ID: 948599472

View in Genome Browser
Species Human (GRCh38)
Location 2:239100150-239100172
Sequence CAGCCCAGAGACTCTGCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 5, 3: 46, 4: 245}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948599469_948599472 -8 Left 948599469 2:239100135-239100157 CCTGGTGGGTCCCTGCAGCCCAG 0: 1
1: 0
2: 1
3: 64
4: 465
Right 948599472 2:239100150-239100172 CAGCCCAGAGACTCTGCCTTTGG 0: 1
1: 0
2: 5
3: 46
4: 245
948599462_948599472 14 Left 948599462 2:239100113-239100135 CCCTAAGAGGGTCTTTCTTACCC 0: 1
1: 0
2: 0
3: 8
4: 113
Right 948599472 2:239100150-239100172 CAGCCCAGAGACTCTGCCTTTGG 0: 1
1: 0
2: 5
3: 46
4: 245
948599467_948599472 -6 Left 948599467 2:239100133-239100155 CCCCTGGTGGGTCCCTGCAGCCC 0: 1
1: 0
2: 4
3: 36
4: 525
Right 948599472 2:239100150-239100172 CAGCCCAGAGACTCTGCCTTTGG 0: 1
1: 0
2: 5
3: 46
4: 245
948599463_948599472 13 Left 948599463 2:239100114-239100136 CCTAAGAGGGTCTTTCTTACCCC 0: 1
1: 0
2: 0
3: 15
4: 120
Right 948599472 2:239100150-239100172 CAGCCCAGAGACTCTGCCTTTGG 0: 1
1: 0
2: 5
3: 46
4: 245
948599468_948599472 -7 Left 948599468 2:239100134-239100156 CCCTGGTGGGTCCCTGCAGCCCA 0: 1
1: 0
2: 2
3: 32
4: 322
Right 948599472 2:239100150-239100172 CAGCCCAGAGACTCTGCCTTTGG 0: 1
1: 0
2: 5
3: 46
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948599472 Original CRISPR CAGCCCAGAGACTCTGCCTT TGG Intronic
900918689 1:5657102-5657124 TAGCCCAGATATTTTGCCTTTGG + Intergenic
903233251 1:21934444-21934466 CAGCCCAGAGACTCATACTTGGG + Intronic
905653409 1:39671459-39671481 CGGACCTGAGACTCTGCGTTTGG - Intronic
905880211 1:41458167-41458189 CTGCCCTGAGACTCTGCGATGGG + Intergenic
907389772 1:54150692-54150714 GAGCCCAGAGGCTCTGGCTGTGG + Intronic
908265860 1:62378440-62378462 CAGCACAGAGAATCTGCCAAGGG - Intergenic
911041285 1:93592821-93592843 CAGCCCAAGGACTGTGCTTTGGG - Intronic
912261351 1:108114162-108114184 TAGCCCATAGGCTCTTCCTTGGG - Intergenic
912328428 1:108792858-108792880 CAGTCCTGGGACTATGCCTTAGG - Intronic
912856982 1:113178109-113178131 CAGCCCACAGCCTCTGCCCAAGG + Intergenic
915311742 1:155008719-155008741 GGGCCCAGAGTCTCTGCCTGTGG - Intronic
915422290 1:155793067-155793089 CAGCCAAAAGACTCTTCCTTTGG + Intronic
915460083 1:156065083-156065105 CAGGCCAGAGTTTTTGCCTTTGG - Intronic
915591923 1:156875601-156875623 GAGCCCAGAGCCTTTGCCCTCGG - Exonic
916387811 1:164296369-164296391 CTGCCCTGAGACTCAGCCTATGG - Intergenic
916996755 1:170309633-170309655 CAGTGCAGAGACACTGCATTTGG - Intergenic
921182052 1:212638942-212638964 CAGCCCAGAGGCTCTGTTCTTGG - Intergenic
922393994 1:225177567-225177589 CAGCACAGAGACCCTGGGTTTGG - Intronic
1064242999 10:13647431-13647453 AAGCCCAGAGGTTCTGGCTTTGG - Intronic
1065203261 10:23334447-23334469 AAGCACAGACATTCTGCCTTTGG - Intronic
