ID: 948596594

View in Genome Browser
Species Human (GRCh38)
Location 2:239083311-239083333
Sequence CCTTAGGAGGAGCTGAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 624
Summary {0: 1, 1: 0, 2: 4, 3: 73, 4: 546}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948596581_948596594 15 Left 948596581 2:239083273-239083295 CCTCACACTGCTCTCTTCCCAGG 0: 1
1: 0
2: 7
3: 52
4: 542
Right 948596594 2:239083311-239083333 CCTTAGGAGGAGCTGAGGGAGGG 0: 1
1: 0
2: 4
3: 73
4: 546
948596583_948596594 -2 Left 948596583 2:239083290-239083312 CCCAGGCACTCCTACCTGCTCCC 0: 1
1: 0
2: 1
3: 42
4: 312
Right 948596594 2:239083311-239083333 CCTTAGGAGGAGCTGAGGGAGGG 0: 1
1: 0
2: 4
3: 73
4: 546
948596580_948596594 25 Left 948596580 2:239083263-239083285 CCATCAGCGACCTCACACTGCTC 0: 1
1: 0
2: 0
3: 13
4: 169
Right 948596594 2:239083311-239083333 CCTTAGGAGGAGCTGAGGGAGGG 0: 1
1: 0
2: 4
3: 73
4: 546
948596584_948596594 -3 Left 948596584 2:239083291-239083313 CCAGGCACTCCTACCTGCTCCCT 0: 1
1: 1
2: 2
3: 46
4: 424
Right 948596594 2:239083311-239083333 CCTTAGGAGGAGCTGAGGGAGGG 0: 1
1: 0
2: 4
3: 73
4: 546

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948596594 Original CRISPR CCTTAGGAGGAGCTGAGGGA GGG Intronic
900227255 1:1539227-1539249 GCTGGAGAGGAGCTGAGGGATGG - Intronic
900812373 1:4816684-4816706 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
900820214 1:4880783-4880805 CCCTGGGAGGTGCTGAGTGATGG + Intergenic
900848909 1:5126563-5126585 CCTTAGGAGCAGTTTAGGGAGGG - Intergenic
900938501 1:5782275-5782297 CCCTATGAGGAACTGAGGGAGGG + Intergenic
901702245 1:11051709-11051731 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
901929860 1:12590202-12590224 CCTCTGGAGGTGCTGAGGGTGGG + Intronic
902637790 1:17746295-17746317 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
902675331 1:18004781-18004803 ACATAGGAGGAGGTGATGGAGGG + Intergenic
903409693 1:23131274-23131296 CCATGGGAAGATCTGAGGGAAGG - Intronic
903540206 1:24092469-24092491 CCATAGCAGTATCTGAGGGAAGG + Intronic
903641491 1:24863177-24863199 CCTTGGGAGGGCCTGTGGGAAGG - Intergenic
903840312 1:26234209-26234231 CCGTTAGAGGAGCTGAGGGAGGG + Exonic
903858494 1:26351284-26351306 GCTTAGGAGGTGCTCAGCGAGGG - Intronic
903955260 1:27021188-27021210 CCTTGGTAGGACCTGAGGTAGGG - Intergenic
904286471 1:29455902-29455924 CCTTGCCTGGAGCTGAGGGAAGG + Intergenic
904303365 1:29570609-29570631 TCTTAGGAGCAGTTTAGGGAAGG + Intergenic
905145640 1:35884782-35884804 CCTTAGGATGGGCTGTGGGGTGG + Intronic
905283252 1:36862646-36862668 GCCCTGGAGGAGCTGAGGGAGGG - Intronic
905475204 1:38221478-38221500 CATTAGGAGGAGCACAAGGAAGG - Intergenic
905564539 1:38953375-38953397 CCTTAGGAGCAGTTTAGGGAAGG - Intergenic
906740300 1:48175277-48175299 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
907373649 1:54018710-54018732 CCTGAGGTGGTGCTGAGGTAGGG + Intergenic
907668351 1:56452548-56452570 GCTGAGGAGGAGCTGAGGAATGG - Intergenic
908240373 1:62184139-62184161 TCTTAGGAGCAGTTCAGGGAGGG + Intergenic
908388792 1:63666891-63666913 TCTTAGGAGCAGTTTAGGGAAGG + Intergenic
911362803 1:96900253-96900275 CCCCAGGAGAAGCTGAGAGATGG - Intergenic
911544384 1:99199347-99199369 CCTTTGGAGGCACTGAGGGAGGG + Intergenic
912410494 1:109477797-109477819 TCCTGGGAGGAGCAGAGGGATGG - Exonic
912416095 1:109509298-109509320 TTTTGGGAGGAGCTGAGGGAAGG + Intronic
912520293 1:110240417-110240439 CAATATGAGGAGCTGAGGGGAGG - Intronic
912824570 1:112894012-112894034 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
913653439 1:120939711-120939733 GCCTATGAGGAACTGAGGGAGGG - Intergenic
914167661 1:145189317-145189339 GCCTATGAGGAACTGAGGGAGGG + Intergenic
914353141 1:146857465-146857487 CCTTAGGAGGACATGTGGGCAGG + Intergenic
914519127 1:148399835-148399857 GCCTATGAGGAACTGAGGGAGGG - Intergenic
914643620 1:149633874-149633896 GCCTATGAGGAACTGAGGGAGGG - Intergenic
914727262 1:150338247-150338269 CCTAAGAAGGAGCTAAAGGAAGG + Exonic
915280689 1:154820260-154820282 CCTCAGGAGCATCAGAGGGAGGG + Intronic
915294114 1:154908117-154908139 TGTTAGGAGAAGCTGAGGCAGGG + Intergenic
915486368 1:156223796-156223818 CCTTAGCAGGGGCTCGGGGAAGG - Intronic
915917915 1:159952178-159952200 TCTTGGGAAGAGCTGGGGGAGGG + Intronic
916619337 1:166478898-166478920 CATTAGGAGTAGCAGAGTGATGG - Intergenic
917123128 1:171661697-171661719 CCTTAGAAGGAGATGTGGGTAGG + Intergenic
917805646 1:178611092-178611114 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
918307257 1:183258676-183258698 TCTTAGGAGCAGTTTAGGGAGGG - Intronic
918623631 1:186633617-186633639 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
919987587 1:202686563-202686585 CCTCAGGAGGACCTGAGAGTGGG - Intronic
920073548 1:203320960-203320982 GCTGGGGAGGAGCTGGGGGAGGG - Intergenic
920422355 1:205843704-205843726 CCTTTGGAGGAGCTGAAGAGTGG + Exonic
920701350 1:208219964-208219986 CCTGAAGAGGAGCTGTGGAAAGG + Intronic
920794197 1:209123075-209123097 CCTTAGCAGAAGCTGAGATAGGG + Intergenic
921883060 1:220275851-220275873 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
922468564 1:225861644-225861666 CCTTAGGAGCAGCACAGGGTGGG - Intronic
923958897 1:239054994-239055016 CCTTAGGAGTAGTTTAGAGAGGG - Intergenic
924809394 1:247387994-247388016 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
924951370 1:248887129-248887151 CCTTAGGATAAGCTGAGTGAAGG - Intergenic
1063236235 10:4119296-4119318 CCTTAGGAGGAAGCGATGGATGG - Intergenic
1063469990 10:6276725-6276747 CATTGGGAGAAACTGAGGGAAGG - Intergenic
1063483283 10:6395514-6395536 TCTTAGGAGCAGCTTAGGGAGGG + Intergenic
1064073091 10:12247168-12247190 CCTGAGGGGGAGGTGAGAGAGGG - Intronic
1064073159 10:12247470-12247492 CCTGAGGGGGAGGTGAGAGAGGG - Intronic
1064174515 10:13062808-13062830 TCTTAGGAGCAGTTTAGGGAGGG - Intronic
1064328912 10:14375787-14375809 TCTTAGGAGCAGTTTAGGGAGGG - Intronic
