ID: 948596168

View in Genome Browser
Species Human (GRCh38)
Location 2:239081214-239081236
Sequence CACACGTCATGGACCCCGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 46}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948596165_948596168 -1 Left 948596165 2:239081192-239081214 CCTGTGGCCAGAAGGAGAGAAAC 0: 1
1: 0
2: 5
3: 44
4: 239
Right 948596168 2:239081214-239081236 CACACGTCATGGACCCCGAGCGG 0: 1
1: 0
2: 0
3: 1
4: 46
948596158_948596168 15 Left 948596158 2:239081176-239081198 CCGGGCCCTGTGCCCACCTGTGG 0: 1
1: 1
2: 3
3: 68
4: 580
Right 948596168 2:239081214-239081236 CACACGTCATGGACCCCGAGCGG 0: 1
1: 0
2: 0
3: 1
4: 46
948596160_948596168 10 Left 948596160 2:239081181-239081203 CCCTGTGCCCACCTGTGGCCAGA 0: 1
1: 0
2: 2
3: 36
4: 325
Right 948596168 2:239081214-239081236 CACACGTCATGGACCCCGAGCGG 0: 1
1: 0
2: 0
3: 1
4: 46
948596164_948596168 2 Left 948596164 2:239081189-239081211 CCACCTGTGGCCAGAAGGAGAGA 0: 1
1: 0
2: 1
3: 33
4: 286
Right 948596168 2:239081214-239081236 CACACGTCATGGACCCCGAGCGG 0: 1
1: 0
2: 0
3: 1
4: 46
948596161_948596168 9 Left 948596161 2:239081182-239081204 CCTGTGCCCACCTGTGGCCAGAA 0: 1
1: 0
2: 2
3: 40
4: 293
Right 948596168 2:239081214-239081236 CACACGTCATGGACCCCGAGCGG 0: 1
1: 0
2: 0
3: 1
4: 46
948596163_948596168 3 Left 948596163 2:239081188-239081210 CCCACCTGTGGCCAGAAGGAGAG 0: 1
1: 0
2: 6
3: 38
4: 296
Right 948596168 2:239081214-239081236 CACACGTCATGGACCCCGAGCGG 0: 1
1: 0
2: 0
3: 1
4: 46
948596156_948596168 21 Left 948596156 2:239081170-239081192 CCCACGCCGGGCCCTGTGCCCAC 0: 1
1: 0
2: 2
3: 16
4: 233
Right 948596168 2:239081214-239081236 CACACGTCATGGACCCCGAGCGG 0: 1
1: 0
2: 0
3: 1
4: 46
948596166_948596168 -8 Left 948596166 2:239081199-239081221 CCAGAAGGAGAGAAACACACGTC 0: 1
1: 0
2: 0
3: 11
4: 145
Right 948596168 2:239081214-239081236 CACACGTCATGGACCCCGAGCGG 0: 1
1: 0
2: 0
3: 1
4: 46
948596157_948596168 20 Left 948596157 2:239081171-239081193 CCACGCCGGGCCCTGTGCCCACC 0: 1
1: 0
2: 4
3: 63
4: 565
Right 948596168 2:239081214-239081236 CACACGTCATGGACCCCGAGCGG 0: 1
1: 0
2: 0
3: 1
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948596168 Original CRISPR CACACGTCATGGACCCCGAG CGG Intronic