1065274659 10:24073819-24073841 CAGCACACAGACACTGCCCTAGG + Intronic
1067832249 10:49616915-49616937 GAGCCCAGTGATTTTGCCTTAGG + Intronic
1068708927 10:60110292-60110314 CAGCCCATTGCCTCTGCCTGTGG - Intronic
1068983673 10:63087570-63087592 CACCCCAGTTACCCTGCCTTGGG + Intergenic
1070517837 10:77224692-77224714 AATCCCAGAAACTCTGGCTTTGG - Intronic
1072204648 10:93192425-93192447 CAGCCCAGACACTCTGTCTTGGG + Intergenic
1073333474 10:102686815-102686837 CAACCCAGAGATGCTGACTTTGG + Intronic
1073427612 10:103465357-103465379 CAGCCCAGACTGTCTGCCTGAGG + Intergenic
1074158094 10:110815661-110815683 CACTCCTGAGACTCTGCCCTGGG + Intronic
1074540764 10:114363480-114363502 CAGCCCAGTGCCTCTGCATTTGG - Intronic
1075137444 10:119796816-119796838 CAGCCCAGAGACCCCCCCTCAGG + Exonic
1075139097 10:119815616-119815638 CAGTCCAGAGAAGCTGACTTGGG + Intronic
1075876879 10:125814894-125814916 CAGGTCACAGACTCTGCCTTGGG - Intronic
1075906113 10:126083392-126083414 CTGCCCAGAGGCCCTGCCCTGGG - Intronic
1076629263 10:131842598-131842620 GAGCCCAGGGACTCAGCTTTGGG - Intergenic
1077225714 11:1438230-1438252 CTCCCCACAGACACTGCCTTTGG - Intronic
1077997647 11:7467786-7467808 CAGCCCAGAGTCATAGCCTTGGG + Exonic
1078434783 11:11315490-11315512 CAGCCCAGAGACTCTGGAGTGGG + Intronic
1080173280 11:29332063-29332085 CAGCTTAGGGACTCTGCCTATGG + Intergenic
1080872559 11:36250024-36250046 CTGCCCAGGGTCTCTGCCTCTGG + Intergenic
1083418342 11:62539605-62539627 CTGCCCTGGGACTCTGCCTGAGG - Intronic
1083944825 11:65917982-65918004 CAGCCCACAGGCTCTGAGTTGGG + Exonic
1087214028 11:95475722-95475744 CAGCTCAGTTATTCTGCCTTTGG + Intergenic
1087474591 11:98620264-98620286 CAGCACAGAGACTCTGCGCCTGG - Intergenic
1087945259 11:104152039-104152061 CAGAGCAGAGACTGTGCCTTAGG + Intronic
1088742696 11:112780106-112780128 CACCCCAGGGACTCTGGCTCAGG - Intergenic
1089649884 11:119905832-119905854 CAGCCTAGAGAATCTGCAATGGG - Intergenic
1089735418 11:120547298-120547320 AAGGCCAGAGACCTTGCCTTGGG + Intronic
1090615729 11:128512869-128512891 CAGCCCACAGACTCGGCCTGCGG + Intronic
1092130838 12:6112012-6112034 CAGCCCAGGGATTCTGACTTGGG - Intronic
1094346810 12:29479383-29479405 TAACCCAGAGACTGTGACTTAGG - Intronic
1096740081 12:53686787-53686809 CAGCCCACAGCCTCTTCCTGGGG - Intergenic
1097282062 12:57851133-57851155 CAGCCCCGATACTCTGCCCTGGG - Intergenic
1103558782 12:121781268-121781290 CAGGCAAGTGACCCTGCCTTAGG + Exonic
1105421665 13:20257883-20257905 CAGCTCTGAACCTCTGCCTTGGG - Intergenic
1107044130 13:35977256-35977278 CTGCCCAGACACTCTGAGTTGGG - Intronic
1107758169 13:43648292-43648314 CAGCCCAGACACTGTTCTTTGGG + Intronic
1110762536 13:79246103-79246125 CACCCCAGAGCCTCTGCTTCAGG - Intergenic
1111700609 13:91683327-91683349 CAGCCTAGTGACACTGCTTTGGG + Intronic