1064366682 10:14714654-14714676 CTTAGGGAGGAGCTGAGGGAGGG + Intronic
1064536456 10:16362351-16362373 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
1064759828 10:18606624-18606646 CCTTAGGAGAAACTGGGTGAAGG + Intronic
1065613433 10:27496198-27496220 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
1065851555 10:29794353-29794375 CCTCAAGAGGAGGTGAGTGAGGG + Intergenic
1066353002 10:34654715-34654737 ACTTGGGAGGAGCTGTAGGATGG - Intronic
1066792403 10:39080536-39080558 TGTTGGGAGGAGCTGAGGCAGGG - Intergenic
1067281839 10:44879260-44879282 CCCTACGGGGAGCTGAGGGAAGG - Intergenic
1067551970 10:47242614-47242636 CCTCAGGGGCAGCTGAGGGAGGG + Intergenic
1068613761 10:59089172-59089194 CCTTGGCAGCAGCTGAGGGAAGG + Intergenic
1069582849 10:69577208-69577230 CCTTAGGAGCAGGTGACGGCTGG - Intergenic
1069605375 10:69735608-69735630 CCTTAGGAGAGGCTGAGGAAGGG - Intergenic
1069646355 10:70001345-70001367 CTTGAGTGGGAGCTGAGGGAAGG - Intergenic
1070400503 10:76049216-76049238 CCTTGGAAGGAGTTGAGGGGTGG + Intronic
1071420509 10:85492642-85492664 CCTGAGGAGGGGCTGCTGGAAGG + Intergenic
1071424282 10:85532836-85532858 GCTTAGGAGCAGCTTAGAGAGGG - Intergenic
1072120557 10:92402244-92402266 TCTTAGGAGAAGTTTAGGGAGGG - Intergenic
1073063131 10:100744043-100744065 CCTCAGGAGGAGCTCAGGCCAGG - Intronic
1073939867 10:108684414-108684436 CATTAGGAGAAGCTGGGTGAAGG - Intergenic
1074695846 10:116049766-116049788 CCCAGAGAGGAGCTGAGGGATGG + Intergenic
1074968112 10:118511299-118511321 CCTGAGGAGGAGGAAAGGGAGGG + Intergenic
1075269557 10:121036641-121036663 CCCTAGGAGGGGCTGGGGGTAGG + Intergenic
1075373710 10:121959951-121959973 CCTTAGGAGGACATGAGTAATGG + Intronic
1075622438 10:123937808-123937830 CCTTTAGAGAAGATGAGGGAAGG + Intronic
1075669922 10:124257188-124257210 CCTGGGGAGGGGCTCAGGGAGGG + Intergenic
1076653352 10:132005094-132005116 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
1076659589 10:132046726-132046748 CCTTAGGAGAACCTGGGTGAAGG - Intergenic
1077286692 11:1769393-1769415 TCTTAGGAGCAGTTGAGAGAGGG - Intergenic
1077933239 11:6755047-6755069 CCTTAGGAGGAGGTGTGAGATGG + Intergenic
1078062244 11:8055707-8055729 CTTCAGGTGGAGCTGAGGGCTGG + Intronic
1078244980 11:9565819-9565841 CCTTTGCAGGAGCTGGGAGAGGG - Intergenic
1078385625 11:10889578-10889600 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
1080571326 11:33559644-33559666 GCTAAGCAGGAGTTGAGGGAAGG - Intronic
1081597158 11:44467219-44467241 CTCGGGGAGGAGCTGAGGGAAGG + Intergenic
1081853960 11:46292210-46292232 ACTAGGGAGGAGCCGAGGGAAGG + Intronic
1081972516 11:47209658-47209680 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
1082030371 11:47599185-47599207 GCGTAGGTGGAGCTTAGGGAAGG + Intergenic
1082789285 11:57335957-57335979 ACTCTGGAGGACCTGAGGGAAGG + Intergenic
1082867490 11:57913086-57913108 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
1083053282 11:59795833-59795855 CTCTAGGAAAAGCTGAGGGAGGG - Intronic
1083504441 11:63142621-63142643 TCTTAGGAGCAGTTTAGGGAGGG - Intronic
1083505991 11:63157803-63157825 TCTTAGGAGCAGTTTAGGGAGGG - Intronic
1083889854 11:65590284-65590306 CCTTGGGAGGAGCTGGGAGGAGG + Intronic
1084181226 11:67447422-67447444 CCTTAGGAGCAGTTTAGGGAGGG - Intergenic
1084308072 11:68299413-68299435 CCTTAGCAGGAGGTGAGGGCGGG + Intergenic
1084674078 11:70624146-70624168 CCTCAGGAGGGGCTGAGGCCGGG + Intronic
1084888373 11:72224647-72224669 CCGCAGGAGGAGCTGGGGGCAGG + Intronic
1085019520 11:73196713-73196735 CCTCTGGAGCAGCTGGGGGAAGG - Intergenic
1085130485 11:74033834-74033856 CCTGACGAGGTGCAGAGGGAAGG - Exonic
1086129883 11:83390170-83390192 CCTGAGGAGTGGCTAAGGGATGG + Intergenic
1086834961 11:91609411-91609433 CCTGAGGAGGACCTGAGGCCTGG + Intergenic
1087161889 11:94957169-94957191 GCTTAGGAGGAGCTGCCGCAAGG + Intergenic
1087797869 11:102473293-102473315 TCTTAGGAGCAGTTTAGGGAGGG + Intronic
1087913251 11:103777637-103777659 GGTTATGAGGAGCTGAGGGAGGG + Intergenic
1088253346 11:107880570-107880592 TTTTAGGAGTAGTTGAGGGAGGG - Intronic
1088391824 11:109322901-109322923 CATTAGAAGAAGCTGAGTGAAGG - Intergenic
1088819474 11:113445352-113445374 CTTTAGGGGAAGCTGAGTGAAGG + Intronic
1089286162 11:117409468-117409490 CCTTATGAGGGGGTCAGGGATGG - Intronic
1089438456 11:118493102-118493124 CCTTCGGGGGAGCTGCGGGAAGG - Exonic
1089685397 11:120143484-120143506 CCTTAGAAGGAGCCAAGGGTAGG - Intronic
1089712569 11:120325997-120326019 CTTTAGAAGGAGATAAGGGAGGG + Intronic
1090813108 11:130265103-130265125 CCTGAGGAGGAGGAGAGAGATGG - Intronic
1093181822 12:15975426-15975448 TCTTAGGAGCAGTTTAGGGAGGG + Intronic
1093691438 12:22114056-22114078 CCTTAGGAGCAGTTTAGGAAGGG - Intronic
1094744357 12:33327812-33327834 CCTTAGCTCGAGTTGAGGGATGG - Intergenic
1095666987 12:44814140-44814162 CCTCAGGAGGAGCAGATGGAGGG + Intronic
1096161710 12:49384009-49384031 CATTAGGGGAAGCTGAGAGAAGG - Intronic
1096353439 12:50918848-50918870 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
1096817548 12:54210948-54210970 GCTAAGGAGGGGCTGAGGGGTGG - Intergenic
1096830128 12:54307349-54307371 TCTAAGGAGGAGCAGAGGGTGGG - Intronic
1096939639 12:55328101-55328123 TCTTAGGAGTAGTTTAGGGAGGG - Intergenic
1097229193 12:57498813-57498835 CTGAAGGAGCAGCTGAGGGAGGG + Intronic
1098188515 12:67923760-67923782 GCATAGGAGGAAATGAGGGAAGG - Intergenic
1098765701 12:74486194-74486216 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
1098985852 12:77011145-77011167 GCCTAGCGGGAGCTGAGGGATGG + Intergenic
1099176341 12:79427218-79427240 CCTGATGAGAAGCTCAGGGAGGG + Intronic
1101149610 12:101872544-101872566 TCTTAGGAGTAGTTTAGGGATGG - Intergenic
1101224332 12:102672528-102672550 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
1101603625 12:106231720-106231742 CCCTAGGAGAAGTGGAGGGAGGG + Intergenic
1102075386 12:110055891-110055913 TCTTAGGAGCAGTTTAGGGAGGG + Intronic
