ID: 948595539

View in Genome Browser
Species Human (GRCh38)
Location 2:239077067-239077089
Sequence GCATTCCAGGGTAGGATCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 142}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948595539_948595549 22 Left 948595539 2:239077067-239077089 CCCCAGATCCTACCCTGGAATGC 0: 1
1: 0
2: 3
3: 12
4: 142
Right 948595549 2:239077112-239077134 CACCTAAGCTGCCACAAGACGGG 0: 1
1: 0
2: 1
3: 6
4: 95
948595539_948595548 21 Left 948595539 2:239077067-239077089 CCCCAGATCCTACCCTGGAATGC 0: 1
1: 0
2: 3
3: 12
4: 142
Right 948595548 2:239077111-239077133 TCACCTAAGCTGCCACAAGACGG 0: 1
1: 0
2: 0
3: 6
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948595539 Original CRISPR GCATTCCAGGGTAGGATCTG GGG (reversed) Intronic
903338515 1:22640367-22640389 GCATCTAAGGGGAGGATCTGGGG + Intergenic
903409712 1:23131530-23131552 GTATTCCAGGCTAGGCACTGGGG - Intronic
903796584 1:25933550-25933572 GCAGTCCAGATTAGGATGTGAGG - Intergenic
907788577 1:57638460-57638482 GGTTTGCATGGTAGGATCTGGGG - Intronic
916823980 1:168426876-168426898 GCATTCCAGGACTGGATCTGGGG + Intergenic
919815774 1:201437881-201437903 ACAAACCACGGTAGGATCTGTGG - Intergenic
923509649 1:234639312-234639334 GCATCCCTGGGCAGGTTCTGTGG - Intergenic
1065857808 10:29844282-29844304 GCATCCCAGGCCAGGCTCTGTGG - Intergenic
1068351833 10:55857601-55857623 GCATTGCAGGCAAGGATCAGTGG + Intergenic
1069562339 10:69439584-69439606 GCATTCCGGGGAAGCAGCTGGGG - Intergenic
1072490003 10:95895924-95895946 GCATTCCAGGAAAGTATCTGAGG + Intronic
1072997794 10:100261363-100261385 ATATTCCAGGGAAGGATATGTGG - Intronic
1073592526 10:104770437-104770459 GTATTTCATGGGAGGATCTGTGG + Intronic
1074986765 10:118666375-118666397 GCATTAGAGGGTAGCATATGGGG + Intergenic
1076651895 10:131995619-131995641 GCAGTCCTGGGTAGGATCTGGGG - Intergenic
1083955226 11:65979114-65979136 AGATTCCAGGGTTGGATCTTTGG + Exonic
1087211801 11:95452728-95452750 TCAACCCAGGGTAGGATCTATGG + Intergenic
1087623248 11:100566520-100566542 GCATTCCAGGTTACCATATGGGG + Intergenic
1090633228 11:128669094-128669116 CCATTACAAGGTAGTATCTGTGG - Intergenic
1091782501 12:3222818-3222840 TCATCCCAGGGTGGGACCTGGGG - Intronic
1096905788 12:54934187-54934209 ACAAGCCACGGTAGGATCTGTGG + Intergenic
1098096472 12:66962031-66962053 GAATTCAAGGGTAGGCTCTCAGG - Intergenic
1102027724 12:109723113-109723135 GCATCCCAGGGTAGCAGCAGGGG + Intronic
1102155732 12:110726201-110726223 GCATTACAGGGTGGGAGGTGTGG - Intronic
1102892512 12:116571390-116571412 TCATTTCATGGTAGGATCAGTGG - Intergenic
1103783967 12:123418221-123418243 GCATTCCAGGACAGGAGCAGTGG - Intronic
1103945720 12:124525309-124525331 GAATTCCAGGGTAGCTTCTGAGG - Intronic
1104881997 12:132078369-132078391 CCATTGCAGGGTAGGGCCTGGGG - Exonic
1106172013 13:27296523-27296545 GCATTCCAGGGCTTGATTTGGGG - Intergenic
1106574050 13:30957734-30957756 CCCTTCCAGGGTAGGGGCTGTGG + Intronic
1107230448 13:38103925-38103947 CCCTTTCAGGGTAGGATCTGTGG - Intergenic