1112174607 13:97009731-97009753 CAGCCGAAAGACTCTACATTTGG - Intergenic
1112340973 13:98552720-98552742 CACTCCAGAGAAACTGCCTTCGG + Intronic
1113388212 13:109870521-109870543 CAGCCCAAAGGCTCTGACTCAGG - Intergenic
1113723130 13:112575946-112575968 CAGCCCCAGGACACTGCCTTTGG + Intronic
1113964403 13:114144504-114144526 CAGCCCAGCCTCTGTGCCTTGGG - Intergenic
1117872533 14:60216339-60216361 AAGCCCAGGGGCTCTGCATTTGG + Intergenic
1118114706 14:62762131-62762153 GAGCCCAGAGAGTTTGGCTTGGG + Intronic
1119043479 14:71296527-71296549 CAGCTCAGATATGCTGCCTTTGG - Intergenic
1119720141 14:76884825-76884847 CAGCCCAGGGGATCTGCCTGAGG + Intergenic
1120916671 14:89716559-89716581 CAGCCGGTAGACTCGGCCTTTGG + Intergenic
1121055063 14:90845593-90845615 CAGCACGGAAACTCTGCCTCAGG + Intergenic
1121774662 14:96582785-96582807 CAGCCCAGTGTGTCTGCCTCTGG + Intergenic
1122570391 14:102694641-102694663 CAAGCCAGAGACTCTGCCTGAGG - Intronic
1122633517 14:103119065-103119087 CAGCCCTGAGACTCTTCCTGGGG - Intergenic
1124215651 15:27805641-27805663 CAGCCCAGAGCATCTGCCAGCGG - Intronic
1124701210 15:31914147-31914169 CAGCCCATAGACTCTGACTCTGG - Intergenic
1125726670 15:41871728-41871750 CACCCCATAGGCTCTGCCTCAGG + Intronic
1126680126 15:51193972-51193994 CACCCCAGGAACCCTGCCTTAGG - Intergenic
1127810340 15:62560130-62560152 CAGCCCAAAGGAGCTGCCTTTGG - Intronic
1127911614 15:63420702-63420724 TAGCACAGAAACTTTGCCTTAGG + Intergenic
1128242030 15:66107741-66107763 CTGCCCAGAGACTACTCCTTTGG + Intronic
1129543054 15:76366930-76366952 CAGCCCTGAGACTCTGAGGTGGG + Intronic
1129918408 15:79295382-79295404 CAGGCCAGAGCCTCTTCCATGGG - Exonic
1130039874 15:80397538-80397560 CATTCCAGAGCCTCTGCCCTTGG + Intronic
1132498075 16:273228-273250 CATCCCTGTGACTCTCCCTTGGG + Intronic
1132530419 16:445563-445585 CAGACCAGAGTCACTCCCTTGGG - Intronic
1133266631 16:4588596-4588618 CATCCCATGGACTCTGCCTTTGG + Intronic
1133280513 16:4662567-4662589 CAGCACAGAGACACTGCCTGTGG - Intronic
1134148689 16:11788392-11788414 CAGGCCAGAGGGTCTGCCTGGGG - Intronic
1136009339 16:27352764-27352786 AAGCCCAGAGACTCAGCCAGGGG - Intronic
1136516828 16:30773481-30773503 CTGGCCAGAGACCCTGCCGTGGG - Intronic
1136748633 16:32614035-32614057 CTGCCCAGAGGCTCTGCCCTGGG - Intergenic
1138444574 16:57055339-57055361 GAGCCCAGAGGCTGTGCCCTGGG + Intronic
1138630521 16:58290939-58290961 CAGGCCAGTGCCCCTGCCTTTGG - Exonic
1139744859 16:69066201-69066223 CTGCCCAGCCACTCTGCCTTTGG + Intronic
1139748236 16:69091814-69091836 CATCTCTGAGACTCTGCCCTTGG + Intergenic
1141063233 16:80894272-80894294 GAGCCCAGAGACTTTGACTGCGG - Intergenic
1141564353 16:84891405-84891427 CTGCCCGGTGACTCTGCCATCGG + Intronic
1203050766 16_KI270728v1_random:873249-873271 CTGCCCAGAGGCTCTGCCCTGGG - Intergenic
1145977355 17:28992028-28992050 CAGGCCAGATACTCTGCCCTCGG - Intronic