1103242786 12:119428901-119428923 CCCTGGGAGGAGCAGAGGGCAGG + Intronic
1103555786 12:121765777-121765799 CCTGAGGAGGAGCTGGAGGAGGG - Intronic
1103596353 12:122026597-122026619 CCTCTGGAGGAGCTGAGGTGAGG - Intronic
1103965480 12:124636517-124636539 CTTTAGGAGCAGTTTAGGGAGGG + Intergenic
1104128241 12:125867798-125867820 TCTTAGGAGCAGTTTAGGGAAGG + Intergenic
1104320395 12:127745336-127745358 TCTTAGGAGGAGTTTAGGGAGGG + Intergenic
1104326928 12:127808012-127808034 CCTTGCGAGGAGCAGATGGAAGG - Intergenic
1104340477 12:127944164-127944186 TCTTAGGGGCAGCTTAGGGAGGG + Intergenic
1104355593 12:128082489-128082511 TCTTAGGGGCAGCTTAGGGAGGG - Intergenic
1104541522 12:129670376-129670398 TCTTAGGGGCAGCTTAGGGAGGG - Intronic
1104685724 12:130782832-130782854 CCTGAGGTGGAACTGAGGGGAGG - Intergenic
1104852765 12:131885407-131885429 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
1105210662 13:18254954-18254976 CCTGAGGAGGTGGGGAGGGAGGG + Intergenic
1105633310 13:22193452-22193474 CCTCAGGAGGAGGTGAAGAAAGG + Intergenic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1106139602 13:27001199-27001221 CCTTCTGAGGCTCTGAGGGAAGG - Intergenic
1106466795 13:30020987-30021009 CTTTGGGAGAAGCTGAAGGACGG + Intergenic
1106508043 13:30388654-30388676 CCTTAGGGGAAGCCGAGTGAGGG + Intergenic
1106717660 13:32407949-32407971 CCTTAGCAGGAGATGGGAGAGGG + Intronic
1107238315 13:38199897-38199919 CTTTAGGAAGATATGAGGGAAGG + Intergenic
1107795982 13:44052310-44052332 CATCAGGAAGAGATGAGGGAAGG - Intergenic
1107868642 13:44727651-44727673 TCTTAGGAGGAGTTTAGGGAGGG - Intergenic
1108805315 13:54147924-54147946 TCTTAGGAGCAGTTTAGGGAAGG + Intergenic
1109300329 13:60584337-60584359 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
1109958941 13:69605563-69605585 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
1110094825 13:71504507-71504529 CGTTAGGAGGAACTGAGGAAAGG + Intronic
1110122905 13:71905362-71905384 CCTTAGGAGGAGAGGAAGAAAGG - Intergenic
1111858298 13:93668709-93668731 CCTCAGGAGGCTCTTAGGGAAGG - Intronic
1112226361 13:97544446-97544468 CCATAGAAGGAGCTGTGGAAGGG - Intergenic
1113161145 13:107382480-107382502 CATTAGGAGAAGCTGAGTGAAGG - Intronic
1113701114 13:112389004-112389026 TCTTAGGAGCAGTTTAGGGAGGG + Intronic
1113872092 13:113565663-113565685 TCTTGGGAGGGTCTGAGGGAAGG - Intergenic
1114139281 14:19893158-19893180 CCTTAGGAACAGTTTAGGGAGGG + Intergenic
1114235737 14:20822029-20822051 TCTTAGGAGGAGTTTAGGGAGGG + Intergenic
1114446658 14:22793875-22793897 TCTTAGGAGCAGTTTAGGGAAGG - Intronic
1114482723 14:23045534-23045556 CCTTAGGAGAGTCTTAGGGAGGG + Intergenic
1115893518 14:38059077-38059099 TCTTAGGAACAGTTGAGGGAAGG - Intergenic
1117817214 14:59610805-59610827 TCTTAGGAGCAGTTTAGGGAGGG - Intronic
1117818001 14:59618281-59618303 TCTTAGGAGCAGTTTAGGGAGGG - Intronic
1118273502 14:64364959-64364981 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
1118595205 14:67430115-67430137 CCTTGGTTGGAGCTGAGGCACGG + Intergenic
1119040509 14:71270118-71270140 GCTTGGGAGGGGCTGGGGGAGGG + Intergenic
1119265823 14:73262805-73262827 CTGTAGGAGGAGCTGTGGAAGGG - Exonic
1119529845 14:75352431-75352453 CCTTTGCAGCAGGTGAGGGAGGG + Intergenic
1119629335 14:76213752-76213774 CATTAGAAGAAGCTGAGAGAAGG - Exonic
1119732750 14:76961535-76961557 CATTAGGAGGAAAAGAGGGATGG + Intergenic
1119823777 14:77640818-77640840 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
1121500606 14:94434005-94434027 GCTGAGGAGGAGTTGTGGGAGGG - Intergenic
1121558738 14:94858389-94858411 CTTTTGGAGGAGCTCAGGGAAGG + Intergenic
1121817032 14:96936446-96936468 GCTGAGGAGGAGATGAGAGAAGG - Intergenic
1122380232 14:101298348-101298370 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
1123043521 14:105500164-105500186 CCTTAGGAGGAGCTGGCGGAGGG - Intergenic
1123828040 15:24102901-24102923 CCTCTGGAGTAGTTGAGGGAAGG + Intergenic
1123842494 15:24262315-24262337 CCTCTGGAGTAGTTGAGGGAAGG + Intergenic
1123857529 15:24428374-24428396 CCTCTGGAGTAGTTGAGGGAAGG + Intergenic
1123862159 15:24478902-24478924 CCTCTGGAGTAGTTGAGGGAAGG + Intergenic
1124603676 15:31154722-31154744 TCTTAGGAGCAGTTTAGGGAGGG - Intronic
1125690699 15:41593839-41593861 CCTTAGGAGCAGTTTAGGGAGGG + Intergenic
1126637128 15:50790201-50790223 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
1127086323 15:55427586-55427608 TCTTAGGAGCAGTTTAGGGAGGG + Intronic
1127559359 15:60120353-60120375 CGTGTGGGGGAGCTGAGGGAGGG + Intergenic
1128058258 15:64716973-64716995 CCTCAGGAGGATCTGGGGAAGGG - Intergenic
1128350966 15:66888181-66888203 TCTTAGGAGTAGTTTAGGGAGGG + Intergenic
1128792543 15:70443704-70443726 CCTCCGGAGGTGCTGGGGGAGGG - Intergenic
1129138739 15:73577672-73577694 TCTTAGGAGCAGTTTAGGGAGGG - Intronic
1129378425 15:75150113-75150135 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
1130837837 15:87669176-87669198 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
1130999661 15:88929732-88929754 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
1131513728 15:93064062-93064084 CCCCAGGAGGAACTGGGGGATGG - Intronic
1132206248 15:99988024-99988046 CCTGAGGCTGAGCTGGGGGAAGG - Intronic
1132275971 15:100564279-100564301 ACTTAGGAGCAGTTTAGGGAGGG - Intronic
1132529393 16:438107-438129 TCTCAGGAGGAGGTGGGGGAAGG - Intronic
1132599778 16:768320-768342 CCTCTGGCGGCGCTGAGGGAAGG + Intronic
1132605161 16:790568-790590 CCTGAGGAGGAGCCGACTGACGG + Exonic
1132663181 16:1070554-1070576 CCTTTGGAGGAGCGGAGGGAGGG + Intergenic
1132834174 16:1944263-1944285 TCTTAGGGGCAGCTTAGGGAGGG - Exonic
1133694099 16:8244312-8244334 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
1135055786 16:19231220-19231242 ACTTAGGGGAAACTGAGGGAGGG - Intronic
1135965715 16:27033343-27033365 TCTTAGGGGCAGCTTAGGGAGGG - Intergenic
1136615057 16:31393489-31393511 TCTTATGAGGAGCTGAGGCAGGG + Intronic
