397 10:130120641-130120663 GAATAGAAGGGGAGGCAGGTTGG - Intergenic
1076778131 10:132709382-132709404 GAAGAGAGGAGGAGGGAGGAAGG + Intronic
1077231774 11:1461042-1461064 CAGCAGGAGCGGAGGGAGGGCGG - Exonic
1077240639 11:1508722-1508744 CCACAGCAGGACAGGGAGGATGG - Intergenic
1077252876 11:1568322-1568344 CAGAGGGAGGGGAGGGAGGAGGG + Intronic
1077543486 11:3158680-3158702 CAGGAGAGAGGGAGGGAGGAAGG + Intronic
1077817690 11:5703194-5703216 CTACACTAGGGGAGGGAGGAGGG - Intronic
1077994472 11:7441607-7441629 GAACAGAAAGGAAGGAAGGATGG - Intronic
1078312668 11:10260888-10260910 AGAAAGAAGGGGAGGGAGGGAGG + Intronic
1078380724 11:10837711-10837733 CAAGAAAGGGGGAGGGGGGAAGG - Intronic
1078759869 11:14243226-14243248 CAACAGCAGGTGAGGGAGTGGGG + Intronic
1078894813 11:15588678-15588700 CAAGTGAAGAGGAGGGAGGCAGG + Intergenic
1078911919 11:15740454-15740476 CAAAAGAAAAGGAAGGAGGAAGG + Intergenic
1079078238 11:17396735-17396757 CAATAGAAGGAGAGGAAAGATGG + Intronic
1079091029 11:17480441-17480463 CAACAGACAGGCAGGGAGGCTGG - Intergenic
1079749999 11:24185316-24185338 GAAGAAAAAGGGAGGGAGGATGG + Intergenic
1080103760 11:28490032-28490054 GAATAGAAGGAGAGGGAAGAAGG + Intergenic
1080303602 11:30813002-30813024 GAAGAGAAAGGAAGGGAGGAAGG - Intergenic
1080397893 11:31906724-31906746 AGACAGAGGGGAAGGGAGGAAGG - Intronic
1080521993 11:33075683-33075705 CAACAGAAGGGCAAAGAGTACGG + Intronic
1081401586 11:42649198-42649220 GAAAAGAGGGGGAGGGAGGCTGG - Intergenic
1081434104 11:43008278-43008300 AGAGAGAGGGGGAGGGAGGAAGG + Intergenic
1081603390 11:44511139-44511161 TAACAGAATGGGTGGGTGGAGGG - Intergenic
1081635471 11:44718657-44718679 TAACAGAAGGAGAGGGAAGGAGG + Intergenic
1081671359 11:44944430-44944452 CAGCAGATGGGGAGGTGGGAGGG - Intronic
1082063385 11:47879463-47879485 CGAAAGAGGGGAAGGGAGGAGGG + Intergenic
1082208603 11:49469125-49469147 ATACAGATGGGGAGGGAGAAAGG + Intergenic
1082269204 11:50151122-50151144 CAAAATAAAGGGAAGGAGGAAGG + Intergenic
1082986561 11:59174384-59174406 CATCAGAAGGTGAGGGTGGAGGG + Intronic
1083593746 11:63909479-63909501 CAAAGGAAGGGGAGGGTGGATGG + Exonic
1083889517 11:65588939-65588961 GGACAGAAGGGGAGGGAGCCTGG + Intronic
1083975438 11:66115776-66115798 AAAAAGAAGGGGAGGAGGGAAGG - Intronic
1084200075 11:67550890-67550912 CAACAGAAGGGGAAGCAGGCAGG - Intergenic
1084389547 11:68866003-68866025 AGACAGAAGGGAAGGAAGGAAGG - Intergenic
1084738712 11:71123501-71123523 CATCATAAGGAGAGGGAGGGAGG + Intronic
1084993113 11:72947624-72947646 CAACAGAATGTGCTGGAGGATGG - Intronic
1085270655 11:75267875-75267897 CATCTGAAAGGCAGGGAGGATGG + Intronic
1085314494 11:75536146-75536168 TGACAGAAAGGGAGGGAGGGAGG + Intergenic
1085473352 11:76772276-76772298 CAACTGAATGTGGGGGAGGAGGG + Intergenic
1085525075 11:77159405-77159427 CAGCATCAGGGGAGGGAGGGTGG - Intronic
1086092059 11:83014783-83014805 AAAGAGAAGGGGAGGGAGGGAGG + Intronic
1086310038 11:85525003-85525025 CAAGAGAAAGGAAGGAAGGAAGG - Intronic
1086641017 11:89156065-89156087 ATACAGATGGGGAGGGAGAAAGG - Intergenic
1086741005 11:90368941-90368963 AAAAAGATGGGGAGAGAGGAAGG - Intergenic
1087006665 11:93478384-93478406 AAAGGGAAGGGGAGGGAAGAGGG + Intergenic
1087501171 11:98956018-98956040 AAAAAGGAAGGGAGGGAGGAAGG - Intergenic
1087543835 11:99558290-99558312 CAACTGAAGGAGATGGAGGTAGG + Intronic
1087761763 11:102110473-102110495 GAAAAGAAAGGGAGGAAGGAAGG + Exonic
1087779918 11:102291018-102291040 CAATAGGAGGGGAGGGAGCTGGG - Intergenic
1087875038 11:103344928-103344950 CAGCAGAACGGGAGGGAGACTGG - Intronic
1087997003 11:104821797-104821819 AAAAAGAAAGGGAGGGAGGAAGG - Intergenic
1088030783 11:105246929-105246951 AAACAGATGGGGATTGAGGAAGG + Intergenic
1088147172 11:106695221-106695243 CAACAAAATGGAAGAGAGGACGG + Intronic
1088157320 11:106823239-106823261 CAAAAGCAGGGAAGGCAGGAGGG - Intronic
1088230403 11:107668390-107668412 AAATTGAAGGGGAGTGAGGAGGG + Intergenic
1088352868 11:108909478-108909500 CAAGGGAAGGGGCGGGAGTAGGG - Intronic
1089015512 11:115162166-115162188 CAGTAGAAGTGGCGGGAGGAGGG + Intergenic
1089095544 11:115917184-115917206 AAACAGAAAGGAAGGGAGGATGG - Intergenic
1089125832 11:116175852-116175874 GAAAAGGAAGGGAGGGAGGAGGG - Intergenic
1089225548 11:116917687-116917709 CGACAGGAAGGGAGGGAGGGAGG + Intronic
1089306861 11:117531915-117531937 AAAGGGAAGGGAAGGGAGGAGGG + Intronic
1089529447 11:119116841-119116863 GAGCAGGAGGGGAGGCAGGAAGG - Exonic
1089641149 11:119848027-119848049 CAGGAGAAGGGGAGGGCAGAGGG - Intergenic
1089735452 11:120547507-120547529 TCAGATAAGGGGAGGGAGGAAGG + Intronic
1090055778 11:123423340-123423362 GAAGAGAAGAGGAGAGAGGAGGG - Intergenic
1090078572 11:123595027-123595049 CACCCAAAGGGGAGGGAGGGAGG - Intronic
1090283941 11:125482520-125482542 CAAAAAAAGAGGAGGGAGGTTGG + Intronic
1090346027 11:126071512-126071534 CAACTGAAGCAGAGGAAGGAAGG + Intergenic
1090347650 11:126084017-126084039 CACCAGAAGAGGAGGGAGCTGGG + Intergenic
1090357060 11:126147210-126147232 GAAAGGAAGGGGAGGGAGGGAGG - Intergenic
1090404385 11:126468178-126468200 ACACAGCAGGGGAGGAAGGATGG - Intronic
1090584398 11:128194707-128194729 GAAGAGAAGGGAAGGGAGGAAGG - Intergenic
1091029177 11:132169041-132169063 CAAAAGAAGGAGGGGGTGGATGG - Intronic
1091502069 12:1028008-1028030 CAACAGTACGGGAGGGAGTTCGG + Exonic
1091612110 12:2019482-2019504 GAAAAGAAAGGGAGGGAGGGAGG + Intronic
1091689604 12:2586807-2586829 CAGGAGGAGGGGAGTGAGGATGG - Intronic
1091790690 12:3270367-3270389 CCAGAGAAGGGGAGGGATGGGGG - Intronic
1091869971 12:3881290-3881312 CAGGAGAGGGTGAGGGAGGAAGG + Intergenic
1092053911 12:5493256-5493278 CAACAGAATGAGAGCGTGGATGG + Intronic
1092118774 12:6029044-6029066 CAAAATAAAGGGAGGGAGGAAGG + Intronic
1092255712 12:6925942-6925964 CCAGAGAATGGGAGGGAGGCAGG - Intronic
1092286400 12:7131304-7131326 GGACAGACGGAGAGGGAGGACGG + Intronic
1092525302 12:9306115-9306137 CGACTGAAGGTGAGGCAGGAGGG + Intergenic
1092541970 12:9425702-9425724 CGACTGAAGGTGAGGCAGGAGGG - Intergenic
1092585252 12:9893696-9893718 GAAAAAAAAGGGAGGGAGGAAGG - Intronic
1092619464 12:10248573-10248595 GAAAAGAAGGGAAGGAAGGAAGG - Intergenic
1093680175 12:21993548-21993570 GAAGAGAAAGGGAGGGAGGGAGG + Intergenic
1094047113 12:26179276-26179298 CAGGAGAAGGTGAGGGCGGAGGG + Intronic
1094511040 12:31096737-31096759 CGACTGAAGGTGAGGCAGGAGGG + Exonic
1095089849 12:38093598-38093620 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1095091698 12:38113550-38113572 GAATAGAATGGGAGGCAGGATGG - Intergenic
1095148392 12:38759865-38759887 CAGCAGAAGGGAAGAGAAGAGGG + Intronic
1095253947 12:40011640-40011662 GAGGAGACGGGGAGGGAGGAAGG - Intronic
1095905552 12:47373805-47373827 AAAGAGAGGGGGAGGGAGGGAGG + Intergenic
1096204003 12:49706763-49706785 CAGCAGAAGGGGGAGGAAGAAGG + Intronic
1096462532 12:51829866-51829888 AAAGAGAATGGGAAGGAGGAAGG + Intergenic
1096596700 12:52700440-52700462 CCACAGAAGGTGAGGGAGGAAGG + Intronic
1096603084 12:52744302-52744324 AAAGAGAAGGGAAGGGAGGAAGG + Intergenic
1096659917 12:53118035-53118057 AGACAGAAGGGGAAGGAGAATGG + Intronic
1096740420 12:53689838-53689860 CATCAGAAAGGAAGGAAGGAAGG - Intergenic
1096810111 12:54164011-54164033 CAAGAGAAGGGGAGGAAGGCAGG + Intergenic
1096830885 12:54313177-54313199 AAAAAGGAAGGGAGGGAGGAAGG + Intronic
1096847680 12:54417115-54417137 GAGCAGAAGGGGAGGGGGAAGGG + Intronic
1096869516 12:54584582-54584604 TAAAAGAGAGGGAGGGAGGAGGG + Intronic
1097102314 12:56598429-56598451 CAAGAGGAGGGAAGGGAGAAAGG + Exonic
1097161071 12:57047139-57047161 CTAGAGAAGGGAAAGGAGGAAGG + Intronic
1097181395 12:57173995-57174017 CAGGAGAAGGGTAGGGAGGGTGG + Intronic
1097376383 12:58848227-58848249 CAAAAAAAAGGGAGGGAGGAAGG - Intergenic
1097864428 12:64547582-64547604 AAAAAGAAGGGAAGGAAGGACGG + Intergenic
1097926480 12:65134018-65134040 AAAGAGGAGGGGAGGAAGGAAGG + Intergenic
1098046534 12:66407166-66407188 TAAAAGAAGGGAAGGGAGAATGG - Intronic
1098065264 12:66608012-66608034 CAGCAGGTGGGGAGGGAGGCAGG + Intronic
1098236145 12:68420198-68420220 CAAGAGGAGAGGAGGAAGGAGGG + Intergenic
1098876027 12:75867347-75867369 AGACAGAAGGGGCTGGAGGATGG - Intergenic
1099101787 12:78450556-78450578 AAAAAGAAGAGGAGAGAGGAAGG + Intergenic
1099248045 12:80217299-80217321 GATGGGAAGGGGAGGGAGGATGG + Intronic
1099469427 12:83029156-83029178 GAACAAAAGGAGAGGGAGTATGG + Intronic
1099493006 12:83309007-83309029 AAAGAAAGGGGGAGGGAGGAAGG - Intergenic
1099595020 12:84650743-84650765 CAACATAAGCAGAGGGAGCAGGG - Intergenic
1099809144 12:87558452-87558474 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1099906292 12:88775384-88775406 CAACACATGGGGAGAGAAGATGG - Intergenic
1100080459 12:90842732-90842754 CAACTGAAAGGGAGGGGGGCAGG + Intergenic
1100286285 12:93169617-93169639 GAAAGGAAGGGGAGGGAGGGAGG + Intergenic
1100405318 12:94267834-94267856 AAAAAGAAGGGGAGGAGGGAAGG - Intronic
1100756968 12:97762063-97762085 CAAGAGAAAAGGAGGGAGTAGGG - Intergenic
1100856120 12:98758709-98758731 GAAGAGAAGGGAAGGGAAGAGGG - Intronic
1100863746 12:98833740-98833762 ACAAAGGAGGGGAGGGAGGAAGG - Intronic
1101186287 12:102284129-102284151 GAAGAGACGGGGTGGGAGGAAGG - Intergenic
1101255514 12:102973442-102973464 GCAGAGAGGGGGAGGGAGGAAGG - Intergenic
1101621725 12:106395401-106395423 CAAGAGAGCGTGAGGGAGGAGGG + Intronic
1101673348 12:106896709-106896731 GAAGGGGAGGGGAGGGAGGAGGG + Intergenic
1101673364 12:106896740-106896762 GAAGGGGAGGGGAGGGAGGAGGG + Intergenic
1101814253 12:108133749-108133771 TTACAGAAGGTGAGGGAGGCGGG - Intronic
1101931173 12:109015452-109015474 CAGCAGAAGGGGTGGGAGTCTGG + Intronic
1102051317 12:109864118-109864140 CAACAGTAGGGGAGGAATGTGGG + Intronic
1102052163 12:109870626-109870648 AAGCAGAAGGAGAGGAAGGAAGG + Intronic
1102275730 12:111580658-111580680 AGAGAGAAGGGGAGGGAGGGGGG + Intronic
1102275739 12:111580682-111580704 AGAGAGAAGGGGAGGGAGGGAGG + Intronic
1102503160 12:113366809-113366831 AAAAAGAAGGGGAGGGAAGGGGG - Intronic
1102517512 12:113459834-113459856 GAAGAGGAGGGGAGGGAGGCAGG - Intergenic
1102673241 12:114637757-114637779 CAAGAGAAAGAGAGGAAGGAAGG + Intergenic
1102717122 12:114983954-114983976 AGAGAGAAAGGGAGGGAGGAAGG - Intergenic
1102792962 12:115663066-115663088 CAACAGGATGGGAGAGAGGGAGG + Intergenic
1102821486 12:115912805-115912827 CAAGAGAAAGGAAGGAAGGAAGG - Intergenic
1102906290 12:116677881-116677903 GAATACAAGAGGAGGGAGGATGG - Intergenic
1102984063 12:117264597-117264619 GGAGAGAAGGGGAGGGAGGGAGG - Intronic
1103135009 12:118499459-118499481 GAAAAGAAGGAGAGGAAGGAAGG - Intergenic
1103461870 12:121111306-121111328 AAAAAGAAGGGAAGGAAGGAAGG + Intergenic
1103497135 12:121371526-121371548 CAACAGAGAGAGAGAGAGGAAGG - Intronic
1103954528 12:124568712-124568734 AAGCAGAAGAGGAGGGAGGGAGG - Intergenic
1103954964 12:124571006-124571028 CAACAGAGGGGGAAGGAGGCAGG + Intergenic
1103976674 12:124707234-124707256 AAACAGAAAAGGAGGGAGGAAGG + Intergenic
1104088798 12:125497156-125497178 CAACAGCAGGGCAATGAGGAAGG - Intronic
1104198580 12:126565748-126565770 CTACAGAATGAGAGGGAGAAAGG - Intergenic
1104330028 12:127836152-127836174 CAAAAAAAGGGGCGGGGGGAGGG - Intergenic
1104463382 12:128971874-128971896 GCACAGAAAGGGAGAGAGGAGGG - Intronic
1104629919 12:130391658-130391680 CAGCAGAATGGTAGGGAGGCTGG + Intergenic
1104631385 12:130405615-130405637 GAACAGAAAAGGAGGGAGGGTGG + Intronic
1104657200 12:130582119-130582141 CAGCAGAGGAGGAGGGAGGGAGG - Intronic
1104661475 12:130613939-130613961 CAGCAGAGAGGGAGGGAGGCAGG + Intronic
1104664577 12:130638652-130638674 CAACAGATGGGGAGGGGGAAAGG - Intronic
1104786049 12:131448507-131448529 CAGGAGACGGGGAGGGAGGGAGG + Intergenic
1105233844 13:18527003-18527025 GAAAAGGAAGGGAGGGAGGAAGG + Intergenic
1105456818 13:20548627-20548649 AAAAAGAAAGGGAGGGAGGGAGG + Intergenic
1105644890 13:22306531-22306553 CAACAGATGTAGAGGGAAGATGG - Intergenic
1105727733 13:23182462-23182484 TGAGAGAAGGGGAGGGAGGGAGG - Intronic
1105762929 13:23530209-23530231 CATCAAAAGGGGAAGGAGAAGGG + Intergenic
1105894871 13:24709291-24709313 CCACAGTAGGGGAGGGGGGCTGG - Intronic
1106321463 13:28643479-28643501 TAACAGAGGGCGAGGAAGGAGGG - Intergenic
1106375498 13:29182910-29182932 CAGCTGAAGGGGAGGGAGCAGGG + Intronic
1106671662 13:31912649-31912671 AAAAAGAAAGGGAGGAAGGAAGG - Intergenic
1107708202 13:43127609-43127631 AGACAGAGGGAGAGGGAGGAGGG - Intergenic
1107718058 13:43220068-43220090 CAAAGGGAGGGGAGGAAGGAAGG + Intronic
1108163530 13:47667603-47667625 CAATAGAAGGGCACAGAGGAAGG + Intergenic
1108231559 13:48349229-48349251 AAAAAGAAAGGGAGGGAAGATGG - Intronic
1108853832 13:54768883-54768905 CAAGGGAAGGGAAGGGAGGAAGG - Intergenic
1109191813 13:59333570-59333592 AAACAGGAGGGAAGGAAGGAAGG + Intergenic
1109267878 13:60221622-60221644 CAATAGAAGGGTAAGGAGGACGG - Intergenic
1109473053 13:62835979-62836001 AAAAAGAAAGAGAGGGAGGAAGG - Intergenic
1109734859 13:66469451-66469473 CAAAAGGAAGGGAGGGAGGGGGG + Intronic
1110582884 13:77152727-77152749 CAGCAGAAGGGGAGCTAGAAAGG - Intronic
1110637552 13:77783395-77783417 GAGGAGAAGGAGAGGGAGGAGGG + Intergenic