1146287345 17:31582723-31582745 AAGTCCTGAGACTCTGCCATGGG + Intergenic
1147689841 17:42308383-42308405 CAGCCCATAGACAAAGCCTTGGG + Intronic
1149495414 17:57114367-57114389 TAGCCCAGAGACTTGCCCTTGGG + Intronic
1149598087 17:57875734-57875756 CAGCCCAGAGCCTCTGCCTCTGG + Intronic
1150281726 17:63932811-63932833 CAGCCAAGAGGCTCTGCTCTGGG - Intergenic
1150470553 17:65433641-65433663 CTGCCCAGAGACTCTGGATGAGG + Intergenic
1150856690 17:68759950-68759972 CAGCCCAGTGACTCAGCAATGGG - Intergenic
1151247089 17:72803330-72803352 CAGCCGGCAGAGTCTGCCTTTGG - Intronic
1151442096 17:74136067-74136089 CCTCCCAGAGACTCTCCCCTGGG + Intergenic
1151836654 17:76586399-76586421 CAGCCCAGAGACTGAGCTGTCGG - Intronic
1151964219 17:77422823-77422845 CACCCCAGAGACTCTGGTTCTGG - Intronic
1151978754 17:77497202-77497224 CTGCCCTCAGACTCTGCTTTTGG + Intronic
1152014530 17:77741787-77741809 CAGCCCTGAGACCCTGCCCTGGG + Intergenic
1152033083 17:77855679-77855701 CATCCCAGGGACTCTTCCTGGGG + Intergenic
1152448136 17:80358384-80358406 CAGGCCAGATACTCCGCCCTGGG + Exonic
1153745385 18:8173672-8173694 CAGGCCAGAGAGTCTGCTTCTGG + Intronic
1156706261 18:39886499-39886521 CAGCCAAGCGACTCTGCCTTAGG - Intergenic
1157535944 18:48457396-48457418 CAGCCCAGGGACTCCGTTTTGGG - Intergenic
1157593096 18:48847940-48847962 CAGCCCAGGGACTGTGCCTATGG - Intronic
1157712942 18:49862564-49862586 CTTCTCAGACACTCTGCCTTGGG + Intronic
1160348451 18:78153607-78153629 CAGCACAGAGACTCGGCGTGAGG + Intergenic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
1162105599 19:8367734-8367756 CATCTCAGAGGCTCTGCCTGGGG - Intronic
1163462980 19:17449889-17449911 CAACCCAGGGACTCTGTCATTGG + Intronic
1164480119 19:28605073-28605095 CAGCTCACAGACTGTTCCTTCGG + Intergenic
1164497183 19:28777337-28777359 CAGCCCAGTGAATCTGCCTCTGG - Intergenic
1165747186 19:38236822-38236844 CAGCCCAGTGACACTGACTTTGG - Intergenic
925090382 2:1150481-1150503 CAGCCCAGAGGGTCTTCCCTGGG + Intronic
925571271 2:5315151-5315173 CAGCCCAGAGAATCTGGCTAAGG - Intergenic
925578181 2:5381873-5381895 CCGCTCAGATACTCTCCCTTCGG + Intergenic
925900729 2:8507593-8507615 CAGGCCAGGGACTCAGCATTTGG + Intergenic
929468407 2:42167825-42167847 CAGGCCACACTCTCTGCCTTAGG - Intergenic
929545677 2:42854157-42854179 AAGGCCTGAGACTCTGCCCTGGG - Intergenic
929601227 2:43206088-43206110 CAGCCCAGAGACTGTGCTCTGGG + Intergenic
932317803 2:70797695-70797717 AGGCACAGAGACTCTGCCCTTGG + Intergenic
932332267 2:70904553-70904575 CAGCCCAGAGAGGCCGCTTTGGG - Intronic
932753612 2:74389247-74389269 CATCCTGGAGACTCTGACTTTGG - Intronic
933874549 2:86605932-86605954 CAAACCAGTGACTCAGCCTTAGG - Intronic
935098003 2:99965724-99965746 CAGCCCATAGGCTGGGCCTTGGG - Intronic
935744369 2:106177840-106177862 CACCCCAGAGTTTCTGCTTTGGG - Intronic