1111407619 13:87829698-87829720 GCAAACGAGGGAAGGATCTGAGG + Intergenic
1113224064 13:108140067-108140089 GGATTCCTGGGGAGGATATGGGG - Intergenic
1114489128 14:23086026-23086048 AAATTCCTGGGTAGGATTTGTGG + Intronic
1114598313 14:23933450-23933472 GCATAGCAGGGCAGGATGTGGGG - Intergenic
1117290413 14:54326733-54326755 GAATTCAGGGTTAGGATCTGTGG - Intergenic
1121487851 14:94332174-94332196 GCATTCCAGGGTTGATCCTGAGG + Intergenic
1121667741 14:95685923-95685945 GCATGCCAGCTCAGGATCTGGGG + Intergenic
1122875876 14:104664623-104664645 GCATCCCAGGGCAGGCCCTGGGG + Intergenic
1124080465 15:26489636-26489658 GCATTCCAGGCTGGCAGCTGGGG + Intergenic
1124106012 15:26738679-26738701 GAATTCCAAGGTAGGATGGGAGG - Intronic
1124592584 15:31066499-31066521 ACATTCCAGTGCAGGATTTGAGG - Intronic
1129051659 15:72786170-72786192 GCCTTCCAGGTCAGGATCTTGGG - Intergenic
1131156444 15:90078887-90078909 GAAGCCCAGGGTAGGATCTGGGG - Intronic
1132306286 15:100815935-100815957 GCAAGCCACAGTAGGATCTGTGG + Intergenic
1132665238 16:1078477-1078499 GCACTGCAGGGCAGGCTCTGAGG + Intergenic
1133483168 16:6191788-6191810 GCATTCCAAGGAAAGCTCTGTGG - Intronic
1135167968 16:20157181-20157203 CCATTCCAATGTAAGATCTGTGG + Intergenic
1135862736 16:26071827-26071849 GCATTCCAGGGGAGGGCCTAGGG - Intronic
1138519837 16:57564699-57564721 GCAGTCCAGGGGAGTTTCTGGGG + Intronic
1139122338 16:64035587-64035609 GCATTTCAGTGTATGAACTGGGG + Intergenic
1141733961 16:85840101-85840123 GCCTTACAGGGGAGGATCAGAGG - Intergenic
1142068254 16:88074832-88074854 GCCTTCCAGGGTAGGATGAGGGG - Intronic
1143147714 17:4787430-4787452 GCATTCCAGGAAAGGATATAAGG - Intergenic
1143302573 17:5921940-5921962 GCATTCCAGGGAGGCATTTGAGG + Intronic
1145007367 17:19345151-19345173 GCATTCCAGGCAAGGACCTGAGG + Intronic
1147268890 17:39253029-39253051 GCACTCCAGGGTAGGCCCTAAGG + Intergenic
1150879392 17:69006158-69006180 GAATTCCAGGGGATGATATGGGG - Intronic
1151309506 17:73284896-73284918 GATTTCCAGGGCAGGAGCTGGGG + Exonic
1152282129 17:79390997-79391019 GCCTTCCAGGGAAGGATCTGTGG - Intronic
1152541687 17:80979860-80979882 GCATTCCACGGGAGAAACTGAGG - Intergenic
1156853381 18:41754586-41754608 GTATTTCAGGGAAGGATGTGTGG - Intergenic
1157308150 18:46531812-46531834 GCATTCCAGGGCATCCTCTGGGG + Intronic
1157535175 18:48452526-48452548 GGGTCCCTGGGTAGGATCTGGGG + Intergenic
1160629057 18:80232768-80232790 GCATTCATGGGCAGGATCAGAGG + Intronic
1163310713 19:16512932-16512954 TTATTCCAGGGTCGTATCTGTGG + Intronic
1163550271 19:17962623-17962645 GAATACCAGGGTGGGAGCTGGGG - Intronic
1164457657 19:28421827-28421849 TCAATCCAGGGTAGGAGGTGGGG - Intergenic
1165361264 19:35338332-35338354 GCGTGCCAGGGGAGGATCTTTGG - Exonic
1166755295 19:45187126-45187148 GAATTCCAGGATAGGGACTGGGG + Intronic
926380959 2:12288772-12288794 GTTTTCCAGGTTAGGAACTGAGG - Intergenic
927311599 2:21637965-21637987 GCATTGCAGGCTAGGAAATGTGG - Intergenic
927868886 2:26610898-26610920 ACATTCCAGGGAAGGAGCTCAGG - Intronic
