ID: 948598064

View in Genome Browser
Species Human (GRCh38)
Location 2:239093076-239093098
Sequence GGCCTCGCCCAGCGGAGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 160}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948598064_948598074 24 Left 948598064 2:239093076-239093098 CCAGGACTCCGCTGGGCGAGGCC 0: 1
1: 0
2: 0
3: 5
4: 160
Right 948598074 2:239093123-239093145 CAGTTGAAACTTGCGGTCACTGG 0: 1
1: 0
2: 1
3: 3
4: 51
948598064_948598071 17 Left 948598064 2:239093076-239093098 CCAGGACTCCGCTGGGCGAGGCC 0: 1
1: 0
2: 0
3: 5
4: 160
Right 948598071 2:239093116-239093138 CCTCACCCAGTTGAAACTTGCGG 0: 1
1: 0
2: 1
3: 13
4: 121
948598064_948598075 29 Left 948598064 2:239093076-239093098 CCAGGACTCCGCTGGGCGAGGCC 0: 1
1: 0
2: 0
3: 5
4: 160
Right 948598075 2:239093128-239093150 GAAACTTGCGGTCACTGGAGAGG 0: 1
1: 0
2: 0
3: 4
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948598064 Original CRISPR GGCCTCGCCCAGCGGAGTCC TGG (reversed) Intronic
900096701 1:942766-942788 GGGCTCGCCGGGCAGAGTCCCGG - Exonic
900423723 1:2566767-2566789 GGCATCGCCCAGTGGGATCCTGG - Intergenic
901019698 1:6249522-6249544 AGCAGCGCCCAGCGGAGCCCAGG - Exonic
903320726 1:22541639-22541661 GGCCTGGCCCAGAGGAGGGCGGG - Intergenic
903398350 1:23019797-23019819 GGCCTCGCCCCCCGGGGGCCTGG + Exonic
906288404 1:44603375-44603397 GGCCTGGCCCACCGTAGCCCGGG - Intronic
915981200 1:160420889-160420911 GGCCTCTCCCAGAGGTGGCCAGG + Intronic
918487560 1:185045611-185045633 GGCCGCGGCCAGCGGAGCCCTGG + Exonic
919751648 1:201041449-201041471 GTCTTCTCCCAGAGGAGTCCGGG - Intronic
922668387 1:227491449-227491471 GTCCTTGCCCAGCGCAGCCCAGG - Intergenic
922753839 1:228083204-228083226 GGCCTCCCCCACCCGAGTACAGG + Exonic
924624123 1:245686040-245686062 GGCCTCACCCAGGAGCGTCCCGG + Exonic
1067544604 10:47183960-47183982 GGCCTCACACAGAGGAGTCAGGG + Intergenic
1073453239 10:103621826-103621848 GGCCTGATCCAGGGGAGTCCAGG - Intronic
1074867715 10:117554452-117554474 GGCCTCGCCTGGCGGTGGCCTGG + Intergenic
1076003542 10:126930674-126930696 GGCCTCGTGCACAGGAGTCCAGG + Intronic
1076006050 10:126948872-126948894 GGCCTGGCCCAGGGTAGTACTGG + Intronic
1076239864 10:128896396-128896418 GGCCTCGCCCATGGAAGTTCTGG + Intergenic
1076409016 10:130232706-130232728 GGCCCAGCCCAGGGCAGTCCAGG + Intergenic
1076726855 10:132417997-132418019 GGCCCCGCCCAGCAGTGCCCAGG - Intergenic
1076993613 11:288314-288336 GGCTGAGCCCAGCGGCGTCCGGG + Intergenic
1077507942 11:2940810-2940832 GGCCTCGGCAAGAGGCGTCCAGG + Intergenic