938842128 2:135173990-135174012 AAGCCCAGGGACTCTGCCGCTGG + Intronic
939380464 2:141428960-141428982 CAGCCCAGAGATTATGGTTTAGG - Intronic
941908872 2:170743288-170743310 CAGCATAGACTCTCTGCCTTTGG + Intergenic
942801565 2:179882104-179882126 CAGTTCAGATTCTCTGCCTTTGG + Intergenic
943944098 2:194036416-194036438 CAGCCCAAAGATACTACCTTTGG + Intergenic
944500598 2:200355284-200355306 CAGCCCAGAGGCTATGTCTGGGG - Intronic
945575680 2:211525719-211525741 CAGGCCTGAGACTCACCCTTCGG - Intronic
945590263 2:211720267-211720289 CAGCCCAGTCATTCTGTCTTTGG + Intronic
947363436 2:229369608-229369630 CAGCTCAGAGCATGTGCCTTAGG - Intronic
948075194 2:235160504-235160526 CAGCCCAGTGACACTGATTTTGG - Intergenic
948599472 2:239100150-239100172 CAGCCCAGAGACTCTGCCTTTGG + Intronic
948644202 2:239393555-239393577 CAGCCCCGAAACTCTGGCTCTGG + Intronic
948699402 2:239750761-239750783 CAGCCCAGGGACGCTGCCCGAGG - Intergenic
948756887 2:240165263-240165285 TAGCCCACAGACTCTGCATCAGG + Intergenic
1168853931 20:995639-995661 AAGCCCAGAGAGTCTGTCTCTGG - Intronic
1169165522 20:3420111-3420133 CAGCCAAGAGACTTTACCTGAGG + Intergenic
1170608857 20:17895307-17895329 CAGCACAGAGACTGTCCCCTGGG + Intergenic
1170621946 20:18003705-18003727 CAGCCCTCAGATTCTGCTTTTGG - Intronic
1172178408 20:32986344-32986366 CAGCCCAGGGAATCTGACCTTGG + Intronic
1172387584 20:34545028-34545050 CGGCCCAGAGAATATGCCTTGGG + Intergenic
1172992180 20:39044748-39044770 CAGCCCAGAAACTCTGCTTCTGG + Intergenic
1173666663 20:44767973-44767995 CAGCCCAGAAACACTGGCATGGG - Intronic
1173672193 20:44806338-44806360 CAGCCCTGACACTCTGCCTTGGG - Intronic
1173707028 20:45117718-45117740 CTGCCCAGCGTCTCTTCCTTTGG + Intergenic
1174008456 20:47429053-47429075 CCTCCCAGAGACTGTTCCTTGGG + Intergenic
1174160123 20:48544547-48544569 GAACCCAGAGAATCTGCCTCCGG - Intergenic
1174514380 20:51080256-51080278 CACCTATGAGACTCTGCCTTTGG - Intergenic
1174930156 20:54804756-54804778 AAGCCCAGAGTCTTTGCCTGAGG - Intergenic
1175409967 20:58760981-58761003 CAGCTCAGATGCTCTGCTTTAGG - Intergenic
1175988373 20:62775663-62775685 CAGCCCTGGGTCTCTGCCTCAGG + Intergenic
1176050115 20:63114559-63114581 CTGCCCAGAGCCTCTGCCTGAGG - Intergenic
1181419697 22:22789147-22789169 CATCCCAGGGACACAGCCTTTGG - Intronic
1181974623 22:26720161-26720183 CAGCCCAGGGACTCTGGCTAGGG + Intergenic
1184983742 22:48115084-48115106 CAGCCCTGAGGCTCTGGATTTGG + Intergenic
949339525 3:3013850-3013872 CAGCCCAGAGACACACCCTAGGG + Intronic
950528868 3:13540801-13540823 CAGCCCAGAGCCTGTGCCTGGGG - Intergenic
950570274 3:13795652-13795674 CAGCCCAGATAGTCTGGCTCTGG - Intergenic
951451123 3:22839810-22839832 CAGCTCAAAGACTTTGGCTTAGG + Intergenic
951522392 3:23621755-23621777 CACCCCAGAGCCTCTCCCTGGGG + Intergenic