1136673388 16:31877510-31877532 TCTTAGGAGGGGCTTAGGGAGGG + Intronic
1137847595 16:51706950-51706972 CATTAGGAGAAGCTGAGTGAAGG + Intergenic
1138544931 16:57711951-57711973 TCTTAGGAGCAGTTTAGGGAGGG + Intronic
1139284262 16:65796900-65796922 CAGGAGGAGGAGGTGAGGGAGGG - Intergenic
1139670662 16:68490842-68490864 TATTAGGAGGAGGTGAGGGAGGG + Intergenic
1139980883 16:70858053-70858075 CCTTAGGAGGACATGTGGGCAGG - Intronic
1140096866 16:71883577-71883599 CCTTGGGTGGAGCTGGGGGAGGG - Intronic
1141335732 16:83153379-83153401 CCTTAGGAGCAGTTTAGGGAGGG + Intronic
1142165540 16:88585550-88585572 TCGTAGGGGGAGCTCAGGGAAGG + Intronic
1142219905 16:88848986-88849008 CGTTAGGAGGGGCTGAGGCAAGG - Intronic
1142228978 16:88890561-88890583 CTCTAGCAGGAGCTGAGGAAAGG - Intronic
1142827829 17:2525321-2525343 CCTTGGGAGGAGCTGGGGCAAGG - Intergenic
1142965283 17:3577230-3577252 GCCCAGGAGGAGCTGAGGGAAGG + Intronic
1143174597 17:4948933-4948955 CCTTCGGCGGAGGTGGGGGAAGG - Exonic
1143222221 17:5272247-5272269 TCTTAGGAGCAGTTTAGGGAAGG - Intergenic
1143274282 17:5698692-5698714 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
1144355958 17:14446595-14446617 TCTTAGGAGTAGCTGAGAGGAGG - Intergenic
1144556132 17:16284531-16284553 TCTTAGGAGCAGTTTAGGGAGGG - Intronic
1147184787 17:38707200-38707222 CCTGAGGTGGGGCAGAGGGAGGG - Intronic
1147216353 17:38901370-38901392 CCTCTGCAGGAGCTGGGGGAAGG + Intronic
1147282858 17:39377144-39377166 TCTTAGGAGCAGTTTAGGGAGGG - Intronic
1147424455 17:40339357-40339379 CCTGAGAAGGAGCTGAGGGAGGG + Intronic
1147841674 17:43376206-43376228 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
1148649867 17:49242444-49242466 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
1148812456 17:50302389-50302411 CCTTGGTAGAAGCTGATGGAGGG + Intergenic
1149335439 17:55630750-55630772 GCTTAAGGGGAGATGAGGGAAGG - Intergenic
1150348597 17:64423946-64423968 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
1150600870 17:66649845-66649867 CCTTGGGAGGTACTGAGGGTGGG + Intronic
1151288178 17:73128554-73128576 CCTTAGGAACAGCAGTGGGAAGG + Intergenic
1151918704 17:77138206-77138228 TCTTAGGAGCAGTTTAGGGAGGG + Intronic
1151979368 17:77499508-77499530 CTGGTGGAGGAGCTGAGGGAGGG + Exonic
1151992383 17:77584351-77584373 CATTAGGAGAAGCTGGGTGAAGG - Intergenic
1152290782 17:79438802-79438824 CCCGAGCAGGAGCTGAGGGGAGG + Intronic
1152393887 17:80020127-80020149 CCTTAGGAGGCTGTGAGGGAGGG - Intronic
1152438244 17:80289028-80289050 TCTTAGGAGGTGGTGAGGGATGG + Intronic
1152816199 17:82409368-82409390 CCCTGGGAGGATCTGACGGAGGG - Exonic
1152920310 17:83063250-83063272 CCTTAGGATGGGGTGTGGGAGGG + Intergenic
1153100951 18:1468995-1469017 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
1153181635 18:2441767-2441789 CCTGAGGAGGAACAGAGGGCTGG - Intergenic
1155618496 18:27748459-27748481 ACTTAGGAGGAAGAGAGGGAGGG - Intergenic
1155963013 18:32010641-32010663 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
1155994054 18:32311588-32311610 CCTTTGGTGTAGGTGAGGGAGGG + Intronic
1157124534 18:44943698-44943720 CCTCAGCAGGAGCTGAGTGTGGG - Intronic
1157167895 18:45375304-45375326 TCTTAGGAGCAGTTTAGGGAGGG - Intronic
1157496951 18:48162942-48162964 CAGTAGGAAGGGCTGAGGGAGGG + Intronic
1158608261 18:58915418-58915440 CCTTAGGTGGAGTAGAGGGATGG + Intronic
1159580509 18:70230157-70230179 TCTTAGGAGCAGTTAAGGGAGGG + Intergenic
1159596190 18:70384830-70384852 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
1159655229 18:71024969-71024991 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
1159797783 18:72865842-72865864 GCTTAGAAAGTGCTGAGGGACGG - Intronic
1160201074 18:76795866-76795888 TCTTAGGAGCAGCTTAGGGAGGG - Intronic
1160509713 18:79446612-79446634 TCTTCCGAGGAGCTGAGGGCTGG + Intronic
1160568091 18:79798982-79799004 CCTTTGGAGGAGGTGACAGAGGG - Intergenic
1160689524 19:454990-455012 CTTTATGAGAAGCTGAGTGAGGG - Intronic
1161351394 19:3794068-3794090 CCTTGAGAAGAGCTGGGGGAAGG - Intronic
1161410110 19:4112386-4112408 CATGAGGAGGAGATGGGGGAGGG + Intronic
1163144334 19:15370430-15370452 GCTTAGGAGGAACCGAGAGAGGG - Intronic
1163431305 19:17269295-17269317 CCTCAGGAGGCTCTAAGGGAGGG + Intronic
1163676083 19:18655970-18655992 CCTGAGGAGCAGGTGAGGGGTGG + Intronic
1164003431 19:21127968-21127990 CCTTAGGATGACCTGAAGTATGG - Intergenic
1164027039 19:21361760-21361782 CCATAGGACGACCTGAGGTATGG + Exonic
1164523723 19:28998413-28998435 CCCTAGCAGGAGAGGAGGGAGGG + Intergenic
1164617950 19:29677820-29677842 CCTTGGAAGGAGCTGAGGATGGG - Intergenic
1164754205 19:30677967-30677989 CCTTGGGAGGAGAAGAGGCAGGG + Intronic
1164888606 19:31804259-31804281 GCCTATGAGGAGCTGGGGGAGGG + Intergenic
1165602346 19:37065374-37065396 GGTTAGGAGAAGCTGAGGCAGGG - Intronic
1165764085 19:38339474-38339496 TGTTAGGAGAAGCTGAGGCAGGG - Intronic
1165802610 19:38562237-38562259 GCATAGGAGGAGCTGAGATAGGG - Intronic
1165853579 19:38866161-38866183 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
1166146852 19:40843977-40843999 CCTGAGGAGGAGAGGCGGGAGGG + Exonic
1166148301 19:40852047-40852069 CCTTAGCAGGAGGTGAGTGCTGG + Intronic
1166151013 19:40875874-40875896 CCTGAGGAGGAGAGGCGGGAGGG + Exonic
1166155508 19:40908653-40908675 CCTGAGGAGGAGAGGCGGGAGGG + Intergenic
1166523169 19:43495002-43495024 CCTGAGGAGGGGCTGGGGGCTGG + Intronic
1166820751 19:45578287-45578309 TCTTAGGAGCAGTTTAGGGAGGG - Intronic
1166821425 19:45582768-45582790 TCTTAGGAGCAGTTTAGGGAGGG + Intronic
1167115823 19:47488499-47488521 TCTGAGGAGGAGTAGAGGGAGGG + Intronic
1167276070 19:48540421-48540443 CCTTTGAAGGAGGTGAGGAAAGG - Intergenic
1167578243 19:50328013-50328035 TCTTTGGAGGATCTGGGGGATGG + Intronic
1167805878 19:51784953-51784975 TCTTAGGAGCAGTTTAGGGAGGG - Intronic
1168043205 19:53775470-53775492 CCTTGGCAGCAGCTGAGGAAAGG - Intergenic