1110868003 13:80419955-80419977 GAAGAGAAGGGAAGGGAGAAGGG - Intergenic
1110896190 13:80755295-80755317 CAACAAAAGTACAGGGAGGAGGG - Intergenic
1111074544 13:83216506-83216528 CAAATCAAGGGGAGGGAGCAAGG - Intergenic
1111275006 13:85936564-85936586 GAAAAGAAGGAGAGGAAGGAAGG - Intergenic
1111446120 13:88347867-88347889 GGAAGGAAGGGGAGGGAGGAAGG + Intergenic
1111452618 13:88438740-88438762 AAAAAGGAAGGGAGGGAGGAAGG + Intergenic
1112211220 13:97379677-97379699 GAACAGAAAGGGTGGGAGGGTGG + Intronic
1112229887 13:97578803-97578825 CAGCAGAAAGGGAGGGAGAGGGG + Intergenic
1112516654 13:100059021-100059043 AAAAAGGAAGGGAGGGAGGAAGG + Intergenic
1112643929 13:101307672-101307694 CAAGAAAAGGGAAGGGAGGAGGG + Intronic
1112661175 13:101510154-101510176 CTAGAGGAGGGGATGGAGGAAGG - Intronic
1113032378 13:106008394-106008416 GAAGGGAAGGGGAGGGAGGGGGG + Intergenic
1113050925 13:106211068-106211090 AGAGAGAAAGGGAGGGAGGATGG + Intergenic
1113337676 13:109392712-109392734 GAAGAGAAGGGAAGGAAGGAAGG + Intergenic
1113614507 13:111671081-111671103 GAAGAGAGAGGGAGGGAGGAAGG - Intronic
1113619975 13:111755995-111756017 GAAGAGAGAGGGAGGGAGGAAGG - Intergenic
1113814054 13:113159418-113159440 CGAGAGAAAAGGAGGGAGGATGG + Intronic
1113891514 13:113738083-113738105 AAACAGAAAGGGAGGGAGGGAGG - Intergenic
1114260407 14:21032509-21032531 CAACAGATGAGGAAGGTGGAGGG - Intronic
1114261452 14:21039529-21039551 CAACAGAAAAAGATGGAGGAAGG - Intronic
1114419935 14:22573354-22573376 ACATAGAAGGGGAGGGAGGAAGG + Intronic
1114557221 14:23568916-23568938 CACCAGAGGGGGCTGGAGGAGGG + Exonic
1114713400 14:24801321-24801343 AAACAGAAGAGGGGGCAGGATGG + Intergenic
1114714370 14:24808740-24808762 GAACAGAAGGGGAGGCATGGTGG - Intergenic
1115067021 14:29275740-29275762 CAGCAGAAGTGGAGGGAAAAAGG - Intergenic
1115128456 14:30024721-30024743 CCACCCAAGGGGAGGGAGGTGGG - Intronic
1115631197 14:35247309-35247331 TAAGAGAAAGGAAGGGAGGAAGG - Intronic
1115657990 14:35462538-35462560 GAGGGGAAGGGGAGGGAGGAAGG - Intergenic
1116491221 14:45505808-45505830 CGGCAGAAGGGGTGGGAGGAGGG - Intergenic
1117194858 14:53329647-53329669 CAGCAGAGGGGGAATGAGGATGG - Intergenic
1117202659 14:53408384-53408406 CAGGAGTAGGGGAGGGAGGCAGG - Intergenic
1117202666 14:53408403-53408425 CAGGAGTAGGGGAGGGAGGCAGG - Intergenic
1117351243 14:54883881-54883903 CTAAAGAAGGTGAGGCAGGAAGG + Intronic
1117419301 14:55528445-55528467 CAATAGAATGGGAGGCAGGTTGG - Intergenic
1117579580 14:57138704-57138726 CAAATGAGGGGGAAGGAGGATGG + Intergenic
1117846863 14:59920480-59920502 CAAGAGAAGGAAAGGGAGGGTGG + Intronic
1117922447 14:60739193-60739215 AGAGAGAAAGGGAGGGAGGAAGG + Intronic
1118137693 14:63046333-63046355 CGAGAGAGGGGGAGTGAGGAGGG + Intronic
1118139426 14:63064336-63064358 AAAGAGAAGGGGAAGGAGAAAGG + Intronic
1118245287 14:64104350-64104372 CAAGAAAAGGAGATGGAGGAGGG - Intronic
1118366446 14:65101696-65101718 CAAGGGGTGGGGAGGGAGGAAGG - Intronic
1118470953 14:66074944-66074966 GAAGGGATGGGGAGGGAGGAAGG - Intergenic
1119002742 14:70897768-70897790 GTACAGAAGCAGAGGGAGGAAGG + Intergenic
1119420421 14:74504907-74504929 TGAAAGAAGGGGAGAGAGGAAGG - Intronic
1119710650 14:76820429-76820451 CAGCAGACAGGGAGGGACGAGGG + Intronic
1119743338 14:77027883-77027905 CGACTGCGGGGGAGGGAGGAGGG + Exonic
1119745309 14:77039764-77039786 CCACAGATGGGGAGGGAGTTCGG - Intergenic
1119804443 14:77473733-77473755 CAAGAGAAAGGGAGTGAGCATGG + Intergenic
1119913317 14:78371378-78371400 CAGCAGAAGGGGAGGTGGAAGGG - Intronic
1119922199 14:78456932-78456954 GAAGGGAAGGGAAGGGAGGAAGG - Intronic
1119957055 14:78809710-78809732 CAACCTAAGGAGAGGGTGGAGGG + Intronic
1120367751 14:83592047-83592069 GAATAGAAGGAGAGGAAGGAAGG - Intergenic
1120583881 14:86287240-86287262 GAAGAGAAGGGGAGGGAAGGAGG + Intergenic
1120583921 14:86287385-86287407 AAAGAGAAGGGAAGGGATGAGGG + Intergenic
1120746907 14:88160366-88160388 CAGAAGAAAGGAAGGGAGGATGG - Intergenic
1120800431 14:88682551-88682573 AACCAGATGAGGAGGGAGGAAGG - Intronic
1120873736 14:89360343-89360365 AAAGAGAAAGGGAGGGAGGGAGG + Intronic
1121022791 14:90591743-90591765 GAACAGAAAGGGAAGGAGTATGG - Intronic
1121328535 14:93035583-93035605 AAACAGGACGGGAGGGAGGGAGG + Intronic
1121468206 14:94129400-94129422 GAAGGGAAGGGGAGGGAGGAAGG + Intronic
1121897068 14:97658480-97658502 AGACGGAAGGGAAGGGAGGATGG + Intergenic
1122040401 14:98983779-98983801 CAATAGGAAGGGAGGGAGGAAGG + Intergenic
1122088369 14:99322327-99322349 AACCAGAAGGAGAGGGGGGACGG + Intergenic
1122230859 14:100305845-100305867 CAACGGATGGGGATGGGGGAGGG + Intronic
1122420223 14:101571712-101571734 AAGCAGAGGGGGAAGGAGGAGGG + Intergenic
1122662730 14:103308937-103308959 AAAGAGGAAGGGAGGGAGGAAGG + Intergenic
1122725641 14:103749539-103749561 AAACACATGGGGAGGAAGGAAGG + Intronic
1122897951 14:104769632-104769654 ACACAGAAGGGGAAGGGGGAGGG + Exonic
1123839436 15:24232908-24232930 CACCAGAAAGGGAGAGAGAAAGG + Intergenic
1124044067 15:26131823-26131845 GAAAGGAAGGGGAGGGAGGGAGG - Intergenic
1124167756 15:27343161-27343183 AACACGAAGGGGAGGGAGGAAGG + Intronic
1124211976 15:27770995-27771017 GAAAAGAAGGGAAGGAAGGAAGG - Intronic
1124455807 15:29841716-29841738 AAAAAGGAGGGGAGGGAGGGAGG - Intronic
1124548146 15:30651916-30651938 GGGAAGAAGGGGAGGGAGGAAGG - Intronic
1124589085 15:31037126-31037148 GAACAGGAGAGGAGGCAGGAGGG - Intronic
1124611462 15:31212351-31212373 GGAGAGAAGGGGAGAGAGGAAGG + Intergenic
1124712764 15:32029632-32029654 AAAGAGGAAGGGAGGGAGGAAGG - Intergenic
1124720609 15:32108239-32108261 ACACTGAAGGGAAGGGAGGAAGG - Intronic
1125217218 15:37289319-37289341 CAACAGGAGGGGAGGAAGGGAGG - Intergenic
1125348891 15:38747056-38747078 TAACAGTAGGGGAGAGAGGCTGG - Intergenic
1125359524 15:38850347-38850369 GAAGAGAAGAGGAGGGAGGCAGG + Intergenic
1125691475 15:41599527-41599549 CAGCAGAAGGAGAGTGAGGGTGG + Intergenic
1125744774 15:41990717-41990739 GAAGAGGAGGGGAGGGAGGGAGG - Intronic
1125748220 15:42011761-42011783 AAGCAGAAGGGGTTGGAGGAAGG + Intronic
1125817995 15:42602849-42602871 TAACAAAAGGGGTGGGATGAAGG - Intronic
1126079581 15:44946384-44946406 CAGCAGAAGGCTAAGGAGGAAGG + Intergenic
1126142501 15:45449771-45449793 GAGGGGAAGGGGAGGGAGGAGGG + Intergenic
1126167656 15:45667106-45667128 GAAGGGGAGGGGAGGGAGGAAGG - Intronic
1126920555 15:53517819-53517841 CAAGAGGAGGGGAGGGAGAGAGG + Intronic
1127430603 15:58903537-58903559 CATCTGACGGGGAGGGGGGAGGG + Intronic
1127646956 15:60968273-60968295 GGACAGAAGGGGAGCAAGGAAGG + Intronic
1127818213 15:62631618-62631640 AGAAAGAAAGGGAGGGAGGAGGG - Intronic
1127973018 15:63977101-63977123 AAAGAGAAGGGGAAGGGGGAAGG + Intronic
1127997599 15:64162756-64162778 AGACAGAAGCCGAGGGAGGAGGG + Intronic
1128146141 15:65333419-65333441 CAGAGGAAGGGGAGGGGGGATGG + Intronic
1128228146 15:66017122-66017144 AAGCAGTAGGGGACGGAGGAGGG + Intronic
1128355580 15:66924070-66924092 GAAGAGAAGGGGAGGGAAGGAGG - Intergenic
1128427782 15:67559797-67559819 CAACAAAAGGGGTGGGGGTAGGG - Intronic
1128480641 15:68034934-68034956 AAAGAGAGAGGGAGGGAGGAAGG - Intergenic
1128770871 15:70281490-70281512 GAACAGTAGGTGATGGAGGAAGG - Intergenic
1128865955 15:71115417-71115439 CCGCAAGAGGGGAGGGAGGAAGG + Exonic
1129168477 15:73793280-73793302 CAACAGGAGGGGAGTCAGGTTGG - Intergenic
1129182577 15:73886506-73886528 CCACAGAAGGGAAGGGTGCAGGG + Exonic
1129252824 15:74318287-74318309 CAAGGGCAGGTGAGGGAGGAGGG + Intronic
1129431062 15:75502459-75502481 AAAAAGAGAGGGAGGGAGGAAGG + Intronic
1129434104 15:75523955-75523977 AAACAGGGGGGGATGGAGGAGGG + Intronic
1129442132 15:75588976-75588998 GAGGAAAAGGGGAGGGAGGAGGG + Intergenic
1129785413 15:78306854-78306876 CCGCAGGAGGGGAGGGAAGAGGG - Intergenic
1129847419 15:78774329-78774351 CAACAGCTGGGGCGGGAGTATGG + Intronic
1129882571 15:79016922-79016944 CAGCAGAAGGGGAGGGAGGTTGG - Intronic
1130127372 15:81105164-81105186 AAAAAGGAAGGGAGGGAGGAAGG - Intronic
1130332675 15:82934142-82934164 GAACAGAAAGGGAGGGGGAAGGG + Intronic
1130414839 15:83683334-83683356 CAATAGAGGAGCAGGGAGGAAGG - Intronic
1130894913 15:88162460-88162482 CAGCAGAAGGAGAGGGGAGAAGG + Intronic
1130951729 15:88596217-88596239 GAAGAGGAGGGGAGGGAGGGGGG - Intergenic
1131081387 15:89539185-89539207 AAAGAGAAGGAGAGGAAGGAAGG + Intergenic
1131393050 15:92064856-92064878 CAGCTGGAGGGTAGGGAGGAAGG + Intronic
1131753821 15:95538921-95538943 CAAAAAAAGGGAAGGAAGGAAGG + Intergenic
1132014759 15:98305730-98305752 AAACAGAAGAGGAAGGAAGAGGG + Intergenic
1132078654 15:98845546-98845568 CGAGAGAAGAGGAGAGAGGAGGG - Intronic
1132304068 15:100796846-100796868 GAAAAGAAAGGGAGGGAGGGAGG + Intergenic
1132325741 15:100968714-100968736 GAAGGGAAGGGAAGGGAGGAAGG - Intronic
1132377996 15:101344511-101344533 CAGCAGGAGAGGAGGGAGGGAGG - Intronic
1132406290 15:101543381-101543403 CAAGGGAAGCGGAAGGAGGAAGG - Intergenic
1132425298 15:101710811-101710833 CAAGAGAAGGAGAGGGGGGTGGG + Intronic
1132746006 16:1436588-1436610 CCACACAGGGAGAGGGAGGAGGG + Intronic
1133459179 16:5972217-5972239 GAACAGATAGGGAGGGAGGGAGG - Intergenic
1133594075 16:7273253-7273275 AAAGAGAAAGGGAGGAAGGAAGG - Intronic
1133639434 16:7702615-7702637 GACCAGAAGGGGAGGGCGCATGG - Intronic
1133684102 16:8149458-8149480 CAACAACAGGGGAGGAAGGTGGG - Intergenic
1133839504 16:9394771-9394793 AAGCAGGAAGGGAGGGAGGAAGG - Intergenic
1133865869 16:9642903-9642925 GAACAGGGAGGGAGGGAGGAGGG + Intergenic
1134031781 16:10998034-10998056 CAATGGGATGGGAGGGAGGATGG - Intronic
1134754021 16:16650613-16650635 CAGGAGAAAGGGAGGGAGGGAGG - Intergenic
1134872780 16:17666871-17666893 CAACAGAAGGAGAGGGGGAAAGG - Intergenic
1134992038 16:18708431-18708453 CAGGAGAAAGGGAGGGAGGGAGG + Intergenic
1135068523 16:19332209-19332231 AAACAGAAAGGAAGGAAGGAAGG + Intergenic
1135164778 16:20129573-20129595 GAAGAGAAGGGAAGGGGGGATGG - Intergenic
1135194509 16:20383438-20383460 GAAGAGATGGGGAGGGAGGGCGG - Intronic
1135694693 16:24575754-24575776 AAAGAGAGGGAGAGGGAGGAGGG + Intergenic
1135760289 16:25132538-25132560 AAACACTTGGGGAGGGAGGAGGG - Intronic
1135892127 16:26366665-26366687 AAGCAGAGGGAGAGGGAGGAGGG + Intergenic
1135939558 16:26809613-26809635 AAAGAGAGGGGGAGGGAGGAAGG + Intergenic
1136021177 16:27441078-27441100 AAAAAGAAAGGGAGGGAGGGAGG + Intronic
1136067513 16:27768828-27768850 CTGCAGAAAGGAAGGGAGGAAGG - Intronic
1136299614 16:29325016-29325038 CAAGAGAGAGGAAGGGAGGAGGG - Intergenic
1136531730 16:30874627-30874649 AAACAAAAGGGGAGGGCGGGGGG + Intronic
1136532114 16:30876697-30876719 AGAGAGAAGGGGAGGGTGGAGGG + Intronic
1136589014 16:31206059-31206081 AAAGAGGAGGGGAGGGAGGGAGG - Intergenic
1136749131 16:32617046-32617068 GCACAGAGGTGGAGGGAGGAGGG - Intergenic
1136770939 16:32840540-32840562 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1136922799 16:34345888-34345910 CCAGAGCTGGGGAGGGAGGATGG - Intergenic
1136981774 16:35065918-35065940 CCAGAGCTGGGGAGGGAGGATGG + Intergenic
1137465300 16:48702925-48702947 CAAAAGGAAGGGAGGAAGGAAGG - Intergenic
1137912310 16:52390425-52390447 GATCAGGAGGGGAGGGCGGAGGG + Intergenic
1138600538 16:58051522-58051544 AAGGAGAAAGGGAGGGAGGAAGG + Intergenic
1138835283 16:60427434-60427456 GAAAAGAAGGGAAGGAAGGAGGG - Intergenic
1139310388 16:66023499-66023521 CATGAGCAGGGGAGTGAGGAAGG - Intergenic
1139402972 16:66696732-66696754 CAGCGGAAAGGGAGGGAGGTGGG + Intergenic
1140133586 16:72185342-72185364 GTAAAGAAGGGCAGGGAGGAGGG - Intergenic
1140339315 16:74141441-74141463 CAAAAGGAAGGGAGGGAGGGAGG + Intergenic
1140603495 16:76506419-76506441 GAAGGGAAGGGAAGGGAGGAAGG - Intronic
1140603504 16:76506442-76506464 AAGCGGAAGGGGAGGGAAGAAGG - Intronic
1140685239 16:77427153-77427175 CAACAGAAGCTCAGGGAGGCTGG - Intronic
1140896032 16:79325022-79325044 TAAGAGAAGGGGAGAGAAGAAGG - Intergenic
1140944625 16:79756464-79756486 CAAAAGAAATGAAGGGAGGAAGG + Intergenic
1140967661 16:79982972-79982994 AGAAAGAAGGGGAGGAAGGAAGG - Intergenic
1141045516 16:80712939-80712961 CAACAGAAGGGACAAGAGGAAGG + Intronic
1141149254 16:81552808-81552830 AAAGAGAGAGGGAGGGAGGAAGG - Intronic
1141437834 16:84010792-84010814 GAACAGAAAGGGAGGGTGGGGGG - Intronic
1141513137 16:84525382-84525404 GAGCGGAGGGGGAGGGAGGATGG - Intronic
1141527054 16:84618290-84618312 GAAGAGAGCGGGAGGGAGGAGGG - Intergenic
1141773015 16:86102296-86102318 AAAGAGAGAGGGAGGGAGGAAGG - Intergenic
1142368008 16:89660435-89660457 CACCAGAGGGTGGGGGAGGAAGG + Intronic
1203051264 16_KI270728v1_random:876260-876282 GCACAGAGGTGGAGGGAGGAGGG - Intergenic
1203073362 16_KI270728v1_random:1102653-1102675 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1142495359 17:303535-303557 AAAGAGATGGGGAGGGAGGGAGG + Intronic
1142495370 17:303604-303626 AAAGAGATGGGGAGGGAGGGAGG + Intronic
1142495381 17:303673-303695 AAAGAGATGGGGAGGGAGGGAGG + Intronic
1142495404 17:303811-303833 AAAGAGATGGGGAGGGAGGGAGG + Intronic
1142495415 17:303880-303902 AAAGAGATGGGGAGGGAGGGAGG + Intronic
1142495426 17:303949-303971 AAAGAGATGGGGAGGGAGGGAGG + Intronic
1142495437 17:304018-304040 AAAGAGATGGGGAGGGAGGGAGG + Intronic