954380139 3:50214986-50215008 CAGGCCAGAGACTGTCCTTTTGG + Intronic
954678805 3:52330491-52330513 CAGTGCAGAGGCTCTGCCGTGGG + Intronic
957112639 3:75984774-75984796 CAACCCAGAAAATCTGGCTTAGG + Intronic
960153502 3:114274861-114274883 CAGCCCTGAGACTCTCCCTTCGG + Intergenic
960446733 3:117758391-117758413 AAGACCTGAGTCTCTGCCTTCGG - Intergenic
960973531 3:123155722-123155744 CAGCCCTGAGACTCAGTCATGGG + Intronic
961649144 3:128408761-128408783 CAGCCTACAGACTCTGAGTTTGG - Intergenic
962327532 3:134448063-134448085 GAGCCCAGAGTCTCTGCATTGGG + Intergenic
963026247 3:140922314-140922336 GAGGCCACAGCCTCTGCCTTTGG - Intergenic
963548993 3:146697190-146697212 CAGCCCTGTGACTCTCCCTCAGG + Intergenic
964623311 3:158736132-158736154 AAGCCCAGATACCCTGCCTGGGG - Intronic
965466283 3:169034548-169034570 CAGCCCTGAGACATTCCCTTAGG - Intergenic
966139722 3:176742373-176742395 CATCCCAAAAACTCTCCCTTAGG + Intergenic
966970200 3:185038681-185038703 CAGCTCAGAGATTTTTCCTTGGG - Intronic
967083073 3:186068637-186068659 AAGCCAAGAAACTTTGCCTTTGG - Intronic
968866201 4:3213647-3213669 CAGGCCAGAGGCTCTTCCTTGGG - Intronic
969289635 4:6230439-6230461 CAGCCCAGCATCTCTGCCGTGGG + Intergenic
972637934 4:40900917-40900939 CAGACCAAACACTCTGCCCTAGG + Intronic
972784095 4:42311045-42311067 CAGCCCATAGCCTCTTCCATTGG - Intergenic
974022216 4:56701842-56701864 CAGCCTAGAGTCTCTGAGTTTGG - Intergenic
975039392 4:69726182-69726204 CAGCCTAGAGAGTCTTCCTTGGG + Exonic
975974794 4:80082302-80082324 CAGCCCAGATACTATGACATTGG + Intronic
976092166 4:81470522-81470544 CAGTTCAGAGACCCTCCCTTCGG + Intronic
976213973 4:82698404-82698426 CCCCCCAGAGACCCAGCCTTGGG + Intronic
976812599 4:89112177-89112199 CACCCCATAGCCTCTACCTTGGG + Intergenic
978611782 4:110549370-110549392 CATCCCAGAGAATCTGCAATAGG - Exonic
981257774 4:142683438-142683460 CAGCACAGAGTATCTGGCTTTGG + Intronic
981279990 4:142946235-142946257 CAGCGCAAACACTCTGCCTGGGG + Intergenic
982223443 4:153144049-153144071 CAGCCCACAGACGCAGCCCTTGG + Intergenic
983865108 4:172757177-172757199 TAGCCCACAGACTGTGCATTAGG - Intronic
984483143 4:180331646-180331668 CATCACAGAGACTCTGCAGTAGG - Intergenic
985618412 5:938400-938422 CAGCCCAGTGGCCCTGGCTTTGG + Intergenic
986674086 5:10168431-10168453 CAGCCCACAGCCTATGGCTTTGG + Intergenic
987827840 5:23056561-23056583 CAGCCCAGCCTCTCTGCCTTGGG + Intergenic
989518573 5:42373964-42373986 AAGCTAAGAGAATCTGCCTTAGG + Intergenic
989547503 5:42691605-42691627 CTGCCCACTGACTCTGACTTTGG - Intronic
990412492 5:55554735-55554757 CAGCCCAGTGAAACTGACTTAGG + Intergenic
991500776 5:67274536-67274558 CAGCTCAGTGAAACTGCCTTTGG - Intergenic
993666169 5:90699151-90699173 CAGCCCATAGATACTGCTTTTGG - Intronic
996646816 5:125827076-125827098 CAGCCCTGAGACCCTTCATTAGG - Intergenic
997346854 5:133198392-133198414 CACCCCCGAGACTCGGCCTAAGG + Exonic