931647653 2:64439526-64439548 GCATTTCAGGGTAGAAGCAGAGG + Intergenic
935600032 2:104913280-104913302 GTATCCCAGGGTACCATCTGTGG + Intergenic
936066354 2:109335394-109335416 GCTTCCCAGGGTAGGGGCTGTGG - Intronic
940330036 2:152464747-152464769 GCATTCCCAGGGAGGCTCTGAGG - Intronic
942797575 2:179839882-179839904 CCCTTCCAGGGAGGGATCTGGGG + Intronic
943572976 2:189595997-189596019 GCATTTAAAAGTAGGATCTGAGG + Intergenic
944289889 2:197993380-197993402 GCATTCTTGGGTAGGATTTCTGG + Intronic
948595539 2:239077067-239077089 GCATTCCAGGGTAGGATCTGGGG - Intronic
949072811 2:242036273-242036295 GTGTTCCAGGGGAGGATGTGAGG + Intergenic
1171283045 20:23917431-23917453 GCTTTCTAGGGTAGCATATGGGG + Intergenic
1173786660 20:45798508-45798530 CCAGTCGAGGGTAGGCTCTGTGG - Intronic
1173867910 20:46324243-46324265 GCATTCCAGGGTGGGGGGTGGGG - Intergenic
1174267113 20:49339975-49339997 GCATTCCAGAGTCAGTTCTGAGG - Intergenic
1174576012 20:51537741-51537763 CCCTTCCAGGGTGGGATCAGTGG + Intronic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
1177210500 21:18065062-18065084 GCATTCATGGGTAGGCTCTGTGG + Intronic
1178979912 21:37254912-37254934 TTAATCCAGGGTAGGCTCTGGGG + Intronic
1181441649 22:22939081-22939103 TCATTGCAGGGAAAGATCTGTGG + Intergenic
1181531175 22:23518344-23518366 GCTTTGCAGGGCAGGAGCTGAGG - Intergenic
1181627133 22:24129746-24129768 GTATTCCAGGGGAGCATCAGGGG + Intronic
1182824568 22:33253734-33253756 GCACTCTAGAGTAGTATCTGAGG + Intronic
1184955689 22:47884566-47884588 GCAGGCAAGGGTGGGATCTGGGG + Intergenic
1185167700 22:49271768-49271790 GGATTACAGGTTAGGATCAGGGG - Intergenic
1185277567 22:49956442-49956464 GCATCCCAGGGTTGGGCCTGGGG - Intergenic
949376829 3:3400283-3400305 ACATTCCAGGGTAGGGTCTGGGG + Intergenic
949803566 3:7930193-7930215 TCATTCCAGGGTAGTATTTCTGG + Intergenic
950444457 3:13028300-13028322 ACCTGCCAGGGTGGGATCTGGGG + Intronic
950625797 3:14245968-14245990 TCATTCCAGGGTGTGAGCTGGGG + Intergenic
958453058 3:94297706-94297728 ACATTCCAGGGTAGACTCTATGG + Intergenic
961664587 3:128487818-128487840 GGCTTACAGGGTAGGAGCTGGGG + Intronic
965806511 3:172547698-172547720 GCATTTGAGGGAAGGCTCTGTGG + Intergenic
967355848 3:188570212-188570234 GAACTCCAGGGTAGGGTCTCAGG - Intronic
968231853 3:197009057-197009079 GCCTTGCAGTGTAGGATCCGGGG - Intronic
968984675 4:3868737-3868759 GCATTCCAGGTTCACATCTGGGG - Intergenic
972964527 4:44493268-44493290 GAATTTTATGGTAGGATCTGTGG + Intergenic
989295075 5:39816085-39816107 TCTTTCCAGGGCAGGATCAGTGG - Intergenic
992552161 5:77869089-77869111 GCATTTCTGGGAAGGATTTGGGG - Intergenic
993972140 5:94432515-94432537 GCATTCTTGGATAGGATCTTTGG + Intronic
998961084 5:147487868-147487890 AGATTCCAGGGTGGGATGTGGGG - Intronic
1001201029 5:169716966-169716988 GCATTCTAGGGTACTCTCTGGGG - Intronic
1002000028 5:176192199-176192221 GCGTTCCAGGGAAGCACCTGGGG - Intergenic
1002771832 6:296802-296824 GCATTCTAGGGCAGGATATGAGG + Intronic
1004606274 6:17197765-17197787 GCATTCCAGGCTGGGAGCAGTGG - Intergenic