1142495448 17:304087-304109 AAAGAGATGGGGAGGGAGGGAGG + Intronic
1142635562 17:1255226-1255248 CAAAAGAAGGAGAGGAAGAATGG - Intergenic
1142925369 17:3231720-3231742 CAACAGGAGAGAAGGTAGGAGGG - Intergenic
1143021231 17:3918070-3918092 AAAGGGAAGGGAAGGGAGGAAGG + Intergenic
1143021299 17:3918244-3918266 GAAGGGAAGGGGAGGGAGGGAGG + Intergenic
1143179495 17:4975157-4975179 GACAAGAAGGGGAGGCAGGAGGG + Intronic
1143224522 17:5289147-5289169 AAGAAGAAAGGGAGGGAGGAAGG - Intronic
1143246300 17:5488307-5488329 GAACAGAAAGAGAGGGTGGAGGG + Exonic
1143267682 17:5652718-5652740 CAGTATATGGGGAGGGAGGAAGG + Intergenic
1143481201 17:7228169-7228191 CTAGAGAAGGTGAGGGTGGAAGG + Intronic
1143509542 17:7387934-7387956 CTTCAGAAGGGAAGGCAGGAGGG - Intronic
1143869787 17:9949858-9949880 AAAAAGAAAGGGAGGGAGGGAGG - Intronic
1143871312 17:9959018-9959040 CAGGAGAAGGGGAGGTGGGAGGG + Intronic
1143976390 17:10833038-10833060 CAAGAAAAGGGAAGGGAAGAGGG + Intronic
1144044293 17:11440936-11440958 CAAGAGGAAAGGAGGGAGGAAGG + Intronic
1144178934 17:12734066-12734088 TAAGAGAAGGGGAGAGAGGGTGG - Intronic
1144212286 17:13025733-13025755 GAAGAGAGGGGGAGGAAGGAAGG - Intergenic
1144237293 17:13273959-13273981 CAACTGAAGGGGAAGAAGGAGGG - Intergenic
1144374800 17:14628281-14628303 CATAAGAAGGGAAGGAAGGATGG + Intergenic
1144427593 17:15158298-15158320 CAACAGAGGGGGTGTAAGGAGGG + Intergenic
1144444745 17:15316461-15316483 TCAAAGGAGGGGAGGGAGGAGGG + Intronic
1144445338 17:15322067-15322089 TCAAAGGAGGGGAGGGAGGAGGG + Intronic
1144572015 17:16406286-16406308 GAAAAGAAGGGAAGGAAGGAAGG + Intergenic
1144877700 17:18411054-18411076 AAAAGGATGGGGAGGGAGGAGGG - Intergenic
1145030796 17:19503567-19503589 CAACAGCAGAGCTGGGAGGAGGG + Intronic
1145154529 17:20533349-20533371 AAAAGGATGGGGAGGGAGGAGGG + Intergenic
1145238541 17:21225997-21226019 GAAGAAAAGGGGAGGGAAGAGGG - Intergenic
1145868849 17:28257358-28257380 GGAAAGAAGGGAAGGGAGGAAGG + Intergenic
1146059794 17:29598515-29598537 AAAGAGAAAGGGAGGGAGGCAGG - Intronic
1146578044 17:34012046-34012068 CAAAATAAGGGGAGGGAGGAAGG - Intronic
1146599127 17:34198670-34198692 AAACAGAAAGGAAGGAAGGAAGG + Intergenic
1147129700 17:38399870-38399892 CCAAAGAAGGGGTGGGAGGAGGG + Exonic
1147254450 17:39173890-39173912 CACCAGACAGGGAGGGGGGAAGG + Exonic
1147311919 17:39600538-39600560 CAACAGAGGGGCAGCGCGGAGGG - Intergenic
1147416619 17:40295904-40295926 CAGCAGGAGGGGCAGGAGGATGG - Intronic
1147476167 17:40713476-40713498 AACCAGAATGGGAGGGAGAAGGG - Intergenic
1147615111 17:41822924-41822946 CCACTGGAGGCGAGGGAGGAGGG - Exonic
1147720537 17:42536941-42536963 AAAGAGAAGGTGGGGGAGGAAGG - Intronic
1147785766 17:42977642-42977664 AGAGAGAGGGGGAGGGAGGAAGG + Intronic
1148131039 17:45262698-45262720 GGACAGGAGGGGAGGGTGGAGGG + Intergenic
1148262695 17:46197123-46197145 AAAAAGAAAGGAAGGGAGGAAGG + Intronic
1148268214 17:46243472-46243494 GAAAAGAAAAGGAGGGAGGAAGG + Intergenic
1148324768 17:46776871-46776893 CAACGGGAGGGGAAGGAGGAGGG - Intronic
1148340678 17:46871825-46871847 AAAGAGAAGGGAAGGAAGGAAGG - Intronic
1148476433 17:47931785-47931807 AAACACAGGTGGAGGGAGGAAGG - Intergenic
1148486478 17:47994337-47994359 CAACGGAAGGCGAGGGAGGCTGG + Intergenic
1148691550 17:49529858-49529880 CAACAGCAGAGCACGGAGGAAGG - Intergenic
1148721220 17:49754648-49754670 GAGAAGAAGGGGAGGGAAGAGGG + Intronic
1149032108 17:52095790-52095812 CATCAGAAGGGAAGTGAGGCTGG - Intronic
1149305925 17:55346516-55346538 GGACAGGAGGGGAGGGAAGAGGG - Intergenic
1149450787 17:56748409-56748431 CAGCAGGAGGGAAGGCAGGAAGG - Intergenic
1149452504 17:56760751-56760773 GAAGAGAAGGGAAGGAAGGAAGG + Intergenic
1149687839 17:58548089-58548111 CAAAAGAAGAGTAAGGAGGAGGG - Intergenic
1149808920 17:59647802-59647824 GAAGAGAAGGGATGGGAGGAAGG - Intronic
1150152244 17:62819590-62819612 GAAGAGAAGGAGAGGAAGGATGG - Intergenic
1150519574 17:65852286-65852308 GAAGGGAAGGGAAGGGAGGAGGG - Intronic
1150786259 17:68165371-68165393 GAAGGGAAGGGGAGGGAGGAGGG + Intergenic
1150824203 17:68460279-68460301 CAACTGATGGGGAAGGGGGAGGG + Intergenic
1150977812 17:70108788-70108810 AAGGAGAAAGGGAGGGAGGAAGG - Intronic
1151005611 17:70432636-70432658 GCACAGAAGGGGAGGAAGAATGG - Intergenic
1151050999 17:70978550-70978572 GAAAAGAAGGGGAGGGAGGGAGG + Intergenic
1151051009 17:70978576-70978598 GAAAAGAAGGGGAGGGAGGGAGG + Intergenic
1151133718 17:71924835-71924857 AGAAAGAAAGGGAGGGAGGAAGG + Intergenic
1151678000 17:75609707-75609729 CATCAGGAAGGGAGGGAGGGAGG - Intergenic
1151791157 17:76306969-76306991 CCAGAGAAGGGGAGTCAGGATGG - Intronic
1151792856 17:76320298-76320320 GAAAAGAAAGGAAGGGAGGAAGG + Intronic
1151914155 17:77105148-77105170 GAATAGAAGGGGAGGCAGGTTGG + Intronic
1151969355 17:77449988-77450010 CATCTGAATGGGAGGGAGGCTGG - Intronic
1152163694 17:78686713-78686735 CAAAGGCAGGGGAGGGAAGATGG + Intronic
1152187119 17:78864400-78864422 AAACAGGAAGGGAGGAAGGAAGG - Intronic
1152207780 17:78984248-78984270 GAATAGAATGGGAGGCAGGATGG + Intergenic
1152214926 17:79026613-79026635 CAAGAGGAGGAGAGGGAGGCGGG - Intronic
1152277936 17:79369025-79369047 CCACACAAGGAGAGCGAGGAGGG + Intronic
1152288359 17:79425100-79425122 CAAGAGGAGGTGAGAGAGGAGGG - Intronic
1152353142 17:79794470-79794492 AAACTGAGGGGGAGGAAGGAGGG + Exonic
1152471337 17:80491522-80491544 AGACAGAGGGGGAGGGAGGGAGG - Intergenic
1152589724 17:81205484-81205506 CAGCGGGAGGGGAGGTAGGAGGG + Intronic
1152594421 17:81231517-81231539 CAACCGTGGGCGAGGGAGGAGGG - Intronic
1152598467 17:81249548-81249570 AAAAAGAGGGGGAGGGGGGAAGG + Intronic
1152609191 17:81307375-81307397 GAAGAGAAAGGGAAGGAGGAGGG - Intergenic
1152670097 17:81598379-81598401 CAACAGAAGGTGAGTGAAAAAGG + Intronic
1152671844 17:81612937-81612959 CAGCTGCAGGGGAGGGAGGAGGG - Intronic
1152673089 17:81620705-81620727 CAACAGAAGAGAAGGAAGGAGGG + Intronic
1152809687 17:82375590-82375612 TTCCAGAAGGGGACGGAGGAGGG - Intergenic
1153175048 18:2362323-2362345 AAAGAAAAAGGGAGGGAGGAAGG - Intergenic
1153216205 18:2823346-2823368 AAAGAGAAGGGAAGGAAGGAAGG - Intergenic
1153216211 18:2823376-2823398 GAAGAGAAGGGAAGGAAGGAAGG - Intergenic
1153432621 18:5035204-5035226 TAAAAGAAGAGGAGGGAGGGAGG + Intergenic
1153441484 18:5124273-5124295 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1153804702 18:8702301-8702323 GAAGGGAAGGGAAGGGAGGAAGG - Intergenic
1153806054 18:8708882-8708904 CGACAGCAGGGGAGAGAAGAGGG + Intronic
1153901277 18:9619039-9619061 AGAAAGAAGGGGAGGGAGGGAGG + Intergenic
1154095769 18:11413720-11413742 GAAGAGAAGGGAAGGGAGGAAGG - Intergenic
1154309055 18:13253619-13253641 CAAATGAAGTGGGGGGAGGAAGG + Intronic
1154448214 18:14452131-14452153 AAAGAGAGAGGGAGGGAGGAAGG - Intergenic
1154494193 18:14944012-14944034 CAAGACAAGGAGAGGGAGGGAGG + Intergenic
1154515845 18:15164652-15164674 AAAAAGGAAGGGAGGGAGGAAGG - Intergenic
1155048946 18:22129962-22129984 CAAGGGAAGGGAAGGGAAGAGGG - Intergenic
1155334254 18:24748745-24748767 AAAAAGAAAGGGAGGGAGGAAGG - Intergenic
1155449296 18:25946746-25946768 GAAGAGGAAGGGAGGGAGGAAGG + Intergenic
1155962891 18:32009746-32009768 CGAGAGAAAGGGAGGGAGGGAGG - Intergenic
1156044908 18:32867259-32867281 CATCAGAAGGGTAGGCAAGAGGG - Intergenic
1156498317 18:37540585-37540607 CAGCAGTGGGGCAGGGAGGAGGG + Intronic
1157226150 18:45866500-45866522 CAGCAGAATAGCAGGGAGGAAGG - Intronic
1157434214 18:47654781-47654803 CATCAGAAGGGGACTGAGTAGGG - Intergenic
1157475539 18:48021218-48021240 AAAGAGAAGGGAGGGGAGGAAGG - Intergenic
1157529372 18:48408933-48408955 CAACGGAGGAGGCGGGAGGAGGG - Intronic
1157543162 18:48526747-48526769 CAGCAGAAGGAGAGGGAGAAGGG - Intergenic
1157710787 18:49848341-49848363 CCACAGAAGAGGTGGGATGAAGG + Intronic
1157713264 18:49864444-49864466 CAAAAGAAGGGGAGGAGGGGAGG - Intronic
1158279294 18:55803529-55803551 AAAAAGAAAGGGAGGGAGGGAGG - Intergenic
1158334915 18:56405660-56405682 CAAAAGAAGGGAAGGAAGGAAGG + Intergenic
1158645913 18:59246957-59246979 GAACAGAATGGGAGGCAGGTTGG - Intergenic
1159075286 18:63674376-63674398 TAACAGAAGGAGAGGAAGCAGGG - Intronic
1159134249 18:64318567-64318589 AGACAGGAAGGGAGGGAGGAAGG - Intergenic
1159218086 18:65423233-65423255 CAAAAGTAGGGAAGGAAGGAGGG - Intergenic
1159238786 18:65713225-65713247 AAAGAGAGGGGAAGGGAGGAAGG - Intergenic
1159347608 18:67227249-67227271 CAACAGAATGTGAGGGAAAAGGG - Intergenic
1159356129 18:67338485-67338507 AAACAAAAAGGAAGGGAGGAAGG - Intergenic
1159500337 18:69261095-69261117 AAAGAGAGGGGGAGGAAGGAAGG - Intergenic
1159576320 18:70182482-70182504 CAGCAAAAGGGAAGGGAGGAAGG + Intronic
1159626036 18:70696056-70696078 CTACAGATGGGGAGGGAGTAAGG - Intergenic
1159627398 18:70710626-70710648 CACCAGAAGGGGACAGAGGATGG - Intergenic
1159633964 18:70782875-70782897 AAAGAGAAGGGAAGGAAGGAAGG - Intergenic
1159653123 18:71000635-71000657 GAACAGAGAGGGAGGGAGGGAGG + Intergenic
1159895377 18:73991157-73991179 CAGCAGAAGGGAAGAGAGGGTGG - Intergenic
1159933083 18:74334305-74334327 AAGCAGAAGGGGAAAGAGGAAGG + Intronic
1159964136 18:74579384-74579406 AGAAAGAAGGGAAGGGAGGAAGG - Intronic
1160063515 18:75553040-75553062 AAACGGAAGAGAAGGGAGGATGG + Intergenic
1160135301 18:76266355-76266377 GAGAAGAAGGGGAGGGAGGAAGG + Intergenic
1160483243 18:79262119-79262141 CAAGGAAAGGGGAGGGAGGGAGG - Intronic
1160615203 18:80121151-80121173 GAAAGGAAGGGAAGGGAGGAAGG - Intronic
1160625670 18:80202941-80202963 CAAGAGACGGGGTGGGGGGAGGG + Intronic
1160965250 19:1744574-1744596 GAAAGGAGGGGGAGGGAGGAGGG - Intergenic
1161319291 19:3633576-3633598 CAAGAGAGGCAGAGGGAGGAAGG + Intronic
1161540023 19:4844903-4844925 AAAGAGAAAGGGAGGGAGGGAGG + Intronic
1161644676 19:5445723-5445745 GGACAGAGGAGGAGGGAGGAGGG + Intergenic
1161754109 19:6119263-6119285 GAAAGGAAGGGAAGGGAGGAAGG - Intronic
1161859807 19:6789599-6789621 CATCAGAAAGGAAGGAAGGAAGG - Intronic
1161860745 19:6796432-6796454 TAAGCGAGGGGGAGGGAGGAAGG - Intronic
1162032840 19:7924896-7924918 AGACAACAGGGGAGGGAGGAGGG + Exonic
1162182966 19:8883201-8883223 CACCTGAAGGAGAGGGAGGTAGG + Intronic
1162274501 19:9642030-9642052 CATCACAAGGGTGGGGAGGAAGG + Intronic
1162317947 19:9952324-9952346 AAAAAGGAGGGGAAGGAGGAAGG + Intergenic
1162448797 19:10741877-10741899 AAAGAGGAAGGGAGGGAGGAAGG - Intronic
1162833655 19:13302606-13302628 TAGCAGAAGGGGAGGGAGAAAGG - Intronic
1162984093 19:14258280-14258302 AAAGGGAAGGGGAGGGAGGCGGG - Intergenic
1163345115 19:16736228-16736250 CAAAAGAAAGAGAGAGAGGAAGG - Intronic
1163475602 19:17524226-17524248 CAGCAGGAGGGGATAGAGGATGG - Intronic
1163712022 19:18852634-18852656 AAAGAGGAGGGGAGGGAGGGAGG - Intronic
1163764654 19:19156061-19156083 GAGTAGAAGGGGAGGGAGGTGGG + Intronic
1163779710 19:19239922-19239944 CAGAGGAATGGGAGGGAGGAAGG - Intronic
1164314955 19:24079360-24079382 GACTAGAAGGGTAGGGAGGAGGG - Intronic
1164402634 19:27912129-27912151 CTAGAGATGGGGAGGCAGGAAGG + Intergenic
1164522211 19:28988316-28988338 GGAAGGAAGGGGAGGGAGGAAGG + Intergenic
1164772453 19:30820340-30820362 ACAGAGAAAGGGAGGGAGGAAGG - Intergenic
1164826463 19:31288160-31288182 TAGCCGAAGGGGATGGAGGAAGG + Intronic
1164975576 19:32570712-32570734 AAACAGGAAGGGAGGGAGGGAGG - Intergenic
1165476685 19:36034754-36034776 CCATAGTAGGGAAGGGAGGAAGG - Intergenic
1165494249 19:36142412-36142434 CACAAGAAGGGGAGGAAGGTGGG - Intronic
1165523586 19:36333132-36333154 CCACAGAAGGGAAGGGAGGGAGG + Intergenic
1165952804 19:39483531-39483553 AACCAGAAGGGGAGAGAGGAAGG - Intronic
1166766745 19:45255782-45255804 CAACAGGAGGGGAGGAAGAAAGG - Intronic
1166881240 19:45931388-45931410 CAACAGAGGGGGATGGAAGAAGG - Intergenic
1166966024 19:46529649-46529671 AATAAGAAGGGGAGGGAGGGTGG + Intronic
1167258459 19:48444210-48444232 CACCAGATGGGGCGGGAGGTGGG + Exonic
1167381376 19:49140132-49140154 AGAAAGAAAGGGAGGGAGGAAGG - Intronic
1167417990 19:49386969-49386991 GAGCAGAAGGGAAGGGAGGCGGG + Intergenic
1167740276 19:51320439-51320461 CACCAGGCGGAGAGGGAGGAAGG - Intronic
1168054679 19:53856013-53856035 GAACAGAAGGGGAGGAACGCTGG - Intergenic
1168220357 19:54956118-54956140 CAACAGAGGGAGAGAAAGGAAGG + Intronic
1168249712 19:55134775-55134797 AAGAAGAAGGGGAGGGAGGGAGG + Intronic
1168326395 19:55540869-55540891 CAGCAAAAGTGGTGGGAGGACGG - Exonic
1168357622 19:55712330-55712352 CAATAGAATGGAAGGGAGGCAGG - Intronic
1168468234 19:56621104-56621126 GATCAGAGAGGGAGGGAGGAGGG - Intronic
1168654420 19:58117364-58117386 CAACCGCAGGGAAGGGAGGAAGG + Intronic
1168710114 19:58494725-58494747 CAACAGAAACAAAGGGAGGAGGG - Intronic
1202670541 1_KI270709v1_random:46058-46080 CAAAATAAAGGGATGGAGGAAGG + Intergenic
925079384 2:1051201-1051223 AAACAGGAAGGAAGGGAGGAAGG - Intronic
925212335 2:2060685-2060707 GAAGAGAAGGGCAGAGAGGAGGG - Intronic
925322866 2:2990341-2990363 AAACAGAAAGGAAGGGAGGGAGG + Intergenic
925466473 2:4110924-4110946 AAGAAGAAAGGGAGGGAGGAAGG - Intergenic
925661409 2:6207227-6207249 CCACAGGAGGAGAGGGAGCATGG - Intergenic
925790994 2:7488468-7488490 AAAGAGAAAGGAAGGGAGGAAGG + Intergenic