1168709278 19:58489244-58489266 TCTTAGGAGCAGTTGAGGGAGGG - Intronic
925204236 2:1992860-1992882 TCTTAGGAGCAGCTTAGGGAGGG - Intronic
926341000 2:11904295-11904317 CACTAGGAGGAGCTCAGAGAGGG - Intergenic
926484116 2:13433648-13433670 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
926707039 2:15844235-15844257 CCTCAGGTGGAACTGATGGATGG + Intergenic
926720196 2:15954389-15954411 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
927847713 2:26479968-26479990 CTGTAGGTGGAGCTGAGGGTTGG + Intronic
928193080 2:29192028-29192050 CCCTAGGAGGCGATGAGGAAAGG - Intergenic
928253124 2:29699239-29699261 CGCCAGGAGGGGCTGAGGGAAGG - Intronic
929550821 2:42890600-42890622 TCTTAGGAGCAGCTTAGGGAGGG - Intergenic
929868467 2:45737764-45737786 CCCCAGGTGGAGGTGAGGGAGGG - Intronic
930040405 2:47118136-47118158 TCATAGGAGGAGGTGAGGGGTGG + Intronic
930172562 2:48266657-48266679 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
930802758 2:55459814-55459836 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
932908872 2:75784533-75784555 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
933287690 2:80402079-80402101 AATTAGGTGGACCTGAGGGAGGG - Intronic
934670957 2:96212487-96212509 TCTTAGGAGCAGTTCAGGGAGGG - Intergenic
935671007 2:105557200-105557222 CCTGAGAAGGAGCTGTGGGGTGG - Intergenic
936780632 2:116028772-116028794 TCTTAGGAGCAGTTCAGGGAGGG - Intergenic
937324218 2:120979754-120979776 AATTAGGAGGGGCTGTGGGAAGG - Intronic
937324225 2:120979781-120979803 AATTAGGAGGGGCTGTGGGAAGG - Intronic
937387392 2:121448160-121448182 CCTAAGAAGGAACTGAGGGCAGG + Intronic
937922720 2:127143228-127143250 CCTTTGGAGGAGCAGAAGGATGG - Intergenic
938716232 2:134024429-134024451 ACTTAGCAGGATCTCAGGGAGGG + Intergenic
940479710 2:154212715-154212737 CCTTAGAAGGAGAAGAAGGATGG - Intronic
942247615 2:174022447-174022469 CTTTAGGTGAAGCTGAGTGAAGG + Intergenic
944301390 2:198128635-198128657 TCTTAGGAGCAGTTTAGGGAGGG + Intronic
946734290 2:222739066-222739088 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
947114250 2:226751747-226751769 AGTTAGGAGGAACTGAGGTAGGG + Intronic
947519991 2:230838225-230838247 TCTTAGGAGAAGTTTAGGGAGGG - Intergenic
947802726 2:232941266-232941288 TCTTAGGAGCAGTTTAGGGAGGG + Intronic
947817133 2:233045140-233045162 TCTGATGAGGAGATGAGGGAAGG - Intergenic
947889094 2:233600687-233600709 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
947987794 2:234463714-234463736 TCCTGGAAGGAGCTGAGGGAGGG + Intergenic
948006661 2:234615151-234615173 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
948454154 2:238097001-238097023 CCCTAGGAGGGGCAGAGGGAGGG + Intronic
948596594 2:239083311-239083333 CCTTAGGAGGAGCTGAGGGAGGG + Intronic
948616713 2:239203965-239203987 CCTAACCAGGAGCTGTGGGAAGG - Intronic
1168941833 20:1719279-1719301 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
1169016918 20:2299566-2299588 TCTTGGTAGGAGCTGAGAGATGG + Intronic
1169464197 20:5823175-5823197 CAGGAGGAGAAGCTGAGGGAGGG - Intronic
1170440810 20:16377190-16377212 CCTTAGGAGGTGCTGTGGGTGGG + Intronic
1171059321 20:21940780-21940802 CCTCATGGGGAGCTGGGGGAAGG + Intergenic
1171519002 20:25761326-25761348 CCTCAGAAGAAGCAGAGGGAGGG - Intergenic
1171878258 20:30598154-30598176 CCTTAGGAGGGGAGGAGGGCAGG - Intergenic
1172100759 20:32483186-32483208 CCTTTGCCGGGGCTGAGGGAGGG - Intronic
1172198666 20:33110002-33110024 CATTAGGGGGAGCTGGGAGAAGG - Intronic
1172278473 20:33694127-33694149 GCTTTGGAGGGGGTGAGGGAGGG - Intergenic
1172801585 20:37579968-37579990 GCTTAGGAAGAACTGAGAGAGGG - Intergenic
1173163500 20:40669982-40670004 CCTTAGGAGGAGCTGGCCCAGGG + Intergenic
1173464663 20:43271499-43271521 CCTGAGGAGAAGTGGAGGGAGGG - Intergenic
1174568849 20:51486628-51486650 CCGTCGGAGGTGCTGAGGCATGG - Intronic
1175028758 20:55931118-55931140 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
1175200979 20:57277535-57277557 GCCTAGGAGGAGCAGGGGGAGGG + Intergenic
1175239540 20:57536765-57536787 CATTAGGAGAAATTGAGGGAAGG - Intergenic
1175703298 20:61156329-61156351 CCTTTGTTGGAGCTGGGGGAGGG - Intergenic
1175750711 20:61495341-61495363 CCCCAGGAGGAGCTGTGGGAGGG + Intronic
1175787478 20:61721034-61721056 CCTCGGGAGGAGCTCAGGGCAGG - Intronic
1175960926 20:62636022-62636044 CCTGAGGAGGGGCTGGGGCATGG + Intergenic
1176141555 20:63547290-63547312 CGCAAGGAAGAGCTGAGGGAAGG + Exonic
1178624153 21:34201735-34201757 GATTAAGAGGAGGTGAGGGAGGG + Intergenic
1179289540 21:40006435-40006457 ATTTAGAAGGACCTGAGGGAAGG + Intergenic
1180780724 22:18517931-18517953 CCTGAGGAGGTGGGGAGGGAGGG + Exonic
1180934586 22:19616741-19616763 CTTTATGAGGAACTGGGGGAGGG + Intergenic
1181199619 22:21209568-21209590 CCTGAGGAGGTGGGGAGGGAGGG + Intronic
1181277390 22:21695339-21695361 AGTCAGGAGGGGCTGAGGGAGGG + Intronic
1181400141 22:22646290-22646312 CCTGAGGAGGTGGGGAGGGAGGG - Intronic
1181649223 22:24249500-24249522 CCTGAGGAGGTGGGGAGGGAGGG + Intergenic
1181702113 22:24627388-24627410 CCTGAGGAGGTGGGGAGGGAGGG - Intronic
1182094809 22:27618929-27618951 CCTTCGGTGGGGCTGAGGAAAGG - Intergenic
1182488226 22:30652321-30652343 TCTTAGGAGCAGTTTAGGGAAGG + Intronic
1182500091 22:30740368-30740390 TCTTAGGAGCAGTTTAGGGAGGG + Intronic
1183310649 22:37107766-37107788 CCTTTGGAGGAGGTAAAGGAGGG - Intronic
1183311477 22:37112221-37112243 CCACAGGAGAAGGTGAGGGAAGG - Intergenic
1183500100 22:38173648-38173670 CCCCTGGAGGAGCTGAAGGACGG + Intronic
1183799569 22:40150628-40150650 CCTCAGGAAAAGCTGAGGGTGGG + Intronic
1183806956 22:40219740-40219762 CCTTCGGATAAGGTGAGGGAAGG - Intronic
1184105890 22:42367446-42367468 CCTTAGGAGGATATCAGAGAGGG - Intergenic
1184385277 22:44170682-44170704 CCTGGGAAGGAGCTGGGGGAGGG - Intronic
1185136480 22:49076249-49076271 CCGCAGGAGGTGGTGAGGGAAGG + Intergenic
1185161150 22:49230512-49230534 TCCTAGGAGGAGGTGAAGGAGGG + Intergenic