1078100392 11:8327157-8327179 TGCCTGGCTCAGCTGAGTCCTGG - Intergenic
1080383914 11:31799294-31799316 GGGGTCGCCCAGGGGAGCCCGGG + Intronic
1082076760 11:47980955-47980977 GGCAGCGCCCAGCGCAGCCCGGG - Exonic
1083995238 11:66268533-66268555 GGCCTCGCCGCGCTGATTCCCGG - Exonic
1084165543 11:67373323-67373345 GGCCCCGCCGTGCGGACTCCAGG + Intronic
1084424774 11:69078677-69078699 TGCCTCGCCCAGCGCTGTGCTGG + Intronic
1089559056 11:119334536-119334558 GGCGGCGCCCAGCGGAGTAGGGG + Exonic
1097232896 12:57522970-57522992 GGCCCCGCCCTGCGCAGTCGCGG - Exonic
1101740170 12:107494498-107494520 GGCCTCTCCCAGCCTAGACCGGG + Intronic
1103592837 12:122004442-122004464 AGCCCCGCCCAGCAGAGGCCGGG + Intergenic
1104831378 12:131754308-131754330 GGGCTCGCCAAGCTCAGTCCTGG - Intronic
1104975701 12:132551058-132551080 GGCCTCGCACAGCAGTGCCCAGG - Intronic
1108832759 13:54499969-54499991 GGCCTTGCACAGGGCAGTCCTGG - Intergenic
1109638119 13:65149895-65149917 GGCTGCGCGCAGCGGAGTTCCGG - Intergenic
1115769383 14:36654811-36654833 GGCCTTCCTCCGCGGAGTCCGGG - Intergenic
1117377390 14:55129132-55129154 GGGCTCGCCCAGCCTGGTCCGGG + Exonic
1122050733 14:99057946-99057968 TGCCTCGCCCACCTGAGCCCAGG - Intergenic
1122130845 14:99604017-99604039 GGACCGGCCCAGCGGAGCCCCGG - Exonic
1122418192 14:101560395-101560417 TGCCTCGCCCAGCGCAGCCCCGG - Intergenic
1122878250 14:104678624-104678646 GGCTTGGCCCAGGAGAGTCCCGG + Intergenic
1123493238 15:20799488-20799510 TGCCCCGCCCCGCGGTGTCCTGG + Intergenic
1123549745 15:21368590-21368612 TGCCCCGCCCCGCGGTGTCCTGG + Intergenic
1125568463 15:40695470-40695492 GTCCTCGCCCACCTGCGTCCTGG + Intronic
1202958076 15_KI270727v1_random:95808-95830 TGCCCCGCCCCGCGGTGTCCTGG + Intergenic
1132503866 16:297253-297275 AGCCTCGGCCACCGGAGGCCAGG - Intronic
1132576869 16:668336-668358 CGCCTCGCCCCGCGCAGCCCAGG + Exonic
1132593591 16:737783-737805 TGCCCCGCCCACCGGAGGCCAGG - Intronic
1132794192 16:1710987-1711009 GGCTGCGCCCAGCGGCCTCCGGG - Intronic
1132837057 16:1959451-1959473 GGCCGCGCCCGGCGGAGCCGGGG + Intergenic
1133222389 16:4324278-4324300 GGCCTGGCCCAGCAGATCCCAGG - Intronic
1134043789 16:11086918-11086940 GGCCTCCCCCTGAGGATTCCTGG - Intronic
1142430251 16:90022631-90022653 GGCATCGCCCAGCGGTTGCCGGG + Exonic
1143204589 17:5133101-5133123 GTCCTCGCCCAGAGGACTGCAGG + Intronic
1144006196 17:11101979-11102001 AGCCTGGCCCAGCTGAGTACAGG - Intergenic
1144772298 17:17766631-17766653 GGCCTCGCACAGTGCAGTGCTGG - Intronic
1146844071 17:36172721-36172743 GTCCTCGCCCAGAGGACTGCAGG - Intronic