1006332471 6:33401990-33402012 GCATTCCAGGCCAGGCACTGTGG - Intronic
1007007734 6:38382360-38382382 TCACTCCTGGGAAGGATCTGAGG - Intronic
1007347940 6:41247447-41247469 GCCTGCCAGGGAAGGACCTGGGG - Intergenic
1007361136 6:41356733-41356755 CCATTCCAGGGTAGGCTAAGAGG + Intergenic
1014858877 6:126438694-126438716 GCATCTCTGGGTAGTATCTGGGG - Intergenic
1015040990 6:128718562-128718584 GCATATCAGGTAAGGATCTGGGG + Intergenic
1017761741 6:157574577-157574599 GCAGTCCAGGGGAGTTTCTGTGG - Intronic
1017767970 6:157622545-157622567 GCATTCCACTGTAGCCTCTGGGG + Intronic
1018990099 6:168668147-168668169 GCATCCCAGAGGAGGAACTGAGG - Intronic
1019429171 7:990874-990896 ACATTCCAGGGCAGGGGCTGTGG + Intergenic
1026106363 7:67424073-67424095 TCCTGCCAGGGTGGGATCTGGGG - Intergenic
1032624260 7:133572715-133572737 GCATTCCAGGGAAGCTTTTGGGG + Intronic
1032948155 7:136875460-136875482 GGATTCCAGGGAAGCCTCTGAGG - Intronic
1038805801 8:30790223-30790245 GCAGTCAAGAGTAGGATGTGGGG - Intronic
1042035936 8:64533915-64533937 CCATGCCAGGGTATGATCTCAGG - Intergenic
1043459318 8:80443594-80443616 GCATTTCAGGGTTGGCTCTTTGG + Intergenic
1043647431 8:82538080-82538102 GAATTCCAGGCTGGGAGCTGTGG + Intergenic
1046651448 8:116840574-116840596 GCAACCCAGGGAAGGGTCTGAGG + Intronic
1047719729 8:127628506-127628528 GCACTTGAGGATAGGATCTGTGG - Intergenic
1047850773 8:128855005-128855027 GATTTCCAGGGTATTATCTGTGG + Intergenic
1048852911 8:138661666-138661688 CCATTCCAGGGAAGGGTCAGGGG + Intronic
1052987189 9:34496320-34496342 GCCCTCCAGGGTAGGGTCAGGGG - Intronic
1055986420 9:82059606-82059628 GCTTCCCAGGGAAGGTTCTGGGG - Intergenic
1056569253 9:87801659-87801681 TAATTCGAGGGCAGGATCTGGGG + Intergenic
1056584922 9:87921526-87921548 GCTTCCCAGGGAAGGTTCTGGGG + Intergenic
1056611959 9:88131414-88131436 GCTTCCCAGGGAAGGTTCTGGGG - Intergenic
1057210251 9:93197292-93197314 GCACTCCAGGATAGGACCTGAGG + Intronic
1057855659 9:98599110-98599132 TCATTCCTGGGTGGGATCTTTGG + Intronic
1058363557 9:104179636-104179658 GCATTCCAGTTTCTGATCTGAGG - Intergenic
1058545531 9:106057429-106057451 GCATTACAGATAAGGATCTGAGG + Intergenic
1058708688 9:107659570-107659592 GAGTTCCAGGGTAGGATCTCGGG + Intergenic
1060790656 9:126483471-126483493 GGAATCCAGGGTAGGAGCTGGGG - Intronic
1062327042 9:136017465-136017487 GCATTGCTGGGCAGGATTTGGGG - Intronic
1188876249 X:35433813-35433835 CCATTCCAGGATGGGATCTAGGG - Intergenic
1190624742 X:52326258-52326280 GCATTTCAGGGAAGGATGTTTGG - Intergenic
1191752687 X:64560306-64560328 GCAGTCCAGGGCAGGAACAGTGG + Intergenic
1192491737 X:71581478-71581500 GCATGCAAGGGTATGATATGGGG + Intronic
1193629038 X:83858749-83858771 CCATTCCTGGGTAGCATTTGTGG + Intergenic
1194423219 X:93702898-93702920 GCATTCTAGGCTAGGCACTGTGG + Intronic
1197515890 X:127428437-127428459 GCATTCCTGGTTAAGATCTAGGG + Intergenic
1198993347 X:142543000-142543022 ACATTACAAGGTATGATCTGTGG + Intergenic
1199666626 X:150101268-150101290 GCATTCTAGGGTAGTACCTTGGG + Intergenic