925791004 2:7488503-7488525 AAAGAGAAAGGAAGGGAGGAAGG + Intergenic
925791025 2:7488573-7488595 AAAGAGAAAGGAAGGGAGGAAGG + Intergenic
925791059 2:7488689-7488711 AAAGAGAAAGGAAGGGAGGAAGG + Intergenic
925791069 2:7488724-7488746 AAAGAGAAAGGAAGGGAGGAAGG + Intergenic
925791103 2:7488840-7488862 AAAGAGAAAGGAAGGGAGGAAGG + Intergenic
925791124 2:7488910-7488932 AAAGAGAAAGGAAGGGAGGAAGG + Intergenic
925791134 2:7488945-7488967 AAAGAGAAAGGAAGGGAGGAAGG + Intergenic
925791144 2:7488980-7489002 AAAGAGAAAGGAAGGGAGGAAGG + Intergenic
925791175 2:7489088-7489110 AAAGAGAAAGGAAGGGAGGAAGG + Intergenic
925791210 2:7489204-7489226 AAAGAGAAAGGAAGGGAGGAAGG + Intergenic
925806175 2:7650936-7650958 CAAAAGGAAGGAAGGGAGGAAGG - Intergenic
925910106 2:8568237-8568259 CAGCAAAAAGGGAGGGAGGGAGG + Intergenic
926162869 2:10500956-10500978 CAACAGAAGAGCTGGGAGGAAGG - Intergenic
926244574 2:11113502-11113524 AGGAAGAAGGGGAGGGAGGAAGG - Intergenic
926291947 2:11538709-11538731 AGAGAGAGGGGGAGGGAGGAAGG - Intronic
926895687 2:17684976-17684998 CCACAGACGGGAAGGTAGGAGGG + Intronic
927000627 2:18791027-18791049 AAAGGGAAGGGGAGGAAGGAAGG - Intergenic
927174530 2:20396259-20396281 CAACAGGAAGGCAGGCAGGAGGG + Intergenic
927258365 2:21060735-21060757 CAACAGAAGAGGAGCTAGCAAGG - Intergenic
927786573 2:25979153-25979175 CAACACTAGGGGTGGAAGGAAGG - Intronic
927809531 2:26173609-26173631 CAACCGACGGGGCGGGAGCAGGG - Intronic
928164803 2:28962836-28962858 GAAAAGGAAGGGAGGGAGGATGG - Intronic
928285671 2:29988080-29988102 CAGCAGTAGGGGAGTGAGGAAGG - Intergenic
928368817 2:30723801-30723823 CAAGAGAGGTGGAGGGAGGCAGG - Intronic
928435540 2:31252276-31252298 CAACTGACAGGGAGGGAGGGAGG - Intronic
928507123 2:31965274-31965296 GAAGAGAAGGGAAGGGAAGAAGG + Intronic
928858107 2:35824357-35824379 CAATAGAAGGGCAGGCAGGTTGG + Intergenic
928934344 2:36659351-36659373 GGACAGAAAGGGAGGGAGGGAGG + Intergenic
929521529 2:42656758-42656780 TAAGAAAAGGGGAGGAAGGAAGG - Intronic
929565059 2:42978860-42978882 CCTCAGAAGGACAGGGAGGAGGG + Intergenic
929813647 2:45213346-45213368 AAACAGACAGGGAGAGAGGAGGG + Intergenic
930140571 2:47947710-47947732 CACCAGAAGGGGAGACAAGAGGG - Intergenic
930352668 2:50277456-50277478 AAAAAGAAGGGAAGGAAGGAAGG - Intronic
930511847 2:52355863-52355885 CAACAGAATGGAAGGTGGGATGG + Intergenic
930589336 2:53308746-53308768 CAAGAAAAGGGGATGGAGGTGGG - Intergenic
930767353 2:55097555-55097577 CAGCAGTGGGGGAAGGAGGAGGG + Intronic
931133413 2:59366300-59366322 GAAGAGAGAGGGAGGGAGGAAGG + Intergenic
931231096 2:60375455-60375477 CCACAGAATGAGAGGGAGGTGGG + Intergenic
931380711 2:61750692-61750714 CAATAGCAGGGGAGGGAGCAAGG + Intergenic
931391673 2:61849962-61849984 CACCAGGTGGGGAGGGAGGGAGG + Intronic
931434373 2:62234507-62234529 GAACAGCAGAGGAGGGAGGCTGG - Intergenic
931441461 2:62293475-62293497 CATGAGAAGGGCATGGAGGAGGG + Intergenic
932154407 2:69403016-69403038 AAAGAGAGAGGGAGGGAGGAAGG - Intronic
932288491 2:70555346-70555368 CTACAGAAGGGGAGGAATCAGGG + Intergenic
932406128 2:71513565-71513587 TCACTGATGGGGAGGGAGGAGGG + Intronic
932429572 2:71666044-71666066 AAACAGAATGAGAAGGAGGAGGG - Intronic
932796855 2:74703497-74703519 TAACGGGAGGGGAGGAAGGATGG - Intergenic
932837637 2:75051928-75051950 CAGCAGAAGGGGTGGGACAAGGG + Intronic
933244245 2:79957388-79957410 CACCAGCAGGAGATGGAGGAGGG + Intronic
933256021 2:80081503-80081525 AGACAGAAAGGGAGGGAGGGAGG - Intronic
933284169 2:80366671-80366693 CAACAGCAGCGGAGGAAGAAGGG - Intronic
934165438 2:89290046-89290068 CATAAGAAAGGGAGGGAAGAAGG - Intergenic
934201835 2:89892416-89892438 CATAAGAAAGGGAGGGAAGAAGG + Intergenic
934867545 2:97826477-97826499 CATCAAAAGGGGAAGGAGAAGGG + Intronic
934948683 2:98561094-98561116 CATCAGTAGGGGAGGGAGAAAGG - Intronic
934960183 2:98666221-98666243 CAAGAGAAGGGGAGGAATCAAGG + Intronic
934998875 2:98991338-98991360 CAAAATAAAGGGATGGAGGAAGG + Intergenic
934999870 2:99002769-99002791 CAAAATAAAGGGATGGAGGAAGG + Intronic
935063267 2:99626468-99626490 GAAGAGAAGGAGAGGGAGGGAGG - Intronic
935098533 2:99970304-99970326 AAGCAGAAGGGGAGAAAGGATGG - Intronic
935126982 2:100233069-100233091 AAATAGAAAGGGTGGGAGGAAGG + Intergenic
935443532 2:103131967-103131989 AAAAAGAAAGGAAGGGAGGAAGG + Intergenic
935480558 2:103582984-103583006 AAGGAGAAAGGGAGGGAGGAAGG - Intergenic
935622716 2:105143818-105143840 GAAGAGGAGGGGAAGGAGGAAGG - Intergenic
935815105 2:106839983-106840005 CAACAGAAGGGTAGGGGGATGGG + Intronic
935865663 2:107385151-107385173 CAACAGAAGGGAATGGAAGTGGG - Intergenic
936096365 2:109533137-109533159 AAACAGAAAGGGAGGAAGGGAGG + Intergenic
936416718 2:112322147-112322169 CAAGAGGGAGGGAGGGAGGAAGG - Intronic
936775124 2:115963873-115963895 CAAAATAAAGGGATGGAGGAAGG - Intergenic
936912754 2:117609844-117609866 AAAGAAAAAGGGAGGGAGGAAGG + Intergenic
936999074 2:118446706-118446728 CAAAAGGAAGGGAGGGAGGGAGG - Intergenic
937032054 2:118748962-118748984 CAACAGAAGTGGAATAAGGAGGG + Intergenic
937430683 2:121835719-121835741 AAACAGAAGGGGAGGAGGGGAGG - Intergenic
937683565 2:124670172-124670194 AAAGAGAAAGAGAGGGAGGAAGG - Intronic
938120347 2:128628601-128628623 CCGAAGAAAGGGAGGGAGGAAGG - Intergenic
938163980 2:129010076-129010098 CAACAGGAGGGTTGGGAGGATGG + Intergenic
938273761 2:129998057-129998079 CAACAGGAGGTGAGGAAGGCAGG + Intergenic
938442448 2:131348058-131348080 CAACAGAAGGTGAGGAAGGCAGG - Intronic
938569228 2:132546886-132546908 CAAATGAAGGGGAGGGAAGGAGG + Intronic
938823072 2:134978052-134978074 CTGGAGAAGGGAAGGGAGGAAGG - Intronic
939160677 2:138584795-138584817 AAAGAGAAGGGAAGGAAGGAAGG + Intergenic
939258877 2:139781270-139781292 CAAAAGGAAGGGAGGAAGGAAGG - Intergenic
939607028 2:144265727-144265749 TTAGAGAAGGGGTGGGAGGAGGG - Intronic
940019982 2:149146457-149146479 CAACAGAGGATGAGGGAGAATGG + Intronic
940137219 2:150451603-150451625 AAATAGAAGGAGAAGGAGGAGGG - Intergenic
940325811 2:152423892-152423914 CAAAAGAAGAGGAAGGAGGTGGG - Intronic
940332468 2:152490178-152490200 CAAAAAAAGGGGAAAGAGGAGGG + Intronic
940610856 2:155989817-155989839 CTACAGAGGGGGAGAAAGGATGG - Intergenic
940864807 2:158807468-158807490 GAACACAGGGGCAGGGAGGAAGG - Intronic
941423717 2:165317349-165317371 AAAAAGAAAGGGAGGGAGGGAGG + Intronic
941489699 2:166127613-166127635 GAAGAGGAGGAGAGGGAGGAGGG + Intronic
941754613 2:169171639-169171661 CCAGAGAAGTAGAGGGAGGAAGG - Intronic
942041531 2:172068877-172068899 AAAAAGAAAGGAAGGGAGGAAGG - Intronic
942411962 2:175718849-175718871 CAAAATAAAGGGATGGAGGAAGG + Intergenic
942414208 2:175741274-175741296 GAAGGGAAGGGAAGGGAGGAGGG + Intergenic
942807298 2:179946475-179946497 GAAGGGGAGGGGAGGGAGGAAGG + Intronic
943598103 2:189881284-189881306 GAACAGAATGGGAGGCAGGTTGG - Intronic
943685474 2:190813226-190813248 CAACAGCAGGAGAGTGAGGATGG + Intergenic
944320293 2:198332547-198332569 CATAAGAAGGGGAGGTGGGATGG + Intronic
944534370 2:200695100-200695122 CAGGAGCAAGGGAGGGAGGAGGG - Intergenic
944737110 2:202577211-202577233 AAAGAGAAAGGGAGGAAGGAAGG + Intergenic
945028952 2:205645797-205645819 GAAAAGAAGGGGAGGAAGGGAGG + Intergenic
945111678 2:206366221-206366243 AAAAAGAAAGGGAGGAAGGAAGG - Intergenic
945155912 2:206837368-206837390 AAAAAGGAGGGGAGGAAGGAAGG - Intergenic
945603457 2:211896002-211896024 CAACAGTAGGGAAGAGAGGTGGG - Intronic
946035267 2:216736878-216736900 AGAGAGAAAGGGAGGGAGGAAGG - Intergenic
946312039 2:218887443-218887465 GAACCTAAGGGGAAGGAGGATGG - Intronic
946368709 2:219267018-219267040 CAGCAGATGGGCAGGGTGGAGGG - Intronic
946426644 2:219601959-219601981 CAAGGAAAGAGGAGGGAGGAAGG - Intronic
946553085 2:220823842-220823864 AAGAGGAAGGGGAGGGAGGAAGG - Intergenic
946712596 2:222521814-222521836 CAACTGGAGGGGAGGAGGGACGG - Exonic
947052803 2:226065556-226065578 GAACAGAATGGAAGGCAGGAGGG - Intergenic
947077819 2:226364165-226364187 AGAGAGGAGGGGAGGGAGGAGGG + Intergenic
947148016 2:227086376-227086398 GAAAAGAAGGGAAAGGAGGAAGG - Intronic
947275999 2:228393015-228393037 TACTAGAAGGGGAGAGAGGAAGG - Intergenic
947318818 2:228894841-228894863 CAACAGGAGGGGAAAGATGAAGG - Intronic
947537309 2:230948299-230948321 CAGGAGATGGGGAGGGAGGAAGG - Intronic
947702484 2:232246130-232246152 CAGCAGAAGAGCAGGGAGGATGG + Intronic
947799165 2:232916991-232917013 CACCAGATGGGGAGAGAGGCGGG - Intronic
947909164 2:233790407-233790429 GAAGAAAAGGGGAGGAAGGAAGG - Intronic
947909212 2:233790572-233790594 AAAGGGGAGGGGAGGGAGGAAGG - Intronic
948029044 2:234801345-234801367 TAACAGCAGAGCAGGGAGGATGG + Intergenic
948035566 2:234855715-234855737 GAACAGAGGGGGTGGGAGGAAGG + Intergenic
948175823 2:235942011-235942033 CAAGAGGAGTGCAGGGAGGATGG - Intronic
948335665 2:237205073-237205095 CACCAAAAGTGGAGGGAGGGAGG + Intergenic
948385925 2:237580748-237580770 AAAAAGAAGGGGGGGGAGGAGGG + Intronic
948412001 2:237770914-237770936 CAACAGAATGGTAGGAAGTAAGG - Intronic
948593285 2:239064491-239064513 CAACAGAAGGGGAGGGAGGAAGG + Intronic
948691862 2:239711329-239711351 AAACTGAAGGGGGAGGAGGAGGG - Intergenic
948862982 2:240761869-240761891 CCACAGGAGAGGAGGCAGGAGGG + Intronic
948966091 2:241381479-241381501 GAACAGAAGGGGAGAAATGAGGG - Intronic
1168868705 20:1110570-1110592 AAAGAGAAGGGGAGGGAGCAAGG - Intergenic
1168912683 20:1462355-1462377 CAAGAAAAAGGGAGGGAGGAGGG - Intronic
1168948728 20:1782138-1782160 CAGCAGAAGGGTGGGCAGGAGGG + Intergenic
1169009428 20:2237978-2238000 CAAGAGGAAGGGAGGGAGGGAGG - Intergenic
1169354508 20:4896074-4896096 CAACAGGAAGGGATGGAGGGTGG + Intronic
1169447245 20:5682702-5682724 CAAAAAAAGGGAAGGAAGGAAGG - Intergenic
1169709767 20:8548376-8548398 GAAGGGAAGGGAAGGGAGGAAGG - Intronic
1169787182 20:9371487-9371509 CAAAAGGAAGGAAGGGAGGAAGG - Intronic
1169905341 20:10597413-10597435 GAAGAGAAAGGGAGAGAGGAAGG + Intronic
1170355776 20:15490228-15490250 GAAGGGAAGGGAAGGGAGGAAGG - Intronic
1170357363 20:15507307-15507329 AAGCAGGAAGGGAGGGAGGAAGG - Intronic
1170531749 20:17300158-17300180 CAGCAGAAGGGGTGGGAGTCAGG - Intronic
1170552025 20:17486416-17486438 CAAGAGAAAGGGTGGGAGGATGG + Intergenic
1170894367 20:20400369-20400391 GGACAGGAAGGGAGGGAGGAAGG + Intronic
1170900573 20:20458625-20458647 AAAGAGAAGGAGAGGGAGCAAGG + Intronic
1171370874 20:24661325-24661347 GAAGAGAGGGGGAGGAAGGAGGG + Intronic
1171720943 20:28562805-28562827 GAACAGAAGGTGTGGGAGGCAGG + Intergenic
1172184332 20:33021867-33021889 CCACAGAGGGGGAGGGAGAGAGG - Intronic
1172870480 20:38132501-38132523 CTGCAGAAGGGGAGAAAGGAGGG + Intronic
1172987018 20:38999831-38999853 CAAGACAAGGGCAGTGAGGATGG - Intronic
1173002014 20:39111560-39111582 GAAGAGGAGGAGAGGGAGGAGGG + Intergenic
1173550182 20:43927631-43927653 GAAGGGAAGGGGAGGAAGGAAGG - Intronic
1173563573 20:44023150-44023172 GGACAGAAGGGAAGGAAGGAAGG + Intronic
1173564922 20:44031789-44031811 CAGCAGAAGTGGAGGGTGAAGGG + Intronic
1173690447 20:44956887-44956909 GAAAAGAAAGGGAGGGAGGGAGG + Intronic
1173835472 20:46122583-46122605 GAAGAGAAGGGCAGGAAGGATGG - Intronic
1173870748 20:46340538-46340560 GAACAGAAGTGGATGAAGGATGG - Intergenic
1173920171 20:46738475-46738497 CAAGAGATGGGGAGGAAGGGAGG + Intergenic
1173946419 20:46954356-46954378 AAACAGACAGGGAGGAAGGAAGG + Intronic
1173969967 20:47145199-47145221 CAAGTGATGGGGATGGAGGAGGG + Intronic
1174185717 20:48704552-48704574 AAAAAGAGAGGGAGGGAGGAAGG - Intronic
1174216691 20:48921588-48921610 AGACAGAAGGCGAGGGTGGAGGG - Intergenic
1174516853 20:51099138-51099160 CTGCAGAAGGGGAGGGAGGAGGG + Intergenic
1174736954 20:52973469-52973491 CCAGAGAAGGCGAGAGAGGACGG - Intronic
1174777774 20:53361575-53361597 CAAAAGAAAGGGTGGAAGGAAGG - Intronic
1174797388 20:53533642-53533664 AAAGAGAGAGGGAGGGAGGAAGG - Intergenic
1175065435 20:56282425-56282447 CCCCAGAAGGAGAGGGAGGCTGG - Intergenic
1175096934 20:56548676-56548698 GTAAAGAAGGGGAAGGAGGATGG - Intergenic
1175142777 20:56873198-56873220 GAAGGGAAGGGAAGGGAGGAAGG + Intergenic
1175245849 20:57581511-57581533 CAACAGAAGGGGCTGGAGAATGG - Intergenic
1175272459 20:57744110-57744132 GACCAGAAGGGGAGAGGGGAGGG + Intergenic
1175319343 20:58074399-58074421 AAGCAGAAAGAGAGGGAGGAGGG + Intergenic
1175607038 20:60319502-60319524 CAACAGAACCGCAAGGAGGAAGG - Intergenic
1175633046 20:60558097-60558119 AAACAGGAAGGGAGGGAGGGAGG - Intergenic
1175649048 20:60701132-60701154 CAATAAAAAGGGAGGGTGGATGG - Intergenic
1175831560 20:61967597-61967619 TAAAAAAAGGGGAGGAAGGAAGG - Intronic
1175849756 20:62083512-62083534 AAAAAGAAGGGGAGAGAGGGAGG - Intergenic
1176173086 20:63705015-63705037 CACCAGGAAGGCAGGGAGGACGG - Intronic
1176270521 20:64233457-64233479 GAAGAGAAGGGGAGGAAGGTGGG - Intronic
1176349769 21:5783425-5783447 GAAAAGAAAGGGAGGGAGGAAGG - Intergenic
1176356583 21:5904009-5904031 GAAAAGAAAGGGAGGGAGGAAGG - Intergenic
1176544090 21:8181495-8181517 GAAAAGAAAGGGAGGGAGGAAGG - Intergenic
1176550793 21:8220222-8220244 CCAAGGAAGGGGAGGGAGGGAGG - Intergenic
1176563041 21:8364540-8364562 GAAAAGAAAGGGAGGGAGGAAGG - Intergenic
1176569591 21:8402489-8402511 CCAAGGAAGGGGAGGGAGGGAGG - Intergenic