1146856376 17:36260656-36260678 GTCCTCGCCCAGAGGACTGCAGG - Intronic
1146864240 17:36327719-36327741 GTCCTCGCCCAGAGGACTGCAGG + Intronic
1146872286 17:36384567-36384589 GTCCTCGCCCAGAGGACTGCAGG - Intronic
1146879645 17:36435652-36435674 GTCCTCGCCCAGAGGACTGCAGG - Intronic
1146883569 17:36456795-36456817 GTCCTCGCCCAGAGGACTGCAGG - Intergenic
1147067101 17:37928307-37928329 GTCCTCGCCCAGAGGACTGCAGG + Intronic
1147075170 17:37985191-37985213 GTCCTCGCCCAGAGGACTGCAGG - Intronic
1147078633 17:38007868-38007890 GTCCTCGCCCAGAGGACTGCAGG + Intronic
1147086695 17:38064737-38064759 GTCCTCGCCCAGAGGACTGCAGG - Intronic
1147094571 17:38131803-38131825 GTCCTCGCCCAGAGGACTGCAGG + Intergenic
1147102640 17:38188700-38188722 GTCCTCGCCCAGAGGACTGCAGG - Intergenic
1147623298 17:41882732-41882754 AGCCCCGCCCAGCTGAGCCCAGG + Intronic
1149847213 17:60015167-60015189 GTCCTCGCCCAGAGGACTGCAGG - Intergenic
1150085572 17:62271784-62271806 GTCCTCGCCCAGAGGACTGCAGG - Intergenic
1151973090 17:77469095-77469117 GGCCTGGCACAGCGGGGCCCAGG + Intronic
1152030007 17:77836337-77836359 CACCACGCCCAGCCGAGTCCTGG - Intergenic
1152406277 17:80099783-80099805 GGCCTTGCAAGGCGGAGTCCAGG - Exonic
1152497119 17:80681079-80681101 GGCCTGGCGCACTGGAGTCCAGG + Intronic
1152542013 17:80981365-80981387 GGTCTCTCCCACCGGGGTCCGGG + Intergenic
1152801436 17:82332667-82332689 GGCCTGGCTCAGCAGAGACCAGG - Intronic
1154300308 18:13186129-13186151 AGCCTGGCCAGGCGGAGTCCAGG + Intergenic
1154450790 18:14474025-14474047 TGCCCCGCCCCGCGGTGTCCTGG + Intergenic
1156350572 18:36298089-36298111 GGCCGCGCCCAGCCCAGCCCAGG - Intronic
1156957125 18:42980654-42980676 GGCCTCCTGCAGAGGAGTCCAGG - Intronic
1158954778 18:62526871-62526893 GGCCTCTTCCCGCGGAGGCCAGG + Intronic
1160557612 18:79736272-79736294 GGCTTCTCCCGGCAGAGTCCAGG - Intronic
1161968399 19:7561597-7561619 GGCCACCCCCAGCCCAGTCCAGG - Exonic
1164952088 19:32345529-32345551 GGCCCCGCCTACCGGCGTCCCGG - Intergenic
1167101654 19:47407487-47407509 GGTCTGGCCCACCGGGGTCCGGG + Exonic
1167485588 19:49761270-49761292 GGCCTGGCCCAGGGGAAGCCAGG + Intronic
1167533272 19:50032192-50032214 GGCCTTGTCCAGCGCAGTCTGGG + Intronic
1168177062 19:54633724-54633746 GGCCTCCCCCAGGGCAGCCCTGG + Intronic
1168713944 19:58516543-58516565 GACCTCCCCCAGCTGAGTACTGG + Exonic
925294323 2:2767543-2767565 AGCCTGGCCCAGGGGAGGCCTGG - Intergenic
926591618 2:14745772-14745794 GGCCTGGCCCAGCGCTGTTCTGG - Intergenic
927054384 2:19356034-19356056 CGCGGCGCCCAGCGGGGTCCGGG - Intronic