1185405165 22:50643625-50643647 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
1185405187 22:50643824-50643846 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
1185405192 22:50643863-50643885 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
1185405202 22:50643941-50643963 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
949201045 3:1379690-1379712 CCTGAGGAGGAGGTGGGGGGTGG + Intronic
949347352 3:3089082-3089104 CCTAGGGAGGAGGGGAGGGAGGG + Intronic
949993599 3:9599646-9599668 TCTTAGGAGCAGTTCAGGGAGGG + Intergenic
950511794 3:13433685-13433707 CCTTAGGAGCAGTTTAGGAAGGG - Intergenic
950887646 3:16375144-16375166 CCTTAGGGGGCTCTGAGAGAAGG + Intronic
951867824 3:27327164-27327186 ACTTAGGTGGAGGGGAGGGATGG - Intronic
953613483 3:44468547-44468569 TCTTAGGAGCAGTTTAGGGAGGG - Intronic
953983539 3:47424891-47424913 CCTGAGGACAAGCCGAGGGAAGG + Intronic
955393612 3:58538745-58538767 CCTTAGAAGAAGCTGAGTGAAGG - Intergenic
957725936 3:84067273-84067295 TCTTAGGAGGAGTTTAGGGAGGG + Intergenic
958698133 3:97553317-97553339 CCTTGTGAGGACATGAGGGAAGG - Intronic
959009232 3:101055537-101055559 CCCTAGTAGGAGATGAGGGGAGG + Intergenic
960006566 3:112787304-112787326 TCTTAGGAGCAGGTTAGGGAGGG - Intronic
960438617 3:117658839-117658861 CCAGAGAAGGAGATGAGGGAAGG - Intergenic
960556925 3:119040120-119040142 TCTTAGGAGCAGTTTAGGGAGGG - Intronic
960609534 3:119542882-119542904 TCTTAGGAGCAGTTTAGGGAGGG - Intronic
962472854 3:135728621-135728643 TCTTAGGAGCAGTTTAGGGAAGG + Intergenic
964752909 3:160068621-160068643 CCTTGGGAGGCGATTAGGGATGG + Intergenic
965087996 3:164124407-164124429 CCTTAGGAGTAGTTTAGGGAGGG + Intergenic
965347732 3:167572920-167572942 CCTGAGGAGAAGCAGAGGTAGGG + Intronic
966495479 3:180575433-180575455 CCTTAAGTGGAGCTGAGGTGAGG - Intergenic
966734803 3:183179968-183179990 CCTGAGGAGGGGGAGAGGGATGG + Intronic
966757402 3:183384426-183384448 TCTTAGGAGCAGTTTAGGGAGGG - Intronic
966843764 3:184110314-184110336 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
966924447 3:184635276-184635298 CCTTAGCAGGCGCTGAGTGAAGG + Intronic
966934878 3:184699614-184699636 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
967210068 3:187160373-187160395 CCTTAGGAGCACTTTAGGGAGGG + Intronic
968135097 3:196215259-196215281 CCTAAGGTGGAGGTCAGGGAAGG - Intronic
969575819 4:8035131-8035153 CAGTGGGGGGAGCTGAGGGAAGG - Intronic
969889205 4:10243968-10243990 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
970529232 4:16965261-16965283 CTACAGCAGGAGCTGAGGGATGG - Intergenic
970579390 4:17460935-17460957 TCTTAGGAGCAGTTTAGGGAGGG + Intronic
970649978 4:18167012-18167034 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
971228952 4:24782104-24782126 CCTTAGGAGGAAGAGAAGGATGG - Intergenic
972185410 4:36522098-36522120 ACTTAGGGGGAAGTGAGGGAGGG + Intergenic
972350880 4:38235167-38235189 CCTTGGGAAGAGCAGAGGCAGGG + Intergenic
972358307 4:38303352-38303374 CTATAGGGGGAGCTGAGGGCAGG - Intergenic
973581819 4:52351629-52351651 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
973595660 4:52486564-52486586 ACATAGCAGGAGGTGAGGGAGGG - Intergenic
973925193 4:55729885-55729907 CCTTAGGAAAAGGTGAGGGAGGG - Intergenic
974387717 4:61224755-61224777 CCTTGGCAGGACCCGAGGGAAGG + Intronic
974427693 4:61761143-61761165 TCTTAGGAGTAGTTTAGGGAGGG + Intronic
976127276 4:81847448-81847470 CCTGAGGAGGAGATGTGGGCAGG - Intronic
977024660 4:91802129-91802151 CCTCAGGAGAAGGAGAGGGATGG - Intergenic
977527641 4:98164256-98164278 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
977668751 4:99671229-99671251 CCTTATGAGGTGCTGTGGAATGG - Intergenic
978763752 4:112382978-112383000 CCCTAGGTGGGGCTCAGGGAAGG - Intronic
978939721 4:114421737-114421759 CCTTAAGGGGAGCTGAGGCTGGG - Intergenic
978942944 4:114459358-114459380 CCTTAAGTGGAGATCAGGGATGG - Intergenic
980497081 4:133600064-133600086 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
981702850 4:147626130-147626152 TCTTAGGAGCAGTTTAGGGAGGG + Intronic
981763984 4:148226989-148227011 CATTTGGAGAAGCTGAGTGAAGG - Intronic
981948373 4:150376475-150376497 CATTAGGGGAAGCTGAGTGAAGG - Intronic
982867918 4:160541154-160541176 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
983790568 4:171792768-171792790 CATCAGGAAGAGGTGAGGGAAGG + Intergenic
984701918 4:182824033-182824055 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
984849725 4:184143358-184143380 TCATAGGAAGAGCTGAGGCAAGG + Intronic
986081755 5:4401795-4401817 CATGAGGAGGCCCTGAGGGAGGG - Intergenic
988776305 5:34480746-34480768 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
989010762 5:36869487-36869509 TCTTAGGAGCAGGTTAGGGAGGG + Intergenic
989759073 5:44990097-44990119 CCTTATGGGAAGCTAAGGGATGG - Intergenic
990947346 5:61262918-61262940 TCTTAGGAGTCGCTGAAGGAAGG - Intergenic
991496615 5:67233079-67233101 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
991674650 5:69078974-69078996 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
993421972 5:87714075-87714097 TCTTAGGAGCAGTTTAGGGAAGG + Intergenic
995255413 5:110040345-110040367 CAGTAGGAGGAGCTGGGAGAGGG - Intergenic
995357549 5:111256480-111256502 CCTTTGGGGGAACTGAGTGAAGG + Intronic
996381289 5:122864755-122864777 TCTTAGGAGCAGCTTAGGGAGGG + Intronic
996720818 5:126628426-126628448 CCTTGGCAGCAGCTGAGGAAAGG + Intergenic
999057749 5:148598167-148598189 AATGAGGAGGAGCTGAGGGAAGG + Intronic
999314317 5:150574316-150574338 CCTTCGGAGGCTCTGTGGGAGGG + Intergenic
999445866 5:151638971-151638993 CATTAGGAGGTGCTGATGGCAGG - Intergenic
999831288 5:155322585-155322607 CCTGAGGTTGAGGTGAGGGAGGG + Intergenic
1001420999 5:171587048-171587070 CCTGAGATGGAGATGAGGGAGGG - Intergenic
1001969842 5:175946810-175946832 CATTAGGGGGATCTGAGGGAAGG - Intronic