1176777829 21:13155280-13155302 GAAAAGGAAGGGAGGGAGGAAGG + Intergenic
1176873535 21:14103413-14103435 GAATAGAATGGGAGGCAGGATGG + Intergenic
1177144983 21:17397769-17397791 AAAGAGGAAGGGAGGGAGGAAGG + Intergenic
1177145010 21:17397947-17397969 AAAGAGAAAGGGAGGGAGGGAGG + Intergenic
1177234623 21:18372158-18372180 AAACAGAAGGGGAGAGAGTAGGG + Intronic
1177386577 21:20417205-20417227 AAACAGAAAGGGAAGGAGGTAGG - Intergenic
1177447582 21:21217783-21217805 ATGCAGAAGGGGAGGGTGGAGGG + Intronic
1177670175 21:24214575-24214597 CAAAAGAAAGGGAGGGAGGAAGG + Intergenic
1177670197 21:24214668-24214690 AAAGAGAAAGGGAGGGAGGGAGG + Intergenic
1177682169 21:24385942-24385964 CAACTGAAGGGGAAAGAGAAAGG + Intergenic
1177783155 21:25640783-25640805 AAAGAGAAAGGAAGGGAGGAAGG - Intronic
1178016121 21:28347585-28347607 GAAGAAAAAGGGAGGGAGGAAGG - Intergenic
1178063503 21:28877251-28877273 GAAGAGAAGGGAAGGAAGGAAGG + Intronic
1178270608 21:31186215-31186237 CTAAAGAAGGGGAGGGAGGCTGG + Intronic
1178291661 21:31373638-31373660 AAACAGAAAGAGAGGCAGGAGGG + Intronic
1178321950 21:31612676-31612698 CAAAAGAAGGGGAACGAGGCAGG - Intergenic
1178531817 21:33382268-33382290 AAGAAGAAAGGGAGGGAGGAAGG + Intergenic
1178617926 21:34150033-34150055 CATGAGAAGAGGAGGCAGGATGG - Intergenic
1178663179 21:34523483-34523505 CAAAAGGGAGGGAGGGAGGAGGG + Intronic
1178808589 21:35860173-35860195 GAAAAGAGAGGGAGGGAGGAAGG + Intronic
1178899242 21:36585913-36585935 AAAGAGAGAGGGAGGGAGGAAGG - Intergenic
1178974271 21:37208427-37208449 CCCCAGTGGGGGAGGGAGGAGGG - Intergenic
1179030093 21:37712674-37712696 GAGGAGAAGGGGAGGAAGGAGGG - Intronic
1179030106 21:37712719-37712741 GAGGAGAAGGGGAGGAAGGAGGG - Intronic
1179058218 21:37955327-37955349 TATCACAGGGGGAGGGAGGATGG + Intronic
1179396489 21:41044967-41044989 AGCCAGAGGGGGAGGGAGGAAGG + Intergenic
1179903479 21:44406947-44406969 CCCCACCAGGGGAGGGAGGAGGG + Intronic
1179947632 21:44688820-44688842 CAGCGGAAGGGGAGTGGGGAGGG + Intronic
1180146990 21:45927291-45927313 GAAGGGGAGGGGAGGGAGGAGGG - Intronic
1180611364 22:17100335-17100357 CCACTGAAGAGAAGGGAGGAAGG - Exonic
1181033180 22:20157884-20157906 CCACAGCAGGGGAGGGCGGGAGG + Intergenic
1181036289 22:20171378-20171400 CAACAGAAGTGAGAGGAGGAGGG + Intergenic
1181510129 22:23385348-23385370 CCACAGCAGGGGAGGGTGGGAGG - Intergenic
1181528391 22:23502607-23502629 CAAATGGAGGGGTGGGAGGATGG - Intergenic
1181742070 22:24929143-24929165 CAAAAGAAGGGGAGAGAGAAGGG - Intergenic
1181885306 22:26017367-26017389 AAGGAGGAGGGGAGGGAGGAAGG - Intronic
1182198342 22:28542350-28542372 CCACAGAAGGTGAGGAAGGAGGG + Intronic
1182232513 22:28849489-28849511 CGACGGGAGGGGAGGGGGGAGGG - Intergenic
1182344354 22:29650566-29650588 AAAAGGAAGGGGAGGGAGGAAGG - Intronic
1182497376 22:30719188-30719210 AAAGAGAAGGGGAGTGAGGAGGG - Intronic
1182546444 22:31079444-31079466 CTACAGTAGGGCAGGGAGAAAGG + Intronic
1182741718 22:32572499-32572521 AAAGAGAAAGGGAGGGAGGAAGG - Intronic
1183115633 22:35690547-35690569 GAGGAGAAGGGGAGGGAAGAGGG + Intergenic
1183615707 22:38944075-38944097 GAGGAGAAGGAGAGGGAGGAAGG - Intergenic
1183618324 22:38958397-38958419 GCACAGAAGGGAAGGAAGGAGGG - Intronic
1183650725 22:39152084-39152106 CAATAAAAGGGGAGCGAGGTGGG + Intronic
1183785162 22:40025000-40025022 CAGCAGGAGGCGAGGGCGGAGGG - Intronic
1184027829 22:41871058-41871080 GAATAAAGGGGGAGGGAGGAGGG - Intronic
1184279198 22:43427395-43427417 CAGCAGAAGGGGCGGCAGGTCGG + Intronic
1184345434 22:43909980-43910002 AAAGAGAGAGGGAGGGAGGAAGG + Intergenic
1184469870 22:44690345-44690367 CAAGGCAGGGGGAGGGAGGAGGG + Intronic
1184747671 22:46465469-46465491 CCCCAGAATGAGAGGGAGGAGGG - Intronic
1184916887 22:47575427-47575449 CAAGGGAAGGACAGGGAGGAGGG - Intergenic
1185093453 22:48790772-48790794 GATTGGAAGGGGAGGGAGGAGGG - Intronic
1185148000 22:49149741-49149763 GAGAAGCAGGGGAGGGAGGAAGG + Intergenic
1203248958 22_KI270733v1_random:97730-97752 GAAAAGAAAGGGAGGGAGGAAGG - Intergenic
949401060 3:3665821-3665843 GAAGGGAAGGGAAGGGAGGAAGG + Intergenic
949508053 3:4745011-4745033 GAAAAGAAAGGGAAGGAGGAAGG - Intronic
949768202 3:7550299-7550321 AGACAGGAAGGGAGGGAGGAGGG - Intronic
949927757 3:9055548-9055570 CAGCTGCAGGGGAGGGAGGCTGG + Intronic
950008867 3:9708292-9708314 CCAAAGGAGGGGAGGAAGGACGG + Intronic
950151980 3:10694838-10694860 CAGCAGAGAGGGAGGGGGGAAGG - Intronic
950202579 3:11055515-11055537 GAACAGAAGGGAGGGAAGGAAGG + Intergenic
950462157 3:13131014-13131036 GAACGGAAGGGAAGGAAGGAAGG + Intergenic
950582045 3:13868763-13868785 GAAGGGAAGGGAAGGGAGGAAGG + Intronic
950795950 3:15510809-15510831 CAAGAGAGAGGAAGGGAGGAAGG + Intronic
950989860 3:17421968-17421990 AAGTAGAAGAGGAGGGAGGAAGG - Intronic
951086502 3:18518228-18518250 CAAAATAAAGGGATGGAGGAAGG + Intergenic
951244425 3:20323889-20323911 GAACAGAAGGGATGGGAGAAGGG + Intergenic
951479854 3:23148591-23148613 GAAAAGGAAGGGAGGGAGGAAGG + Intergenic
951508423 3:23475199-23475221 CAAAAGGAGGGGAGTTAGGAGGG - Intronic
951597205 3:24331287-24331309 AAAAAGAAGGGGAGAGAGCAGGG + Intronic
951649943 3:24940446-24940468 CAAGAGAAGGGGGGATAGGAAGG + Intergenic
951856308 3:27200926-27200948 AAACAGAAGGGGAAGTGGGAGGG + Intronic
952145341 3:30526009-30526031 CAACAGGAAGGAAGGAAGGAAGG - Intergenic
952230526 3:31424905-31424927 AAAGAGAAAGGGAGGGAGGAAGG + Intergenic
952274933 3:31867740-31867762 AAAGAGAAAGGAAGGGAGGAAGG + Intronic
952433276 3:33246923-33246945 GAAAAGAGAGGGAGGGAGGAAGG - Intergenic
952449124 3:33414271-33414293 AAAAAGAAAGAGAGGGAGGAGGG + Intronic
952946865 3:38483834-38483856 TAAAAGGAGGGGAGGGAGGGAGG - Exonic
953666061 3:44927497-44927519 CACCAGAGGAGGAAGGAGGAGGG + Intronic
953700958 3:45195407-45195429 AAAGAGAAGGAAAGGGAGGAAGG - Intergenic
953748018 3:45590112-45590134 CAAGATACGGGGAGGCAGGAGGG + Intronic
953827646 3:46267936-46267958 CATCCCAAGGGGAGAGAGGAGGG + Intergenic
953855565 3:46497168-46497190 CAAGAGGAGGAGAGGAAGGAAGG - Intergenic
954579198 3:51694042-51694064 GAAGGGAAGGGAAGGGAGGAAGG - Intronic
954748122 3:52798512-52798534 CAAGAGGAGGGGAGGGAGAAAGG - Intronic
954894341 3:53963311-53963333 CAGCAGAAGAGGCTGGAGGAAGG + Intergenic
955111181 3:55951605-55951627 CAACACATGAGGAGGTAGGAGGG + Intronic
955201856 3:56858789-56858811 CAAGAGATGGAGAGGGTGGAGGG + Intronic
955668689 3:61378369-61378391 CAACAGCATGGAAGGCAGGAAGG - Intergenic
956160416 3:66345595-66345617 GAAGAGAAGGGGAGAGAGAAAGG - Intronic
956695237 3:71913130-71913152 CAGGAGAGAGGGAGGGAGGAAGG + Intergenic
956715972 3:72080409-72080431 GAAGAGATGGGGAGGGAGGAAGG - Intergenic
956796014 3:72719389-72719411 GAAGGGGAGGGGAGGGAGGAAGG + Intergenic
957047374 3:75386347-75386369 CAAAAGAAAGGAAGGAAGGAAGG + Intergenic
957083948 3:75663298-75663320 CAGCAGAGGGGGAGAGAAGAAGG + Intergenic
957157415 3:76562911-76562933 AGAAAGAAAGGGAGGGAGGAAGG - Intronic
957297441 3:78351178-78351200 CAAAAGAAAGGAAGGAAGGAAGG - Intergenic
957520356 3:81311273-81311295 GAAGGGAAGGGAAGGGAGGAAGG + Intergenic
957520405 3:81311602-81311624 AAAGAAAAAGGGAGGGAGGAAGG + Intergenic
958253155 3:91293403-91293425 CAAAATAAAGGGATGGAGGAAGG + Intergenic
958677707 3:97288232-97288254 CTACAGAGGGTGAGGAAGGAAGG - Intronic
958781467 3:98548481-98548503 CAAAGAAAGGGGAGGGAGGGAGG + Intronic
959563111 3:107805159-107805181 AGACAGAATGGGAAGGAGGAAGG + Intronic
959631307 3:108510236-108510258 CCACAGAAGAGGAGGGTGGCTGG - Intronic
960034805 3:113091729-113091751 AAAGAGAGAGGGAGGGAGGAAGG + Intergenic
960050757 3:113237302-113237324 CATGAGAAGGGCAGGGGGGATGG - Intronic
960195882 3:114767587-114767609 AAACAGAAAGGGAGGAGGGAGGG + Intronic
960558170 3:119052428-119052450 AAACAGGAAGGGAGGGAGGGAGG + Intronic
960566020 3:119132335-119132357 CAAAATAAAGGGATGGAGGAAGG + Intronic
960702381 3:120451062-120451084 CAGCAGAAGGGGGAGGAGAATGG - Exonic
960790528 3:121425703-121425725 AAACAGAAAGGAAGGGAAGAAGG - Intergenic
961044967 3:123701824-123701846 CAATAAAAGGGGAAGGAGAAAGG + Intronic
961072614 3:123948893-123948915 CACCAGAATGAGAGGGAGCATGG + Exonic
961090959 3:124112423-124112445 CCACAGAAGGCGAGGTATGAAGG + Intronic
961141859 3:124562793-124562815 GAACAGGAGGGCATGGAGGAAGG - Intronic
961180508 3:124872744-124872766 AAAGAGAGAGGGAGGGAGGAAGG - Intronic
961476249 3:127147945-127147967 AAATAAAGGGGGAGGGAGGAGGG + Intergenic
961879447 3:130050461-130050483 CAAGAGAAAGGAAGGAAGGAAGG + Intergenic
962076583 3:132088644-132088666 GAACAGAATGGAAGGAAGGAAGG + Intronic
962256414 3:133872918-133872940 CAAAAGAAGGTGAGGGAGGGAGG + Intronic
962410792 3:135140251-135140273 AAAGAGGATGGGAGGGAGGAGGG + Intronic
962475703 3:135753233-135753255 CAAGAGCAGGAGAGGCAGGACGG + Intergenic
962551629 3:136498498-136498520 CAACAGGAAGGGAGGTAGAAAGG + Intronic
962629756 3:137263997-137264019 CCACAGCAGGGGTGGGAGGGAGG + Intergenic
962752516 3:138444266-138444288 CCTCAGATGGGGAGGGTGGAGGG + Intronic
963183570 3:142387873-142387895 CAAGAGAGGGGTAGGGAGGGAGG - Intronic
963414304 3:144975129-144975151 GAAAAGAAGGGGAAGGAGAAGGG - Intergenic
963423753 3:145096430-145096452 GAAAAGAATGGGAGGGAGGGAGG - Intergenic
963429451 3:145179774-145179796 AAAAAGAAAGGGAGGGAGGGAGG + Intergenic
963627410 3:147690674-147690696 GAAGGGAAGGGAAGGGAGGAGGG - Intergenic
963924659 3:150938717-150938739 GAAGAGAAGGGGAGAAAGGAAGG - Intronic
964101786 3:152996134-152996156 CAAAAGAAAGGAAGGAAGGAAGG + Intergenic
964349193 3:155786124-155786146 AAAGGGAAGGGGAGGGAGAAGGG + Intronic
964508181 3:157422018-157422040 CAGGAGAAGGTGAGGGAGAAAGG - Intronic
964556583 3:157946135-157946157 CAGAAGAGGGGGAGGGAGGGAGG + Intergenic
964873042 3:161334407-161334429 CTAAAGAAGGGAAGGAAGGAGGG - Intergenic
964972412 3:162578093-162578115 CATCAAAAGGGGAGGGAGAGGGG + Intergenic
965465579 3:169026561-169026583 CAAAAAAAAGGGAGGGGGGAGGG - Intergenic
965514715 3:169608544-169608566 AAACACAAATGGAGGGAGGATGG - Intronic
965551147 3:169966634-169966656 CAGCAGGAGCGGAGGGAAGAGGG + Intronic
965802904 3:172512727-172512749 CAACAGAAAGGAAGGAAAGAAGG + Intronic
965887000 3:173458184-173458206 AAACAGAGGGTGAGAGAGGAGGG + Intronic
966269275 3:178085064-178085086 CAAGAGAGGAGGAGGGGGGAGGG + Intergenic
966754513 3:183355934-183355956 CAAGGGGAGGGGAGGGGGGAAGG - Intronic
966885550 3:184376185-184376207 TGACAGAAGGGGAGAGAGAAAGG - Intronic
967136168 3:186514721-186514743 CCACAGAAGGGGTGGGTGGAAGG - Intergenic
967326969 3:188250915-188250937 GAAGGGAAGGGAAGGGAGGAAGG - Intronic
967568512 3:190999762-190999784 GGAAGGAAGGGGAGGGAGGAGGG + Intergenic
967823716 3:193861995-193862017 CAATAGTGGGGGAGGTAGGATGG - Intergenic
967829197 3:193904382-193904404 AAAGAGAAGGGGAGGGAGTGAGG + Intergenic
967987763 3:195107739-195107761 CGCCAGAAGCGCAGGGAGGACGG - Intronic
968093456 3:195911766-195911788 GAACAGGGTGGGAGGGAGGAAGG - Intronic
968107644 3:196013911-196013933 CAACACAAGGAGAGCCAGGATGG + Intergenic
968294750 3:197567335-197567357 GAACAGAACGGGAGGCAGGTTGG - Intronic
968589250 4:1449556-1449578 TGACAGAACGGGAGGGAGGAAGG - Intergenic
968698577 4:2044171-2044193 CAAAACAAGGGGAGGCAGGCAGG - Intergenic
968862801 4:3185903-3185925 GAAGAGAGAGGGAGGGAGGAAGG + Intronic
968910319 4:3474023-3474045 AAACAGGATGGGAGGGAGGGAGG + Intronic
969178208 4:5416188-5416210 AAACAGAAGAGAAGGAAGGAAGG - Intronic
969225503 4:5795353-5795375 CATCAGAAGAGGATGGAGGCTGG + Intronic
969481315 4:7448539-7448561 GTAGAGAAAGGGAGGGAGGAAGG - Intronic
969495316 4:7523044-7523066 GGAGAGAAGGGGAGGAAGGAGGG - Intronic
969957310 4:10904021-10904043 GAACAGAAGTGGTGGTAGGAAGG + Intergenic
969963345 4:10969541-10969563 AAAGAGAAGGAGAGAGAGGAAGG - Intergenic
970110814 4:12636035-12636057 CAACAGGAAGGGAGGAAGGGAGG - Intergenic
970237885 4:13976907-13976929 CAAGATATGGGGAGGGAGGGAGG - Intergenic
970672415 4:18412095-18412117 AAAGAGAGAGGGAGGGAGGAAGG - Intergenic
970906880 4:21226224-21226246 CAGCATAGGGGGAGGGAGGGGGG + Intronic
971034173 4:22675142-22675164 AAAGAGAAAGAGAGGGAGGAAGG - Intergenic
971171452 4:24237605-24237627 CATCAGTAGGGGATGGATGAAGG - Intergenic
971202377 4:24522528-24522550 TAAGAGAAGGGGAGGGGCGAAGG - Intronic
971341739 4:25775738-25775760 CACCAGAAGGTTAGGAAGGAGGG + Intronic
971394300 4:26214378-26214400 AGAAAGAAGGGGAGGGAGGGAGG + Intronic
971402366 4:26287725-26287747 AACGAGAAAGGGAGGGAGGAAGG + Intronic
971448554 4:26778434-26778456 AAAGAGAAGGGGAGGGAAGGGGG + Intergenic
971451239 4:26803907-26803929 AAAGAGAAGGGGACGGGGGAGGG + Intergenic
971455816 4:26842571-26842593 AGAAAGAAAGGGAGGGAGGAAGG - Intergenic
971775552 4:30960068-30960090 GAAAAGGAGGGGAGGAAGGAAGG + Intronic
973013114 4:45102327-45102349 AGAGAGAAGGGGAGGGAGGGAGG + Intergenic
973251033 4:48060031-48060053 CAAAATAAAGGGATGGAGGAAGG + Intergenic
973318713 4:48788062-48788084 AAAGTGAAGGAGAGGGAGGAAGG + Intergenic
973755010 4:54065533-54065555 AGAAAGAAGGGGAGGAAGGAAGG + Intronic
973765349 4:54157124-54157146 CAAGAGAAAGGAAGGAAGGAAGG + Intronic
973779715 4:54277027-54277049 AAACAGAAGGGGAGAGAGCCAGG + Intronic
973847911 4:54932032-54932054 CATCAGGAGGAGAGGGAGGAGGG - Intergenic