927721859 2:25388229-25388251 GGACTCGCTGAGCGGAGTCGGGG - Exonic
932331717 2:70901649-70901671 GGCCTCGCGGAGAGGAGGCCGGG - Intronic
932567852 2:72920761-72920783 GGCCCCGACCTTCGGAGTCCTGG - Intronic
933741692 2:85539024-85539046 CAGCTCGCCCCGCGGAGTCCGGG - Intergenic
936147070 2:109987265-109987287 GGCCTCCCGCAGCTGAGTGCCGG + Intergenic
936197622 2:110384218-110384240 GGCCTCCCGCAGCTGAGTGCCGG - Intergenic
937992903 2:127674239-127674261 GGTCTCCCCCAGCCAAGTCCTGG - Intronic
940293330 2:152098683-152098705 AGCCTCCCCCAGCGGATGCCGGG - Intronic
942799729 2:179861415-179861437 GGGCGCGCCCAGCGGGCTCCGGG - Exonic
946397010 2:219448276-219448298 GGCCTCGCTCAGTGGCGTCTGGG - Exonic
947878029 2:233480673-233480695 GGCCTGTGGCAGCGGAGTCCTGG + Intronic
947984280 2:234435886-234435908 GGCCTCCCCCAGCCCATTCCAGG - Intergenic
948598064 2:239093076-239093098 GGCCTCGCCCAGCGGAGTCCTGG - Intronic
1172742332 20:37179032-37179054 GGCCTGGCCCAACCGCGTCCCGG + Exonic
1175442074 20:58999399-58999421 GCTCTCGCCCAGCTGAGGCCAGG - Intronic
1175875479 20:62227488-62227510 GGCCTGGCCCAGCGGCCCCCTGG - Intergenic
1175913812 20:62416515-62416537 GGCCGCGCCCAGTGGGGGCCGGG + Intronic
1176242195 20:64080212-64080234 GGCCCCGCCGAGCAGAGTCGGGG - Intronic
1180876723 22:19178308-19178330 GGCCGCGCCGACCGAAGTCCGGG - Intronic
1181016251 22:20070546-20070568 GGCATCCCCTAGCTGAGTCCTGG + Intergenic
1181553857 22:23656251-23656273 TACCTCCCCCAGCGGGGTCCTGG + Intergenic
950005167 3:9686851-9686873 TGCCTCGCCCAGGGGCCTCCAGG - Intronic
953464340 3:43105842-43105864 GGCTTCGTCCCGCGGAGTCCAGG - Exonic
953537069 3:43784511-43784533 GGCCTCGCCCAGCTCAGCACGGG - Intergenic
954717685 3:52534391-52534413 GGCCTCCCCCAGCGTGGGCCTGG - Intronic
961654372 3:128433180-128433202 GGCCTCGCCCGGCGGCGCTCGGG + Intergenic
963028470 3:140942468-140942490 GGCCAGGTCCAGCGGCGTCCGGG - Intronic
967809455 3:193744676-193744698 AGCCTCAGCCAGCAGAGTCCCGG - Intergenic
968383207 4:112314-112336 GACCTTGACCAGCGGAATCCAGG - Intergenic
969326753 4:6448626-6448648 GGCCTGGCCCTGGGGACTCCAGG - Intronic
976088147 4:81427370-81427392 GGACTTGCCCAGCTGAGTGCTGG - Exonic
985800646 5:2003589-2003611 AGCCTGGCTCAGCGCAGTCCAGG - Intergenic
999500558 5:152142750-152142772 GGCCTCTCCAAGCAGAGTCCAGG - Intergenic
1002185906 5:177454743-177454765 GCCCGCGCCCTGCGCAGTCCGGG - Intronic
1005039480 6:21588258-21588280 GGCCTCAGCCTGCGGGGTCCGGG + Intergenic
1006391447 6:33761346-33761368 AGCCTCCCCCAGGGGAGGCCAGG + Intergenic