1002247596 5:177896958-177896980 CATTAGGGGGATCTGAGGGAAGG + Intergenic
1002943616 6:1739738-1739760 CATGGGGAGCAGCTGAGGGATGG + Intronic
1003255991 6:4475320-4475342 TCTTAGGAGCAGTTGAGGGAGGG + Intergenic
1003877258 6:10449834-10449856 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
1004468531 6:15907556-15907578 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
1005802950 6:29445589-29445611 CCACAGGAGGAGCTGATGCAGGG - Intronic
1006454885 6:34125975-34125997 CCTCAGGAGGTGCTCAGGGGAGG - Intronic
1006704362 6:36005229-36005251 CATTAGGAGAAGCTGTGGAAGGG - Intronic
1006911381 6:37565853-37565875 GCTGAGCTGGAGCTGAGGGAGGG + Intergenic
1007231286 6:40349220-40349242 CCCTGGGAGGAGGAGAGGGAGGG - Intergenic
1007594409 6:43042731-43042753 CATTTGGAGGAGGTGAGGAAGGG + Intronic
1007976764 6:46109828-46109850 CGTTGGGAGAAGCTGAGGCAGGG + Intergenic
1008586698 6:52957331-52957353 CCTTTGTAAGAGGTGAGGGAGGG - Intergenic
1010928210 6:81769188-81769210 CTTTGGGCAGAGCTGAGGGAGGG - Intergenic
1013604229 6:111732963-111732985 CTTTGGGAGGAGATGGGGGAGGG + Intronic
1013935609 6:115589549-115589571 TCTTAGGAGTAGCTTAGGGAGGG - Intergenic
1014545864 6:122734546-122734568 CATGAGGAGAAGCTGAGAGACGG + Intergenic
1015132825 6:129833160-129833182 CATTAGGGGAAGCTGAGTGAAGG + Intronic
1016105243 6:140154224-140154246 TCTTAGGAGGAAATGAGGAAGGG - Intergenic
1016428524 6:143959042-143959064 CCTGCGGATGAGCTGGGGGATGG - Intronic
1016741656 6:147534757-147534779 TCTTAGGAGCAGTTCAGGGAAGG + Intronic
1017006602 6:150032087-150032109 CCTTAGCAGGAGGTGGGAGAGGG - Intergenic
1017177748 6:151520646-151520668 TCTTAGGAGCAGTTTAGGGAGGG - Intronic
1017407792 6:154138841-154138863 TCTTAGGAGCAGTTTAGGGAGGG - Intronic
1017708717 6:157147564-157147586 CCGGAGGCGGAGGTGAGGGACGG - Intronic
1017708795 6:157147756-157147778 CCGGAGGCGGAGGTGAGGGACGG - Intronic
1017708807 6:157147788-157147810 CCGGAGGCGGAGGTGAGGGACGG - Intronic
1017927111 6:158920292-158920314 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
1018802316 6:167233619-167233641 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
1019101904 6:169638440-169638462 CCTTAACAGGAGATGAGGAAAGG - Intronic
1019310706 7:359324-359346 GCCTAGAAGGGGCTGAGGGATGG + Intergenic
1019575090 7:1733866-1733888 CCTTTGGGGGAGCTGAGGCCTGG - Intronic
1020013147 7:4817130-4817152 CCTTCTGGGGGGCTGAGGGAGGG - Intronic
1021507609 7:21402746-21402768 TCTTAGGAGCAGTTTAGGGAAGG + Intergenic
1022034251 7:26518867-26518889 CCTGAATGGGAGCTGAGGGAGGG + Intergenic
1022114564 7:27250736-27250758 GCTTGGGAGGAGCTGAGTGATGG - Intergenic
1022476902 7:30716928-30716950 CCTTAGGTAGAGCTGGGGGTGGG - Intronic
1022528716 7:31053779-31053801 CCTGGGGAGGAGTTGGGGGATGG + Intronic
1022723235 7:32958754-32958776 CCTGAGGCAGAGCTGAGAGAAGG - Intronic
1023641676 7:42265198-42265220 CTTAAGGAGGACCTGAGGGTGGG + Intergenic
1023800759 7:43832450-43832472 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
1024113385 7:46169836-46169858 GCTTAGGATCAGCGGAGGGAAGG + Intergenic
1024134009 7:46388503-46388525 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
1024138622 7:46437525-46437547 TCTTGGAAGAAGCTGAGGGATGG - Intergenic
1024661751 7:51501942-51501964 TCCTAGGAAGAGCTAAGGGAAGG + Intergenic
1024914616 7:54485298-54485320 CCTTGGGAGGAGGTGGGGGTGGG - Intergenic
1025943534 7:66089766-66089788 CCTTGGGAGGAGGTGAGGTGGGG + Intronic
1026097590 7:67358696-67358718 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
1026205803 7:68256114-68256136 TCTTAGGAGGAGTTTATGGAGGG + Intergenic
1026228912 7:68466531-68466553 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
1026494655 7:70892047-70892069 TCTTAGGAGAAGTTCAGGGAGGG - Intergenic
1027178791 7:75922861-75922883 GCAAAGGAGGAGCAGAGGGAAGG + Intronic
1028146613 7:87327017-87327039 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
1028861450 7:95656273-95656295 ACTTAAGAGGAGCAGAGGGTAGG + Intergenic
1029354392 7:100040712-100040734 CCTGAGGAGGGGCCGAGGAAAGG + Exonic
1030012889 7:105189060-105189082 CCTTGGCAGCAGCTGAGGAAAGG - Intronic
1030324872 7:108208426-108208448 CATTAGAGGAAGCTGAGGGAAGG - Intronic
1031419046 7:121527754-121527776 CCTTAGCAGCAGCTGAGAAAAGG - Intergenic
1031595704 7:123647307-123647329 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
1031702302 7:124941718-124941740 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
1032247444 7:130225029-130225051 TCTTAGGAGGAATTTAGGGAGGG - Intergenic
1032484458 7:132274375-132274397 CATTAGGAAAAGCTGGGGGAAGG - Intronic
1032682082 7:134195199-134195221 TCTTAGGAGCAGTTTAGGGAGGG + Intronic
1032805014 7:135344942-135344964 CATTAGGAGAAGTTGAGTGAAGG + Intergenic
1033340289 7:140486595-140486617 TCTTAGGAGAAGTTTAGGGAGGG + Intergenic
1033916138 7:146328694-146328716 GATTAGGAGGAGCTGGGGGCTGG - Intronic
1034113855 7:148564485-148564507 TCTTAGGAGCAGCTTAGGGAGGG + Intergenic
1034114408 7:148570917-148570939 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
1034776138 7:153828395-153828417 CATTGGCAGAAGCTGAGGGAAGG + Intergenic
1035435337 7:158855420-158855442 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
1035937074 8:3852693-3852715 CCTTTGGAGGCTGTGAGGGACGG + Intronic
1036200509 8:6767374-6767396 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
1036755466 8:11468116-11468138 GCTTGGGAGGCGCTGAGAGAGGG - Intronic
1038393621 8:27230036-27230058 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
1039184836 8:34905582-34905604 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
1039306499 8:36268735-36268757 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
1039346104 8:36707478-36707500 CTTTAGAATGAGATGAGGGAGGG - Intergenic
1039694369 8:39894944-39894966 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
1039799792 8:40944358-40944380 CCTTCTGAGGAGCAGAGAGAAGG - Intergenic