973850721 4:54958911-54958933 AAACCAAAGTGGAGGGAGGAAGG + Intergenic
973901099 4:55472728-55472750 CAAAAGAAGGGGGGGGACAAGGG - Intronic
974151188 4:58011275-58011297 CAAAATAAAGGGATGGAGGAAGG + Intergenic
974612878 4:64239517-64239539 CAAAATAAAGGGATGGAGGAAGG - Intergenic
975365937 4:73527562-73527584 AAACAGAAGGAGAGAGAGTAGGG + Intergenic
975503418 4:75112133-75112155 CAAAATAAAGGGATGGAGGAAGG + Intergenic
975504416 4:75122597-75122619 AAAGAGAGAGGGAGGGAGGAAGG + Intergenic
975613589 4:76224377-76224399 CCACAGAAATGGAGAGAGGAGGG + Intronic
975792368 4:77967540-77967562 AAACAGAAAGGAAGGAAGGATGG + Intergenic
976221802 4:82762171-82762193 CAAAAGAAGAGGAGAGGGGAGGG + Intronic
976222587 4:82769788-82769810 CTACAGAGTGAGAGGGAGGAAGG + Intronic
976326520 4:83777882-83777904 CAGAACAAGGGAAGGGAGGATGG + Intergenic
976546786 4:86344654-86344676 GAATATGAGGGGAGGGAGGAAGG + Intronic
976776124 4:88707876-88707898 GAAAATAAGGGAAGGGAGGAAGG - Exonic
976967014 4:91055787-91055809 AAAAAGAAAGGGAGGGAGGGAGG - Intronic
977361589 4:96012640-96012662 AAAGAGAAAGGGAGGGAGGGAGG + Intergenic
977581369 4:98728713-98728735 CAGCAGATGGGGTGGGAGGAAGG + Intergenic
977593365 4:98851009-98851031 GGAGAGGAGGGGAGGGAGGAAGG + Intergenic
977728070 4:100320798-100320820 AAGGAGAAGGGAAGGGAGGAAGG - Intergenic
977748702 4:100582184-100582206 AAAGGGAAGGGAAGGGAGGAAGG - Intronic
978483745 4:109226221-109226243 CAGAAGAATGGGAGGTAGGAGGG + Intronic
978524502 4:109651964-109651986 CTACAGAAGGGTGGCGAGGAAGG - Intronic
978598297 4:110402281-110402303 GAAGGGAAGGGAAGGGAGGAAGG - Intronic
978697549 4:111600453-111600475 CCAAAGAAAGGGAGGGAGGTTGG - Intergenic
979397992 4:120211722-120211744 TAAAAGAAAGAGAGGGAGGAAGG - Intergenic
979740809 4:124148298-124148320 GAAGAGAAAGAGAGGGAGGAAGG - Intergenic
980176867 4:129356460-129356482 CATCAGAAGGAGAAAGAGGAGGG - Intergenic
980500002 4:133637428-133637450 CAAGAGAAAGAGAGGAAGGAAGG + Intergenic
980812121 4:137895669-137895691 GAAGGGAAGGGAAGGGAGGAAGG + Intergenic
981086579 4:140689739-140689761 AAAAAAAAGGGGTGGGAGGAAGG - Intronic
981174231 4:141661772-141661794 AAACAGAAATGGAGGGCGGAGGG - Intronic
981488485 4:145314022-145314044 TTACTGAAAGGGAGGGAGGAAGG + Intergenic
981489947 4:145328464-145328486 AAAGAGAGAGGGAGGGAGGAAGG + Intergenic
981533198 4:145773023-145773045 GAGCAGGATGGGAGGGAGGAAGG + Intronic
981638889 4:146912709-146912731 CAAGAGAAGGGAGGGGAGGAGGG + Intronic
981950710 4:150403561-150403583 AAAAAGAAGGGGAAGGAGAAGGG - Intronic
982088138 4:151857190-151857212 TAGCATGAGGGGAGGGAGGAGGG - Intergenic
982223142 4:153141676-153141698 GAAGGGAAGGGAAGGGAGGAGGG - Intergenic
982341845 4:154308281-154308303 CAAAAGAAGGGAGGGGAGGAAGG + Intronic
982351067 4:154416129-154416151 CAAGAGAAGGGGTAGGAAGAGGG + Intronic
982649785 4:158073190-158073212 GAAGGGAAGGGAAGGGAGGAAGG + Intergenic
982682218 4:158444980-158445002 CAACAGAGATGGAGGGAGAAGGG - Intronic
982766752 4:159357373-159357395 AGAGAGAAGGGGAGGGAGAAAGG + Intronic
982776317 4:159445055-159445077 CAAGAGAAGGGAAGCAAGGAGGG - Intergenic
982804738 4:159749258-159749280 GAAGGGAAGGGAAGGGAGGAAGG - Intergenic
983953949 4:173675329-173675351 GAAAAGAAAAGGAGGGAGGAAGG - Intergenic
983979948 4:173983289-173983311 AAACAGAAGGGGAGAGAAGCAGG + Intergenic
984008520 4:174342473-174342495 GAAAAGAAGGGAAGGAAGGAAGG + Intergenic
984501549 4:180565284-180565306 AAAAAGAAAGGAAGGGAGGAAGG - Intergenic
984605946 4:181786472-181786494 CTAAAGAAGGTGAGGGATGAGGG + Intergenic
984908781 4:184652853-184652875 AAAAAGAAAAGGAGGGAGGAAGG + Intronic
985187547 4:187333747-187333769 CCACAAAGGGGCAGGGAGGATGG + Intergenic
985219224 4:187685200-187685222 AAAGAGAGAGGGAGGGAGGAAGG - Intergenic
985313099 4:188625451-188625473 GAACAGAATGGGAGGCAGGTTGG - Intergenic
985427850 4:189847570-189847592 GAACTGAATGGGAGGGAGGTGGG - Intergenic
985679129 5:1246818-1246840 GAACAGAGGGAGAGGGAGGAGGG - Intergenic
985711480 5:1432057-1432079 CAGAGGAAGGGTAGGGAGGAAGG + Intronic
985767581 5:1787922-1787944 GAGCAGGAGGGGAGGGAGGAGGG - Intergenic
985830847 5:2228543-2228565 CAAAAGAAGGGAAGGAAGGAAGG + Intergenic
985905029 5:2827860-2827882 GAAAGGAAGGGGAGGAAGGAAGG + Intergenic
985958235 5:3280609-3280631 GAACGGCAGGGCAGGGAGGAAGG - Intergenic
986078471 5:4363288-4363310 AGAAAGAAGGGGAGGGAGGGAGG - Intergenic
986482652 5:8204350-8204372 TAGCAGAAGGTGAAGGAGGAAGG - Intergenic
986627738 5:9738384-9738406 CCAGAGAAGTGGAGGGAGAAGGG + Intergenic
986767457 5:10940641-10940663 AGACAGAAGGGGTGGCAGGAAGG - Intergenic
987026930 5:13936850-13936872 CAGCAGAAGTGGATGGAGGATGG + Intronic
987460145 5:18198920-18198942 GAATAGAAGGGGAGGCAGGTTGG - Intergenic
987563119 5:19549811-19549833 AAAAAGAAAGGGAGGGAGGGAGG + Intronic
987603868 5:20107906-20107928 CAAGAAAGGGGGAGGGGGGAGGG - Intronic
988665374 5:33321499-33321521 ACACAGAAGGGGAGGTAAGAAGG - Intergenic
989130148 5:38099295-38099317 AGAAAGAAGGGAAGGGAGGAGGG - Intergenic
990496620 5:56354284-56354306 AAACAGATGGGGAGGGAGAGTGG + Intergenic
990560818 5:56981187-56981209 CATCAAAGTGGGAGGGAGGACGG + Intergenic
991250015 5:64549642-64549664 GAACAGAAGGGGATGGAGACAGG - Intronic
991507417 5:67339649-67339671 CTACAGAAAGAGAGGAAGGAAGG - Intergenic
991942037 5:71862607-71862629 CAAAAGGAGGGAAGAGAGGAGGG + Intergenic
992380118 5:76228478-76228500 CAGCAGGAGGGTGGGGAGGATGG + Intronic
992667126 5:79021458-79021480 CAACAGCAGGGGAAGGAGGCTGG + Intronic
992967648 5:82019699-82019721 CTACAGATGGGGAGGGAGGGAGG + Intronic
993170321 5:84411516-84411538 TAACAGAAGGGAAGGAAGGAAGG - Intergenic
993204634 5:84863465-84863487 AGAGGGAAGGGGAGGGAGGAAGG - Intergenic
993361508 5:86982168-86982190 CAGCAAAAGGGGAAAGAGGAAGG - Intergenic
993552486 5:89291095-89291117 CAACAGAATGTGCGGGAGGAGGG - Intergenic
993955082 5:94222346-94222368 GAAAAGAAGAGGAGAGAGGATGG + Intronic
994038113 5:95225817-95225839 CAAACAAAAGGGAGGGAGGAAGG - Intronic
994171026 5:96660247-96660269 CAATAGGAGGGAAAGGAGGAAGG - Intronic
994636783 5:102353582-102353604 CAAAATAAAGGGATGGAGGAAGG + Intergenic
995154824 5:108898547-108898569 GAAGGGAAGGGAAGGGAGGAAGG - Intronic
995299007 5:110556336-110556358 GAAGGGAAGGGAAGGGAGGAAGG - Intronic
995453431 5:112327798-112327820 TAACAGAAAGGGAGAGAGGGAGG + Intronic
995688800 5:114800401-114800423 CAACAGAAAGGAAGGGAAGGAGG + Intergenic
995793171 5:115915409-115915431 GAATGGAAGGGGAGGAAGGATGG - Intergenic
995836514 5:116405293-116405315 GAGCAGTAGGGGAGGGAGAATGG + Intronic
996039123 5:118791005-118791027 CAAAAGTAGGGGATGGGGGATGG - Intergenic
996186967 5:120489510-120489532 CAAAATAAAGGGATGGAGGAAGG - Intronic
996232614 5:121085009-121085031 CAAAATAAAGGGATGGAGGATGG - Intergenic
996292719 5:121872629-121872651 AAAAAAAATGGGAGGGAGGAGGG - Intergenic
996403932 5:123089031-123089053 CAGAAGAAGGGGAGGGGAGAGGG - Intergenic
996460760 5:123739645-123739667 GAAGGGAAGGGAAGGGAGGAAGG - Intergenic
996620042 5:125489314-125489336 CCACACTAGGGGATGGAGGAGGG - Intergenic
997042512 5:130275048-130275070 GAACAGAAGGAGGGGGAGGGGGG - Intergenic
997076044 5:130678898-130678920 TAGCAGAAAGGGAGGGAGGGAGG + Intergenic
997183262 5:131855522-131855544 CAAAAGAGAGAGAGGGAGGAAGG + Intronic
997195703 5:131977936-131977958 CATCAAAAGGGGAGGAATGAAGG + Intronic
997645143 5:135477029-135477051 CAAGAGAAGGAGAGAGGGGAGGG - Intergenic
997721406 5:136080807-136080829 CCACTGGAGGGGAGGCAGGAGGG + Intergenic
998305570 5:141072819-141072841 GAAAAGAAAGGGAGGGAGGGAGG + Intergenic
998454818 5:142263658-142263680 TGGCAGAAGGGGAGGAAGGAAGG - Intergenic
998528798 5:142866431-142866453 CAACAGAATGGTTGTGAGGATGG + Intronic
998879192 5:146629742-146629764 GAAGAAAAGGGGAGGGAGGGAGG - Intronic
999081481 5:148848312-148848334 GAACAGAAAAGGAAGGAGGAAGG - Intergenic
999256067 5:150210601-150210623 CAAAAGCTGGGGAGGTAGGAAGG + Exonic
999355879 5:150930132-150930154 CAAACAAGGGGGAGGGAGGATGG - Intergenic
999366125 5:151024613-151024635 CAGCAGCTGGGGAGGGAGGAAGG + Intronic
999448142 5:151657934-151657956 TAAGGGAAGGGGAGTGAGGAAGG - Intergenic
999887350 5:155937494-155937516 TAAAAGAAGTGGAGGGAGAAAGG + Intronic
1000247085 5:159457724-159457746 CAAGAGGAAGGGAGGGAGGGGGG + Intergenic
1000325001 5:160165428-160165450 CAGCAGAAGAGCAGTGAGGAAGG + Intergenic
1000731403 5:164838675-164838697 GAACAGAAAGGGAAGGAGGGAGG - Intergenic
1000743100 5:164995051-164995073 TAACAGAAGAGGAGGGTGAAAGG + Intergenic
1000918957 5:167116232-167116254 TGACAGAAGGAGAGGAAGGAAGG + Intergenic
1001259547 5:170216072-170216094 GTACTGAGGGGGAGGGAGGAAGG - Intergenic
1001397017 5:171424839-171424861 CAGCAGAGGGGGAAGGGGGAGGG + Intronic
1001794107 5:174487572-174487594 GTACAGAAGGGGAGGAAGGACGG + Intergenic
1001991046 5:176115533-176115555 GCACAGAAGTAGAGGGAGGAGGG - Intronic
1002083279 5:176750132-176750154 CTTCAGAAGGGGAAGGAGAAAGG + Intergenic
1002103144 5:176867242-176867264 CTACAGACGGGGCAGGAGGAGGG + Intronic
1002255420 5:177954751-177954773 AAGAAGAAAGGGAGGGAGGAGGG + Intergenic
1002268023 5:178048605-178048627 GCACAGAGGTGGAGGGAGGAGGG - Intronic
1002286136 5:178164007-178164029 AAAGAGAAAGGGAGGGAGGGAGG + Intergenic
1002464037 5:179395514-179395536 AGAAAGAAAGGGAGGGAGGAAGG + Intergenic
1002621880 5:180494135-180494157 GAACAGAAGGAGACGAAGGATGG + Intergenic
1002647792 5:180669747-180669769 AAGCAGAAAGGAAGGGAGGAAGG + Intergenic
1002773241 6:307269-307291 GAAGAGAAGGGAGGGGAGGAAGG - Intronic
1002803396 6:548724-548746 ATACAGAAAGGGAGAGAGGAAGG + Intronic
1002886993 6:1306273-1306295 CACAAGGAGGGGAGGGAAGAAGG - Intergenic
1003096144 6:3144969-3144991 CAACTAAAGGGGAGGGAGAGGGG + Intronic
1003398317 6:5771826-5771848 AAAAAGAAGAGAAGGGAGGAAGG - Intergenic
1003476079 6:6484393-6484415 AAGAAGAAAGGGAGGGAGGAAGG + Intergenic
1003509108 6:6764579-6764601 AAAAAGGAAGGGAGGGAGGAAGG + Intergenic
1003529741 6:6927839-6927861 CACCACAAAGGGAGGGAGGGAGG + Intergenic
1003998519 6:11568375-11568397 GAACAGAGGGGGAAGGAAGAAGG + Intronic
1004193243 6:13483197-13483219 CAACAGAAGGGTATGTAGGGTGG + Intronic
1004275814 6:14234180-14234202 CCACAGAAGCAGAGGCAGGAAGG + Intergenic
1004354780 6:14921485-14921507 CCACAAAAGCGGTGGGAGGAGGG + Intergenic
1004398660 6:15268683-15268705 AAACAGCAGGGGAGGATGGATGG - Intronic
1004779059 6:18885049-18885071 AAACAGAAAGGGAGGAAGGAAGG - Intergenic
1004822998 6:19388806-19388828 AAAAAGAAGGGAAGGAAGGATGG + Intergenic
1004869533 6:19890753-19890775 AAAAAGAGAGGGAGGGAGGAAGG - Intergenic
1005112058 6:22293569-22293591 GAAAAGAAAGGGAGGAAGGAAGG + Intronic
1005354532 6:24969705-24969727 CAAGTGAAGGGGAGAGTGGAGGG - Intronic
1005631067 6:27708455-27708477 AAACAGAAAGAGAGGAAGGAAGG - Intergenic
1005705336 6:28446062-28446084 AAAAAGTAGGGAAGGGAGGAGGG - Intergenic
1006184908 6:32176030-32176052 CAGCAGAAAGGGAGGGAGGGAGG - Intronic
1006236600 6:32638743-32638765 AAAGAAAAGGGAAGGGAGGAAGG + Intronic
1006263391 6:32895189-32895211 AGAGAGAAGGGGAGGGAGAAGGG + Intergenic
1006394490 6:33778207-33778229 GCACAGAAGGGGAGGGAAGGCGG + Intronic
1006424927 6:33957975-33957997 CACCAGCAGGGGAGGAAGGGAGG + Intergenic
1006563194 6:34931532-34931554 AAGCAGAAGGGGAGAGAGTAGGG - Intronic
1006681597 6:35800739-35800761 CGAAAGGAAGGGAGGGAGGAAGG - Intergenic
1006717998 6:36132272-36132294 AAGCATAAGGGGAGGGTGGAAGG - Intronic
1006921124 6:37627857-37627879 CAAAAGAAGGAGAGGGTGAAAGG + Intergenic
1007199453 6:40094189-40094211 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007264021 6:40584002-40584024 CAAGAGAAAGGGAGGGAAGCAGG + Intronic
1007302337 6:40876704-40876726 AGAAAGAATGGGAGGGAGGAAGG - Intergenic
1007404424 6:41625838-41625860 CAAGAGAGGGGGACAGAGGAAGG - Intergenic
1007675244 6:43588372-43588394 GAAAAGAAAGGAAGGGAGGAAGG - Intronic
1007709106 6:43810423-43810445 CAAGAGGAGGGGCTGGAGGAGGG + Intergenic
1007780989 6:44254646-44254668 CAGCAGAAGGGGATGGTGGGAGG + Exonic
1007945320 6:45821307-45821329 CCTGAGAAGGGCAGGGAGGATGG + Intergenic
1008443147 6:51556020-51556042 GAACAGAAAGGGAAGGAGGAAGG + Intergenic
1008640187 6:53454281-53454303 CAACAGAAGGGCAGTTAGAAGGG + Intergenic
1008890863 6:56488406-56488428 CATCAGAGGGGAAGGAAGGAAGG + Intronic
1009267876 6:61579034-61579056 CAGCAGAAAGAGAGGGAGGTGGG + Intergenic
1009777447 6:68222824-68222846 CAAAAGAAGGGGAAGAAGAAGGG + Intergenic
1009950243 6:70387065-70387087 CAACTGAAGAAAAGGGAGGAAGG - Intergenic
1010091880 6:71992476-71992498 AAAAAGAAGGGAAGGAAGGAAGG - Intronic
1010704333 6:79089802-79089824 AAAAAGAGAGGGAGGGAGGAAGG - Intergenic
1011550512 6:88527503-88527525 GGAAAGAAGGGGAGGGAGGGAGG + Intergenic
1011713255 6:90076783-90076805 CCAGAGAAGGGCACGGAGGAAGG - Intronic
1012651701 6:101762129-101762151 GAAGAGGAAGGGAGGGAGGAAGG - Intronic
1012953869 6:105547840-105547862 CTAAAGAAGGAGAGGAAGGAAGG + Intergenic
1013059679 6:106620965-106620987 CTACAGAAGGGAGGGCAGGAAGG - Intronic
1013309875 6:108883835-108883857 GAACAGAAGGGCAGGAGGGAGGG - Intronic
1013313984 6:108923926-108923948 AATGAGAAGGGGAAGGAGGAGGG - Intronic