1007636400 6:43302358-43302380 GGCCGTGCCCAGCAGTGTCCCGG - Exonic
1007751155 6:44072840-44072862 GGCAGGGCCCAGCAGAGTCCTGG + Intergenic
1008535001 6:52500878-52500900 GGCCTCTCTCAGGTGAGTCCAGG - Exonic
1012472744 6:99589528-99589550 GTCCTCTCCCAGCGGTGACCAGG + Intergenic
1013156085 6:107491437-107491459 AGCCTCGCCGAGAGGACTCCGGG - Intronic
1015626451 6:135183707-135183729 GGACTCGCCCTGCTGCGTCCTGG + Intronic
1017816425 6:158019570-158019592 GGCCTCGCCTAGGGCAGCCCTGG - Intronic
1019007375 6:168810881-168810903 GGGCTCTCCCTGCAGAGTCCAGG - Intergenic
1019014871 6:168872923-168872945 GGCCTCTCTCAGCAGAGCCCAGG - Intergenic
1019373735 7:677276-677298 GGCCTTGGCCAGCGCAGTCATGG + Exonic
1019420640 7:949185-949207 CGCCTTGCCCGCCGGAGTCCAGG + Intronic
1019697133 7:2452171-2452193 GGCCTCAGCCAGCGTGGTCCTGG - Intergenic
1019916946 7:4139832-4139854 GGCCTCGCCCTGCGCTGTCTGGG + Intronic
1022486014 7:30778182-30778204 GGACTCGCGCACAGGAGTCCTGG - Intronic
1023939759 7:44761960-44761982 GGCCTGGCCCAGCGGTGCCGTGG + Intronic
1024343284 7:48288251-48288273 GGCCTCTCCCAGTGGTGTGCTGG + Intronic
1025941376 7:66078155-66078177 CGCCTCCCCCAGCGGGCTCCTGG - Intronic
1029456174 7:100673695-100673717 GGTCTCGCCCAGCCGGGTCCTGG + Exonic
1032838818 7:135697944-135697966 GGGCTCTCCCTGCAGAGTCCTGG + Intronic
1034885371 7:154794586-154794608 AGCCTCCCCCAGCGGGCTCCAGG + Intronic
1034982670 7:155488760-155488782 AGCATTGCCCAGCTGAGTCCAGG - Intronic
1035756015 8:2033679-2033701 GACCTCGCACAGCAGGGTCCTGG - Intergenic
1036707947 8:11059250-11059272 GGCCGGGCCCAGCGCGGTCCTGG + Intronic
1047858645 8:128939946-128939968 GGACTAGCCCAGTGGAGTACAGG - Intergenic
1049154485 8:141058574-141058596 GGCCTTCCCATGCGGAGTCCTGG + Intergenic
1049665664 8:143841422-143841444 GGCCCCGCCCTGCGGACACCTGG + Intergenic
1051910939 9:22154138-22154160 GGCCTCTCCCAGCTGAAACCTGG - Intergenic
1057024798 9:91726570-91726592 GGCCTCGCCCAGCCAAGACATGG - Exonic
1060200911 9:121651486-121651508 CGCCTCGCCCCGCCGATTCCAGG + Intronic
1060523757 9:124309042-124309064 TGCCTGGGCCAGCAGAGTCCTGG - Intronic
1060727699 9:126016964-126016986 GGCCCTGCCCAGGGGAGCCCTGG + Intergenic
1062084534 9:134641937-134641959 GAGCTAGCCCAGCGGGGTCCCGG + Exonic
1062489640 9:136799028-136799050 AGCCTCCCCCAGGGGATTCCAGG + Intronic
1062545931 9:137063773-137063795 GGCCTCTCCCAGCTGAAACCTGG + Exonic
1200092927 X:153644251-153644273 GGCCCGGCCCGGCGGAGGCCCGG + Intronic
1200133739 X:153864767-153864789 GGCCCCGGCCAGCCGGGTCCAGG - Intronic