1041118830 8:54566150-54566172 CATTCTGAGGAGCTGAGGGTTGG + Intergenic
1043266950 8:78278712-78278734 TCTTAGGAGCAGCTTAGGGAGGG - Intergenic
1044133868 8:88560154-88560176 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
1044972504 8:97633774-97633796 ACTTAACAGGAGCTGAGGGATGG - Intergenic
1045343241 8:101272681-101272703 CCAAAGGAGGAGCTGTGGGAAGG - Intergenic
1045991854 8:108317039-108317061 CCTTAGGAGCAGTTTAAGGAGGG - Intronic
1046507322 8:115152764-115152786 CCTTCTGAGGCGATGAGGGAGGG - Intergenic
1046933932 8:119868617-119868639 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
1048979075 8:139693524-139693546 CCATAGCAGGTGCTCAGGGAAGG - Intronic
1049310487 8:141931380-141931402 CCTGAGGAGGAGGTGAGGAGGGG + Intergenic
1049404731 8:142447327-142447349 CCTGGGGAGGGGCTGAGGGCTGG + Intergenic
1049543780 8:143220251-143220273 CCTAAGGAGGAGGAAAGGGATGG - Intergenic
1049685717 8:143938569-143938591 CTGTGGGAGGCGCTGAGGGAGGG - Intronic
1049946438 9:601178-601200 CATTAGGAGAAACTGAGTGAAGG - Intronic
1050201829 9:3153158-3153180 CCTTAGCATGAGATGAGGCAGGG + Intergenic
1051072146 9:13183417-13183439 CCTTAGGAGGAGATGATGGAAGG + Exonic
1051244301 9:15093536-15093558 CATTAGCAGAAGCTGAGTGAAGG - Intergenic
1051266765 9:15316802-15316824 TCTTAGGAGCAGTTTAGGGATGG + Intergenic
1051838922 9:21372413-21372435 CATTAGGAGAAGCTGAGTGAAGG - Intergenic
1052074031 9:24118499-24118521 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
1052165136 9:25317347-25317369 CTTTAGGAGGAGCTCATGGAGGG + Intergenic
1053074718 9:35123028-35123050 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
1053203515 9:36168114-36168136 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
1053450153 9:38186974-38186996 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
1053451076 9:38194659-38194681 CCTTAGGGGCAGTTTAGGGAGGG - Intergenic
1054725178 9:68642718-68642740 TCTTAGGAGAAGTTTAGGGAGGG + Intergenic
1055497737 9:76872226-76872248 GCTGAGGAGGAGCTCAGGGAGGG - Intronic
1055551271 9:77434192-77434214 CTTTAGGAGGTGGTGAGAGATGG + Intronic
1056518179 9:87374525-87374547 TCTTAGGAGCAACTTAGGGAGGG + Intergenic
1057008387 9:91581001-91581023 CCAGAGTAGGAGCTGAGGGTGGG - Intronic
1057417655 9:94879116-94879138 TCTTAGGAGCAGTTTAGGGAGGG + Intronic
1057570468 9:96200585-96200607 CCTCAGGAGGATCAAAGGGAAGG - Intergenic
1057779691 9:98039584-98039606 CCTTAGGAGCAGTTTAGGGAGGG - Intergenic
1057918388 9:99075261-99075283 TCTCAGTAGGAGCTGGGGGAAGG + Intergenic
1058493703 9:105530962-105530984 GCTATGGAGTAGCTGAGGGAAGG - Intronic
1059635054 9:116162134-116162156 CCTTAGGAGGAGCATGGAGAAGG + Intronic
1060101646 9:120845900-120845922 TCTTGGCAGCAGCTGAGGGAAGG + Intergenic
1060171062 9:121461527-121461549 CCCCAGGATGAGCTGAGGGCTGG - Intergenic
1060269486 9:122130758-122130780 TCTCAGGAGGTGCGGAGGGATGG - Intergenic
1060418355 9:123449223-123449245 CCTTAAGAGGAGCTTAAAGAAGG + Intronic
1060499990 9:124145983-124146005 CCTTAGGAGCAGTCTAGGGAGGG - Intergenic
1061042106 9:128146239-128146261 CCATAGGAGGGGCCGAGGGGAGG + Intergenic
1061193624 9:129095869-129095891 CCAGAGGAGGAGCTGGGGGCAGG - Intronic
1062256588 9:135625759-135625781 GCCTATGAGGAACTGAGGGAGGG + Intronic
1062452589 9:136621815-136621837 GCCTAGGAGGAGCAGGGGGAAGG - Intergenic
1062606431 9:137350739-137350761 CACTTGGAGGAGCTGCGGGAGGG - Intronic
1186062634 X:5726561-5726583 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
1186114249 X:6288703-6288725 GCCTATGAGGAACTGAGGGAGGG - Intergenic
1186115587 X:6301969-6301991 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
1186622564 X:11256855-11256877 ACCCAGGAGGAGCTCAGGGAGGG + Intronic
1187171567 X:16857115-16857137 GCTTACCAGGAGCTGGGGGAAGG + Intronic
1187211646 X:17238054-17238076 CCAAAGGAGGACCTGAGAGATGG - Intergenic
1187359268 X:18609694-18609716 ACTTAGCAGGAGCAGAGGCAGGG - Intronic
1187583916 X:20639139-20639161 CCTTGGTGGGGGCTGAGGGAAGG - Intergenic
1187672012 X:21677302-21677324 CCTTAGGAGGAGTTCAGGAAGGG - Intergenic
1189012888 X:37064075-37064097 CCTAAGGAGGAGCTGTGGTAAGG - Intergenic
1189090854 X:38081205-38081227 CCTTAGGAGGAGCGAGGGGTGGG + Intronic
1189145296 X:38649504-38649526 TTTTGGGAGGAGCTGAGGGAAGG + Intronic
1189487541 X:41444903-41444925 CCATAAAAGGAGCTGAAGGAGGG - Intergenic
1189566897 X:42251242-42251264 TCTTTCGAGGAGCTGAGAGAAGG - Intergenic
1189671796 X:43418585-43418607 CATTAGGGAGAGCTGAGTGAAGG - Intergenic
1189789572 X:44590658-44590680 CCTTAGGAGCAGTTTAGAGAGGG - Intergenic
1189796070 X:44647056-44647078 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
1190262783 X:48808237-48808259 CCCTAGGAGCAGCAGAGAGAGGG - Exonic
1190287396 X:48970551-48970573 GCCAAGAAGGAGCTGAGGGAGGG + Exonic
1190368632 X:49721043-49721065 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
1190369045 X:49724069-49724091 TCTTAGGAGCAGTTTAGGGAAGG + Intergenic
1190798007 X:53761680-53761702 CCTCAGTGTGAGCTGAGGGAGGG - Intergenic
1194316625 X:92384768-92384790 GCTTAGGAGCAGTTTAGGGAGGG + Intronic
1194758503 X:97765996-97766018 TCTTAGGAGCAGTTTAGGGAGGG + Intergenic
1196649074 X:118150436-118150458 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
1196707540 X:118728534-118728556 CCTTAGGAGCAGCTCCTGGAAGG + Intronic
1197042973 X:121962289-121962311 TCTTAGGAGGAGTTTAGGGAGGG + Intergenic
1197446049 X:126552934-126552956 CCTGAGGAGTAGCTGAGGCCGGG + Intergenic
1197752541 X:129975363-129975385 CTTTAGGAGGCGAAGAGGGAAGG + Intergenic
1199643024 X:149881732-149881754 ACTCAAGAGGAGCAGAGGGAGGG + Intronic
1200624801 Y:5498090-5498112 TCTTAGGAGCAGTTTAGGGAGGG + Intronic
1201262952 Y:12178067-12178089 ACTTAGGAGCAGTTTAGGGAGGG + Intergenic
1201749031 Y:17412667-17412689 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic
1201750485 Y:17426346-17426368 TCTTAGGAGCAGTTTAGGGAGGG - Intergenic