1013840461 6:114386562-114386584 GAAGAGAAGGGAAGGGAAGATGG + Intergenic
1014028390 6:116674309-116674331 AAAAAGAAAGGGAGGGAGGGAGG + Intergenic
1014166966 6:118236214-118236236 AAAGAGAAGGAGAGGGAAGAAGG - Intronic
1014168703 6:118254034-118254056 CAGCAGATGGGGAGAGGGGACGG + Intronic
1014650212 6:124027006-124027028 AAACAGAAGAGGAAGTAGGAGGG - Intronic
1015489763 6:133812394-133812416 AAACAGAAAGGAAGGAAGGAAGG + Intergenic
1015571337 6:134624397-134624419 GGAAAGAAAGGGAGGGAGGAAGG - Intergenic
1015874621 6:137810143-137810165 AGAGAGAAAGGGAGGGAGGAAGG + Intergenic
1015883572 6:137893323-137893345 CAGCAGAAGGGGAGGGGGAGGGG - Intergenic
1016245912 6:141980599-141980621 GAAGAGAAGGAAAGGGAGGATGG + Intergenic
1016411910 6:143792403-143792425 CAACTGAAAGGAAAGGAGGATGG - Intronic
1017041816 6:150314259-150314281 CTGCAGAAGGGGAGAGGGGAGGG + Intergenic
1017056507 6:150441448-150441470 CAGCAGAGGTGGAGGCAGGAAGG - Intergenic
1017424352 6:154305295-154305317 GAACAGCAGGGGAAGGAGAAAGG - Intronic
1017730170 6:157308632-157308654 CAGCAGAAGAGGAGGCAAGACGG + Intronic
1017763905 6:157591970-157591992 GAACAGGAGGGCAGGGTGGATGG - Intronic
1017769832 6:157636496-157636518 CAGCAGGAGGGAAGTGAGGATGG - Intronic
1017808454 6:157966761-157966783 CAACAGACGGGCAGGGAAGAAGG - Intergenic
1017937483 6:159019227-159019249 AAAGAGAAAGGGAGGGAGGTGGG + Intergenic
1018017399 6:159724877-159724899 CAAGAGAAGGGAAGGAAGGGAGG + Intronic
1018423277 6:163658547-163658569 AAAGGGAAGGGGAGGGAGGAAGG - Intergenic
1018735206 6:166682567-166682589 GAACAGAGTGAGAGGGAGGAGGG + Intronic
1018778207 6:167038286-167038308 AAACAGAAGGGCAGACAGGACGG - Intronic
1018814424 6:167320430-167320452 GAAGAAAAGGGGAAGGAGGAAGG - Intergenic
1018989487 6:168662663-168662685 CAACAGATGGGAAGGGCTGAAGG + Intronic
1018992424 6:168684387-168684409 CAAGTGAAGGGAAGAGAGGATGG - Intergenic
1019315506 7:382477-382499 AGAGAGAAAGGGAGGGAGGAAGG + Intergenic
1019353784 7:568552-568574 CATCAGAAGGTCTGGGAGGAGGG + Intronic
1019465429 7:1185600-1185622 CCACGGAGGGGGAGGGTGGACGG - Intergenic
1019564401 7:1672232-1672254 CCAGAGGAGGGGAGGGAGGGCGG + Intergenic
1019686824 7:2386583-2386605 CATCAGGAAGGGAGGGAGGGAGG + Intergenic
1019891994 7:3954482-3954504 AAGCAGGAGGGGAGGGGGGAGGG - Intronic
1019964085 7:4484702-4484724 AGAGAGAAGGGGAGAGAGGAGGG + Intergenic
1020007419 7:4789994-4790016 CCACTGAAGGGGAGGGGGGAGGG - Intronic
1020011358 7:4807556-4807578 AGAGAGAAGGAGAGGGAGGAGGG - Intronic
1020011369 7:4807594-4807616 AGAGAGAAGGAGAGGGAGGAGGG - Intronic
1020011392 7:4807668-4807690 GGAGAGAAGGAGAGGGAGGAGGG - Intronic
1020011500 7:4808039-4808061 GGAGAGAAGGAGAGGGAGGAAGG - Intronic
1020115322 7:5473000-5473022 CTGCAGCAGGGGAGAGAGGATGG - Intronic
1020224538 7:6269752-6269774 CAAGATAAGGAGAGAGAGGATGG - Intronic
1020227050 7:6288597-6288619 CAAAAGGGAGGGAGGGAGGAAGG - Intergenic
1020235663 7:6353471-6353493 AGAGAGAAAGGGAGGGAGGAAGG + Intergenic
1020286212 7:6683084-6683106 TAGCAGAAAGGGAGAGAGGATGG + Intergenic
1020680712 7:11233375-11233397 CTACACCAGGGGAGAGAGGATGG - Intergenic
1020739487 7:11995939-11995961 CAATACAAGAGGAGGGAGGAAGG - Intergenic
1020942043 7:14552524-14552546 CATGAGACAGGGAGGGAGGAGGG - Intronic
1021037069 7:15812668-15812690 CCAGAGCAGGGGAGCGAGGAAGG - Intergenic
1021183945 7:17540994-17541016 GAAAAGAAAGGGAGGGAAGAAGG + Intergenic
1021228467 7:18056776-18056798 GCACAGAAGTGGATGGAGGAAGG - Intergenic
1021376924 7:19919971-19919993 CTAGAGACTGGGAGGGAGGAGGG + Intergenic
1021461176 7:20888734-20888756 CCACAGATGGGGGTGGAGGAGGG - Intergenic
1021656707 7:22880655-22880677 GAAAAGAAAGGAAGGGAGGAGGG - Intergenic
1021695239 7:23269909-23269931 ACAGAGAAGGGGAGAGAGGAAGG - Intronic
1021705914 7:23367579-23367601 CAACGACAGGGGAGGGAGGAAGG + Intronic
1021887332 7:25152678-25152700 AAAGAGGAAGGGAGGGAGGAAGG - Intronic
1021954178 7:25807294-25807316 CAAAACGAAGGGAGGGAGGAGGG + Intergenic
1022004346 7:26253783-26253805 GACAAGAAAGGGAGGGAGGAAGG + Intergenic
1022019066 7:26380935-26380957 CTACAGAAAGGCAGGGAGTATGG + Intergenic
1022135635 7:27445453-27445475 TAAAAGAAAGGGAGGGAGGGAGG + Intergenic
1022139081 7:27476501-27476523 CAAAAGGGAGGGAGGGAGGAAGG + Intergenic
1022311696 7:29202467-29202489 CAACAAAATGGGAAGGTGGAAGG + Intronic
1022525651 7:31035329-31035351 CAGCAGCAGGGGAAGAAGGAGGG + Intergenic
1022858498 7:34340823-34340845 TAGCAGAAGGGGAAGAAGGAAGG - Intergenic
1023149127 7:37183190-37183212 GCACAGAAGGAGAAGGAGGAAGG + Intronic
1023572418 7:41585917-41585939 AGACAGATGGGGAGGAAGGAGGG - Intergenic
1023654958 7:42410068-42410090 AAACAGAAGGGGAAAGAGAAGGG - Intergenic
1023820232 7:43976803-43976825 CAGGAGAAGGGGTGGGAGGTGGG + Intergenic
1023829125 7:44028977-44028999 CTAGAGAATGGGAGGGAGAACGG - Intergenic
1023911143 7:44557680-44557702 AAGGGGAAGGGGAGGGAGGAAGG + Intergenic
1023913979 7:44574791-44574813 GAAGAGAAGGGGAGGGGGGAGGG - Intronic
1023937009 7:44747548-44747570 GAAGGGAAGGGGAGGGAAGAAGG + Intergenic
1024139897 7:46451743-46451765 CCACAGCAGGGCAGGGAGTAAGG + Intergenic
1024142728 7:46478661-46478683 CAAAGAAAGGGGAGAGAGGAAGG + Intergenic
1024156020 7:46626364-46626386 CAACCCAAGGAGAGAGAGGATGG + Intergenic
1024270156 7:47635826-47635848 GGAAAGAAGAGGAGGGAGGAAGG + Intergenic
1024325673 7:48107537-48107559 GAGCAGAAGTGAAGGGAGGAGGG - Intronic
1024455473 7:49600967-49600989 TAACAGAAAGGGGTGGAGGAAGG - Intergenic
1024519675 7:50294078-50294100 TTTCAGAAGGGGAGGGAAGAGGG - Intergenic
1024570211 7:50716923-50716945 CCAGATGAGGGGAGGGAGGAAGG + Intronic
1024672819 7:51612167-51612189 CAGCAGAGAGGGAGGGAGGGAGG + Intergenic
1024746592 7:52413991-52414013 AAAGAGAAAGGGAGGGAGGGAGG + Intergenic
1024965242 7:55018653-55018675 CAAAAGAAGGGAAAGGGGGAAGG + Intergenic
1025139460 7:56450072-56450094 GAAGAGAAGGGGAGGGAAGGGGG - Intergenic
1025479361 7:60962735-60962757 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1025552623 7:62269589-62269611 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1025565862 7:62433239-62433261 CAAAAGGAAGGGAGGGAGCAAGG + Intergenic
1025673199 7:63627374-63627396 AGGTAGAAGGGGAGGGAGGAGGG + Intergenic
1025872637 7:65449199-65449221 GAAGAGAAGGGAAGGGGGGAGGG - Intergenic
1025872668 7:65449359-65449381 CAGAAGAAAGGGAGGGAAGAAGG - Intergenic
1026123240 7:67556097-67556119 AAGGAGAAAGGGAGGGAGGAAGG - Intergenic
1026133194 7:67636985-67637007 AAGGAGAAGGGGAGGAAGGAAGG - Intergenic
1026432667 7:70362654-70362676 AGAGAGAAAGGGAGGGAGGAAGG - Intronic
1026521165 7:71119301-71119323 AAAGAGAAAGGAAGGGAGGAAGG - Intergenic
1026526962 7:71162152-71162174 CAACAGGAAGGAAGGAAGGAAGG - Intronic
1026531276 7:71199562-71199584 GAGCAGAAGGGTAGGCAGGATGG - Intronic
1026677154 7:72437686-72437708 AAAGAGAGAGGGAGGGAGGAAGG - Intronic
1026740387 7:72975409-72975431 CCACAGATGGAGAGGGATGATGG + Intergenic
1026797689 7:73376895-73376917 CCACAGATGGAGAGGGATGATGG + Intergenic
1026871843 7:73857495-73857517 AAAAAGAAGGGAAGGAAGGAAGG - Intergenic
1026882346 7:73915466-73915488 GAAAAGGAAGGGAGGGAGGAAGG - Intergenic
1026953700 7:74363903-74363925 AAAAAAAAAGGGAGGGAGGAAGG + Intronic
1026962458 7:74417469-74417491 GAACAGGAGGGGAGGCTGGAGGG + Intergenic
1026972943 7:74479056-74479078 CAGCAGCAGGGGATGGAGGACGG - Intronic
1027103344 7:75389661-75389683 CCACAGATGGAGAGGGATGATGG - Intergenic
1027223657 7:76230665-76230687 GAACAGAAGGGAAGGGAGAAAGG + Intronic
1027837741 7:83266787-83266809 CAGGAGAAGAGGAGGGAGGGAGG + Intergenic
1027902619 7:84136915-84136937 AAGAAGAAGGGGAGGAAGGAAGG + Intronic
1028445549 7:90918471-90918493 CAAGAGAAGGGGAGCTAGCAAGG - Intronic
1028658157 7:93234792-93234814 CAAAATAATGGGAGGAAGGAAGG + Intronic
1029284903 7:99458650-99458672 CCACAGAATGGGAGTGAGGTGGG + Intronic
1029477697 7:100794843-100794865 GAAGAGAAGAGAAGGGAGGAGGG + Intronic
1029615729 7:101656042-101656064 AAACAGAATGGGAGGCAGGTTGG - Intergenic
1029739426 7:102483234-102483256 CTAGAGAATGGGAGGGAGAACGG - Exonic
1029748520 7:102530324-102530346 CAGGAGAAGGGGTGGGAGGTGGG + Intergenic
1029757427 7:102582413-102582435 CTAGAGAATGGGAGGGAGAACGG - Exonic
1029766467 7:102629408-102629430 CAGGAGAAGGGGTGGGAGGTGGG + Intronic
1029775367 7:102681474-102681496 CTAGAGAATGGGAGGGAGAACGG - Intergenic
1029830052 7:103246864-103246886 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1030035304 7:105403752-105403774 CGAAAGGAAGGGAGGGAGGAAGG - Intergenic
1030035326 7:105403862-105403884 CAAAAGAAAGGAAGGGAGGGAGG - Intergenic
1030189255 7:106794375-106794397 GGAGAGAAGGGGAGGGTGGAAGG + Intergenic
1030444166 7:109627873-109627895 CAATAGAACGGGAGAGAGAAGGG - Intergenic
1030528375 7:110680903-110680925 CAAGAGCAAGGCAGGGAGGATGG - Intronic
1030921658 7:115397103-115397125 ACCCAGAAGGGGAGGGTGGAAGG - Intergenic
1031049935 7:116934797-116934819 AAAGAAAGGGGGAGGGAGGAAGG - Intergenic
1031214878 7:118877323-118877345 GAAAGGAAGGGAAGGGAGGAAGG + Intergenic
1031339813 7:120585299-120585321 AAACAGAAGGGGATGGGGGGTGG + Intronic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1031567344 7:123317129-123317151 CAAAAGGAGGGGAGGGTGGGAGG + Intergenic
1031682890 7:124695897-124695919 AAAGAGAGAGGGAGGGAGGAAGG + Intergenic
1031983647 7:128148031-128148053 AGAGAGACGGGGAGGGAGGAGGG + Intergenic
1032220136 7:129988221-129988243 AGAGAGAAAGGGAGGGAGGAAGG - Intergenic
1032325565 7:130925310-130925332 GAAGAAAAGGGAAGGGAGGAGGG + Intergenic
1032527327 7:132588666-132588688 GAAGGGAAGGGAAGGGAGGAGGG + Intronic
1032716718 7:134515141-134515163 CAACAGCAGAGGATGGAGGGAGG - Intergenic
1032887770 7:136160884-136160906 AAAGAGAAAGGGAGGGAAGAAGG - Intergenic
1033075277 7:138244123-138244145 CATTAGAATGGGAAGGAGGAAGG - Intergenic
1033581936 7:142745980-142746002 CAAGAGGAGGGGCGGGAGGCAGG + Intergenic
1033798849 7:144877978-144878000 CATCTGAAGCGGAGAGAGGAGGG - Intergenic
1033825648 7:145186860-145186882 GAAGGGGAGGGGAGGGAGGAAGG - Intergenic
1034150203 7:148909364-148909386 CCACAGAATGGGAGGAATGATGG - Intergenic
1034256032 7:149725093-149725115 AGACAGGAGGGGAGTGAGGAGGG - Intronic
1034385187 7:150735087-150735109 AAACAGAAGGGTAGGGAAAATGG + Intronic
1034422322 7:150996294-150996316 GAACAGGGGGAGAGGGAGGAGGG - Intronic
1034724668 7:153324499-153324521 CCATAGAGGGGGAGGGAGGCAGG - Intergenic
1034745145 7:153517541-153517563 GAACAGAATGGGAGGCAGGTTGG - Intergenic
1034918836 7:155062283-155062305 CAGGAGAAGGGGAGGGAGGAGGG + Intergenic
1034985510 7:155511123-155511145 CGAGAGTGGGGGAGGGAGGAAGG - Intronic
1035428939 7:158803063-158803085 CAACTAAAGGGGAAGGAAGAAGG + Intronic
1035442859 7:158917966-158917988 CAACCGTATGGGAGTGAGGAAGG - Intronic
1035724434 8:1815779-1815801 AAACAGAAAGGAAGGAAGGAAGG + Intergenic
1035770404 8:2142686-2142708 GAAGGGGAGGGGAGGGAGGAAGG - Intronic
1035776270 8:2191198-2191220 GAAAGGGAGGGGAGGGAGGAAGG - Intergenic
1035824227 8:2627429-2627451 CAAAAGGAAGGGAGGGAGGGAGG + Intergenic
1035883180 8:3265496-3265518 GAACAGAAGGGGCTGGAGAAGGG + Intronic
1035912957 8:3588474-3588496 AAACAGAAAGGGAGGGATGGGGG + Intronic
1035985118 8:4420904-4420926 CAAAAGACAGGGAGGGAGGAGGG - Intronic
1035992787 8:4510847-4510869 GAAGGGAAGGGAAGGGAGGAGGG - Intronic
1036051676 8:5205852-5205874 AAAGAGAGGGGGAGGGAGGGAGG + Intergenic
1036154118 8:6326034-6326056 GAAGAGAAAGGAAGGGAGGAAGG + Intergenic
1036584453 8:10110361-10110383 TAACAAAATGGGAGGGAGGCTGG - Intronic
1036663023 8:10720530-10720552 GAAGAGAAAGGGAGGGAGGAAGG + Intergenic
1036692584 8:10953183-10953205 CCACAGACTAGGAGGGAGGATGG - Intronic
1036975441 8:13405833-13405855 AGACAGAAAGGGAGGGAGGGAGG - Intronic
1037134758 8:15446729-15446751 CAGGAGAGGGGGAGGGAGGGGGG + Intronic
1037330183 8:17736469-17736491 CACCTGAAAGGAAGGGAGGAGGG - Intronic
1037542461 8:19885586-19885608 GAAAAGAAGGAAAGGGAGGAGGG - Intergenic
1037739855 8:21599812-21599834 CAGGAGAAGGGGTAGGAGGAAGG + Intergenic
1037908359 8:22728599-22728621 CAAAAAAAGGGAAGGAAGGAAGG - Intronic
1038037213 8:23696606-23696628 AAACAGAGGGTCAGGGAGGAAGG + Intergenic
1038137295 8:24801570-24801592 CAAAAGAAGGAGGGGAAGGAAGG + Intergenic
1038150959 8:24942146-24942168 AAGGAGAAGGGGAGGGAGGTGGG - Intergenic
1038339530 8:26673896-26673918 GAGGAGGAGGGGAGGGAGGAAGG - Intergenic
1038419039 8:27420335-27420357 AGACAGAAGGGTGGGGAGGATGG + Intronic
1038426162 8:27465261-27465283 AATTAGAAGGGGAGGGAGGATGG - Intronic
1038448435 8:27620833-27620855 GAAGAGAAGGGAAGGGAGGAAGG - Intergenic
1038667661 8:29554250-29554272 AAAAAGAAGGGGAGGGAGGGAGG - Intergenic
1038721335 8:30038583-30038605 GAACAGAGGGAGAGGGAGGGAGG + Intergenic
1038786319 8:30619987-30620009 CAACAGAAGAGGATGGAGGAAGG + Intronic
1039169712 8:34729360-34729382 CGACAGAAGGAAAGGAAGGAAGG + Intergenic
1039187332 8:34931828-34931850 CTACAGAAGGGGCGGGGGGTGGG + Intergenic
1039314503 8:36356530-36356552 AAAGGGAAGGGAAGGGAGGAAGG + Intergenic
1039377688 8:37052883-37052905 CAACTGAAGGGAAGGGAATATGG - Intergenic
1039397670 8:37240940-37240962 AAGCAGGAGGGAAGGGAGGAGGG + Intergenic
1039459246 8:37729517-37729539 CAAGAGAGAGGGAGGGAGGAAGG + Intergenic
1039750004 8:40470029-40470051 CACCAGGAGGGCAGGCAGGAGGG + Intergenic
1039781297 8:40788950-40788972 CTACAGAAAGAGAGAGAGGAAGG + Intronic
1040011020 8:42661308-42661330 AAAAAGAAGGTGGGGGAGGAGGG - Intergenic
1040051899 8:43023409-43023431 GAAAAGAAGGGAAGGAAGGAAGG - Exonic
1040549810 8:48429240-48429262 AGAAAGATGGGGAGGGAGGAGGG + Intergenic
1041313468 8:56539160-56539182 GAACAGAATGGGGAGGAGGAGGG + Intergenic
1041645068 8:60243272-60243294 GAAAAGAGGAGGAGGGAGGAAGG - Intronic
1042089487 8:65143501-65143523 CACCAGGAGGGGTGGCAGGACGG - Intergenic
1042333506 8:67607137-67607159 GAAGAGGAGGGGGGGGAGGAGGG - Intronic
1042363898 8:67914542-67914564 AAAAAGAAGGGGAGGAAGGCTGG - Intergenic
1042656092 8:71098448-71098470 AGAAAGAAAGGGAGGGAGGAAGG - Intergenic
1042839135 8:73106170-73106192 ACACAGAGAGGGAGGGAGGAAGG - Intronic
1042962851 8:74321444-74321466 CGGCAAAAGAGGAGGGAGGACGG - Intronic
1043152691 8:76738685-76738707 AGAGAGAAAGGGAGGGAGGAGGG - Intronic
1043267695 8:78286993-78287015 AAAGAGAGAGGGAGGGAGGAAGG + Intergenic
1043675872 8:82952990-82953012 CAAGAGAGGGAGAGTGAGGAGGG - Intergenic
1043772514 8:84223161-84223183 GAAGGGAAGGGAAGGGAGGAAGG - Intronic
1043930569 8:86086114-86086136 GAGCAGAAAGAGAGGGAGGAGGG + Intronic
1044253206 8:90028708-90028730 AAAAAGAAAGGAAGGGAGGAAGG - Intronic
1044619116 8:94172000-94172022 CGGGAGAAGGGGAGGGAGGAGGG - Intronic
1045380158 8:101616071-101616093 AAAGAGAAAGGGAGGGAGGGAGG - Intronic
1045504197 8:102767127-102767149 GGACAGAAGGGGAGGGAGTCCGG + Intergenic
1045608692 8:103809485-103809507 AAAAAGGAGTGGAGGGAGGAGGG - Intronic
1045882975 8:107063133-107063155 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1046047739 8:108984455-108984477 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1046292361 8:112179801-112179823 CAAGAGAAAGGGAGAGAGGAGGG + Intergenic
1046555459 8:115768322-115768344 GGAAAGAAGGGAAGGGAGGAAGG - Intronic
1046558436 8:115806693-115806715 AAAAAGAAAGGGAGGAAGGAAGG + Intronic
1046588354 8:116175714-116175736 AAAGAGAAGGGAAGGAAGGAAGG + Intergenic
1046660532 8:116943687-116943709 GCACAAAAGGGGAGGGAGGGAGG + Exonic
1046936151 8:119887433-119887455 GAACGGGAGGGGAGGGGGGAGGG - Intronic
1047261301 8:123262951-123262973 GAAAAGAAAGGGAGGGAGGGAGG + Intronic
1047559925 8:125975797-125975819 CCACAGATGGGGATGGGGGATGG + Intergenic
1047736739 8:127772251-127772273 AAAAAGAAAGGGAGGGAGGGAGG + Intergenic
1047750327 8:127875762-127875784 CAAGGGAAGGGTGGGGAGGAAGG + Intergenic
1047873286 8:129108301-129108323 CAACGGGAGGGGTGGAAGGAGGG + Intergenic
1048172159 8:132117610-132117632 CAACAGAAAGCCAGGGAGGAAGG - Intergenic
1048837878 8:138538348-138538370 GAAGGGAAGGGAAGGGAGGAAGG + Intergenic
1049014111 8:139907530-139907552 AAAGAGAAAGGGGGGGAGGAAGG + Intronic
1049243030 8:141548384-141548406 CCCCAGAGAGGGAGGGAGGAAGG + Intergenic
1049288127 8:141787575-141787597 GAACAGAGAGGGAGGGAGGGAGG + Intergenic
1049311757 8:141937310-141937332 AAAGAGGAGGAGAGGGAGGAGGG - Intergenic
1049443537 8:142619771-142619793 CAACAGGAGAAGAGGAAGGAAGG - Intergenic
1049510942 8:143026370-143026392 GAACAGATCCGGAGGGAGGAGGG + Intergenic
1049784890 8:144445660-144445682 AAAAAGAAAGGGAGGGAGGGAGG + Intergenic
1049846252 8:144803258-144803280 CAGCATCAGGAGAGGGAGGATGG - Intronic
1049979659 9:892492-892514 CAACAGAACTGGAGGGCTGAGGG - Intronic
1050511202 9:6397506-6397528 CAAAAGAAAGGAAGGGAGGGAGG + Intergenic
1050638779 9:7642749-7642771 CCAAAAGAGGGGAGGGAGGAGGG - Intergenic
1050874051 9:10613203-10613225 CGCCAGATGGGGCGGGAGGAGGG + Intergenic
1050914209 9:11110584-11110606 AAACAGGAAGGGAGGGAGGGAGG + Intergenic
1051216418 9:14803002-14803024 AGAAAGAAAGGGAGGGAGGAAGG - Intronic
1051258663 9:15239752-15239774 CCAAAAGAGGGGAGGGAGGATGG + Intronic
1052638722 9:31136309-31136331 AAAGAGAAAGGGAGGGAGGGAGG + Intergenic
1052779313 9:32764528-32764550 CAACAGAAAGGAAGAAAGGAGGG - Intergenic
1053297412 9:36924782-36924804 AAAGAGAAAGGGAGGGAGGGAGG + Intronic
1053329324 9:37188841-37188863 AAAGAGAAGGGGAGGGGAGAGGG - Intronic
1053378479 9:37628775-37628797 CACCAGGAAGGGAAGGAGGAAGG - Intronic
1053540110 9:38964952-38964974 CAGTAGGAGGGGAAGGAGGAAGG + Intergenic
1053553341 9:39107347-39107369 AGACTGAATGGGAGGGAGGAAGG + Intronic
1053553362 9:39107417-39107439 CATCTGAATGGGATGGAGGAAGG + Intronic
1053575557 9:39355561-39355583 CAGCAGGAGGGGGAGGAGGAGGG - Intergenic
1053804460 9:41787109-41787131 CAGTAGGAGGGGAAGGAGGAAGG + Intergenic
1053817449 9:41927504-41927526 AGACTGAATGGGAGGGAGGAAGG + Intronic
1053817469 9:41927574-41927596 CATCTGAATGGGATGGAGGAAGG + Intronic
1053946374 9:43312960-43312982 GAAGGGAAAGGGAGGGAGGAAGG + Intergenic
1054107704 9:61071175-61071197 AGACTGAATGGGAGGGAGGAAGG + Intergenic
1054107725 9:61071245-61071267 CATCTGAATGGGATGGAGGAAGG + Intergenic
1054140824 9:61528353-61528375 CAGTAGGAGGGGAAGGAGGAAGG - Intergenic
1054613132 9:67259880-67259902 CATCTGAATGGGATGGAGGAAGG - Intergenic
1054613153 9:67259950-67259972 AGACTGAATGGGAGGGAGGAAGG - Intergenic
1054626030 9:67398969-67398991 CAGTAGGAGGGGAAGGAGGAAGG - Intergenic
1054973412 9:71115544-71115566 CAACAGAAGAGCAGAGGGGAGGG + Intronic
1055186051 9:73455431-73455453 AAAGAGAGGGGGAGGGAGGGAGG - Intergenic
1056037217 9:82619247-82619269 CCACAGAAGGGGAGGGACAGCGG - Intergenic
1056285093 9:85079547-85079569 AGGCAGTAGGGGAGGGAGGATGG - Intergenic
1056540232 9:87564621-87564643 CAAGAGGGAGGGAGGGAGGAAGG + Intronic
1056735353 9:89204986-89205008 CAACACAAGGAGAGGAAGTAGGG - Intergenic
1056962506 9:91138636-91138658 GAAAGGAAGGGGAGGCAGGAGGG - Intergenic
1056983026 9:91334390-91334412 GAACAAAAGGTGAAGGAGGAAGG + Intronic
1057302294 9:93893958-93893980 CAGCAGAGCGGGAGGGAGGTGGG - Intergenic
1057447141 9:95124546-95124568 AACTAGAAGGGGAGTGAGGAAGG - Intronic
1057498500 9:95578594-95578616 CAACAGCAGGGGAGTGGGGAAGG - Intergenic
1057836523 9:98449772-98449794 CAGAAGAGGGGGATGGAGGAGGG + Intronic
1057841090 9:98486065-98486087 CAGGAGAAGGGGAGGGAAGCAGG - Intronic
1057931287 9:99195845-99195867 TAAAAGAAAGGGAAGGAGGAAGG - Intergenic
1058074165 9:100634033-100634055 GAAGGGAAGGGAAGGGAGGAAGG - Intergenic
1058156139 9:101518025-101518047 GAGGAGAAAGGGAGGGAGGAAGG - Intronic
1058191709 9:101924372-101924394 CAACAGAAGGTGAGTGAGCGGGG + Intergenic
1058540114 9:106002982-106003004 CATCTGAAGGAGAGGGATGAAGG + Intergenic
1058561411 9:106233044-106233066 GAACGGAGGGGGAGTGAGGAAGG - Intergenic
1058577804 9:106422224-106422246 TAGCAGAAGGGAAGGGAGAAAGG - Intergenic
1058619208 9:106864630-106864652 CTACAGAGAGGGAGGGAGGGAGG + Intronic
1058643311 9:107107854-107107876 CAAAAGCAAAGGAGGGAGGAAGG + Intergenic
1058646390 9:107135132-107135154 CACTAGATGGGGAGGGAGGTAGG - Intergenic
1058732324 9:107862163-107862185 CTAGAGATTGGGAGGGAGGAGGG - Intergenic
1059063774 9:111060634-111060656 CAAGAGAAGGGAAGAAAGGAGGG + Intergenic
1059215008 9:112553174-112553196 GAAAAGAAGGGGAGGGGAGAGGG - Intronic
1059309929 9:113381341-113381363 AAAGGGAAGGGAAGGGAGGAGGG - Intergenic
1059486897 9:114634015-114634037 AAACACCAGGGCAGGGAGGAAGG - Intronic
1059675819 9:116538173-116538195 AAGAAGAAAGGGAGGGAGGAAGG + Intronic
1059876890 9:118645247-118645269 GAAAAGAGGGGGAAGGAGGAAGG - Intergenic
1059965469 9:119609590-119609612 AAAGAGGAAGGGAGGGAGGAAGG - Intergenic
1059965502 9:119609773-119609795 AAAGAGAGAGGGAGGGAGGAAGG - Intergenic
1060583474 9:124771416-124771438 CAACTGAAGGGGTGGAAGGAGGG + Intergenic
1060844764 9:126827374-126827396 CAAGAGGAGGGGGTGGAGGAAGG - Intronic
1060853343 9:126895607-126895629 CCACAGAAGGGAAGGAAGCAGGG + Intergenic
1060859044 9:126938886-126938908 CAGGAGTAGAGGAGGGAGGAGGG + Intronic
1061005381 9:127926200-127926222 AGAAAGAAGGGGAGGAAGGAAGG - Intronic
1061026858 9:128055372-128055394 GAAGAGAAGGGAAGGGAGGGAGG + Intergenic
1061048559 9:128180707-128180729 CACCAGAAGGTGAGGGAGGGAGG - Exonic
1061233473 9:129328444-129328466 CCCTGGAAGGGGAGGGAGGAAGG + Intergenic
1061381168 9:130258693-130258715 AAAAAGAAAGGAAGGGAGGAAGG + Intergenic
1061591981 9:131603619-131603641 CACCAGAAGATAAGGGAGGAAGG + Intronic
1061942517 9:133891331-133891353 GAATAGAAGGGAAGGGATGAAGG + Intronic
1061942652 9:133891684-133891706 GAATGGAAGGGGAGGGATGAAGG + Intronic
1062073443 9:134571755-134571777 CCACAGAAGTGGAGGTTGGAGGG - Intergenic
1062183431 9:135203290-135203312 AGACTGATGGGGAGGGAGGAAGG - Intergenic
1062199870 9:135296870-135296892 CAACAGGAGGTGAGGCAGGGCGG + Intergenic
1062386595 9:136314304-136314326 CAGCAGGAGGGCAGGGAGCAGGG - Intergenic
1062432726 9:136533163-136533185 CCACTGAAGGGGAAGTAGGAGGG + Intronic
1062703409 9:137920032-137920054 TCACAGCAGGGGAGGGAGAAGGG - Intronic
1062729809 9:138102631-138102653 CAGCAGGAGGGGAGCGGGGAGGG - Intronic
1203465356 Un_GL000220v1:80981-81003 GAAAAGAAAGGGAGGGAGGAAGG - Intergenic
1203589504 Un_KI270747v1:41518-41540 GAAGGGAAAGGGAGGGAGGAAGG + Intergenic
1185491712 X:522847-522869 AAACAGAAAGGAAGGAAGGAAGG - Intergenic
1185526621 X:785214-785236 AGAGAGAAAGGGAGGGAGGAAGG - Intergenic
1185616033 X:1422585-1422607 CCACAGAATGGGAGGCTGGAAGG + Intronic
1185698330 X:2212951-2212973 AGAGAGAAAGGGAGGGAGGAGGG + Intergenic
1185711481 X:2307307-2307329 CAAGAGCAGGGGAGGGAGAGGGG + Intronic
1186551355 X:10509088-10509110 CAGTAGAAGGGCAGGCAGGAAGG + Intronic
1187073544 X:15912006-15912028 CAACAGAAGGGGAAGAAGGAGGG - Intergenic
1187267321 X:17747188-17747210 CAGAAGAAGGGCAGGGATGAGGG - Intronic
1187442404 X:19332160-19332182 CAACAGAAGGCCAGTGAGGAGGG + Intergenic
1187709716 X:22040991-22041013 CAAGAGATGGAGAGGGAGAATGG + Intronic
1187731942 X:22264282-22264304 CTGGAGAATGGGAGGGAGGATGG - Intergenic
1187742232 X:22368408-22368430 CAAAAGAAGGGGATCGAGAAAGG - Intergenic
1187783540 X:22857344-22857366 GAAAAGAGGGGGAGGGAGGGAGG - Intergenic
1187882887 X:23862878-23862900 GGATGGAAGGGGAGGGAGGAGGG + Intronic
1187895087 X:23973295-23973317 CAACTAAAAGGGAGGAAGGATGG - Intergenic
1187913811 X:24134572-24134594 CAACTAAAAGGGAGGAAGGATGG - Intergenic
1188036456 X:25322929-25322951 AAAGAGGAAGGGAGGGAGGAAGG - Intergenic
1188068808 X:25694902-25694924 CAATACAAGAGGTGGGAGGACGG - Intergenic
1188070539 X:25713062-25713084 CATCAGAAGGGGAGAGACCACGG + Intergenic
1188285522 X:28322069-28322091 CAATAGAATGGGAGGCAGGTTGG + Intergenic
1188477879 X:30606004-30606026 GAACAGCAGGGGAGCGAGGATGG + Intergenic
1188891616 X:35618284-35618306 GAGAAGAAGGGCAGGGAGGATGG + Intergenic
1189314010 X:40040907-40040929 TAAAAGAAGGAGAAGGAGGAGGG - Intergenic
1189397801 X:40639129-40639151 CTATAGCAAGGGAGGGAGGAGGG + Intronic
1190110739 X:47587480-47587502 GAGAAGTAGGGGAGGGAGGATGG - Intronic
1190259617 X:48789789-48789811 CAACAGAGGTGGAGGGAGGAGGG + Intronic
1190294985 X:49021071-49021093 AAAAAGAAGGGAAGGAAGGAAGG + Intergenic
1190915115 X:54805833-54805855 GAAGAGAAGGGCAAGGAGGAGGG - Intergenic
1191799013 X:65056944-65056966 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1192582713 X:72298422-72298444 CTAGAGAAGGAGAGGGAGTAAGG - Intronic
1193018036 X:76757841-76757863 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1193224428 X:78965502-78965524 AAAGAGAGAGGGAGGGAGGAAGG - Intergenic
1193542671 X:82790584-82790606 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1194599694 X:95904962-95904984 CAACAGAAGGGGAGGAATGAAGG - Intergenic
1195870536 X:109480908-109480930 AAAAAGAAGGGAAGGAAGGAAGG + Intronic
1196030995 X:111095998-111096020 AAACTGAAGGGGAGGGAACATGG - Intronic
1196112819 X:111965108-111965130 CAAAATAAAGGGATGGAGGAAGG + Intronic
1196293036 X:113966113-113966135 GAAGGGAAGGGAAGGGAGGAAGG + Intergenic
1196893535 X:120311577-120311599 AGACTGAGGGGGAGGGAGGAGGG - Intergenic
1197001378 X:121443462-121443484 CAACAGAAGGATATGTAGGAGGG - Intergenic
1197329975 X:125141639-125141661 TAACAGAAGAGGAATGAGGAAGG + Intergenic
1197333436 X:125181700-125181722 CCACAGAAGGAGAGGGAAGGAGG + Intergenic
1197590009 X:128397061-128397083 CAAGAGGAGGGGAGGGAAGTGGG - Intergenic
1197690409 X:129494570-129494592 CTACAGAAGGAGAGGGATGCGGG + Intronic
1197886342 X:131222020-131222042 GAACATAATTGGAGGGAGGAGGG + Intergenic
1198474283 X:136980980-136981002 CAACATAAAGGGATGGAGGAAGG - Intergenic
1199117257 X:144007736-144007758 GAAGAGAAAGGGAGGGAGGGTGG + Intergenic
1199846718 X:151697024-151697046 GAAGGGAAGGGGAGGGAGGAAGG - Intronic
1200054767 X:153454503-153454525 CAGCAGCTGGGGAGGGAGGGAGG + Exonic
1200941034 Y:8782064-8782086 AAAGAGAGAGGGAGGGAGGAGGG + Intergenic
1201058035 Y:10015374-10015396 AAAGAGAAAGGAAGGGAGGAAGG + Intergenic
1201146255 Y:11066994-11067016 GAACAGAGGGAGAGGGAGGAAGG + Intergenic
1201146272 Y:11067047-11067069 GTACAGAGGGAGAGGGAGGAAGG + Intergenic
1201146552 Y:11067931-11067953 GAACAGAGGGAGAGGGAGGAAGG + Intergenic
1201256454 Y:12112663-12112685 CGAAGGAGGGGGAGGGAGGAAGG - Intergenic
1202126828 Y:21575731-21575753 CAACAAAATGTGAGGGAGGGTGG + Intergenic