997722862 5:136094341-136094363 CAGCCCAAACAATCAGCCTTTGG + Intergenic
1001674139 5:173498653-173498675 CAGCCCAAAGCCTCTGCCCAGGG - Intergenic
1001990509 5:176112410-176112432 CTGCCCAGAGGCTCTGCCCTGGG - Intronic
1002047958 5:176552652-176552674 CAGTCCAGAGCATCTGCCTCTGG - Intronic
1002226363 5:177725730-177725752 CTGCCCAGAGGCTCTGCCCTGGG + Intronic
1002267484 5:178045483-178045505 CTGCCCAGAGGCTCTGCCCTGGG - Intronic
1003038670 6:2667475-2667497 CAGCCATTAGACTATGCCTTTGG - Exonic
1003074824 6:2973822-2973844 CAGTTGAGAAACTCTGCCTTAGG - Intergenic
1006442961 6:34063381-34063403 CAGCCCAGTGTCACTGCCTTTGG - Intronic
1006795166 6:36727554-36727576 CTGCCCAGAGAGTCTGCATGAGG - Intronic
1007231049 6:40347977-40347999 CAGCCCACAGGGGCTGCCTTTGG + Intergenic
1012908916 6:105097627-105097649 CAACCAAGTGACTCTGTCTTTGG + Exonic
1013477268 6:110520686-110520708 CAGCCCAGTGATTCTGCCACGGG - Intergenic
1015022913 6:128498297-128498319 CAGCCCAGAGAATCTACATTTGG + Intronic
1015256423 6:131183892-131183914 CAGGCCAGAGCCTCTGCCCAAGG - Intronic
1015334587 6:132022643-132022665 AAGCCCAGAGCCTGTCCCTTTGG - Intergenic
1015810743 6:137159715-137159737 GACTCCAGTGACTCTGCCTTAGG + Intronic
1016409369 6:143765706-143765728 CAGCCCAAAGAAGCTGACTTGGG - Exonic
1017909928 6:158783840-158783862 CAGCCCAGAAGCTATGCCTGGGG + Intronic
1018637024 6:165871717-165871739 CTGCCCTGAGGTTCTGCCTTTGG - Intronic
1019320640 7:414015-414037 GAGCCCACAGAGGCTGCCTTTGG + Intergenic
1019362271 7:611016-611038 CAGACCAGGGGCTCTGCCCTCGG - Intronic
1019525994 7:1480792-1480814 CAGCACAGAGACCCAGCCTGGGG - Intronic
1019526987 7:1484920-1484942 CAGCACAGAGACCCTGCCCTGGG - Intronic
1019595847 7:1857947-1857969 CAGCCAAGGGACTCGGCCCTGGG - Intronic
1021482032 7:21128777-21128799 CAGCCCAGGGAGGCTGCCATTGG + Intergenic
1023357538 7:39382383-39382405 CAGCACAGAGACTCAGACCTGGG + Intronic
1023405893 7:39833578-39833600 CACCGCCGAGCCTCTGCCTTTGG - Intergenic
1024178229 7:46862324-46862346 AAGCCCACAGACTGTGCCTCTGG - Intergenic
1024374409 7:48620846-48620868 CAGCCCAGAGTGTTTGCCTCTGG - Intronic
1028709642 7:93892231-93892253 CAGCCCAGAGAGATAGCCTTGGG + Intronic
1028925180 7:96349840-96349862 CAGACAAGACAATCTGCCTTAGG + Intergenic
1029306556 7:99624121-99624143 CAGCCCAGATAGACTGCTTTGGG + Exonic
1029652763 7:101905097-101905119 CCACCCAGAGACACAGCCTTGGG - Intronic
1029918124 7:104232816-104232838 CATTCCAGAGACTCTCCCATAGG + Intergenic
1030391249 7:108931284-108931306 CAGACCTGAAACTCTTCCTTAGG + Intergenic
1030931970 7:115535827-115535849 TAGCCCTGATAATCTGCCTTAGG - Intergenic
1031669772 7:124528581-124528603 CAGCCCAGAGCTTCTGTCATGGG + Intergenic
1034238254 7:149589491-149589513 CTTCCCAGAGAGTCTGGCTTAGG - Intergenic
1034581751 7:152049980-152050002 CAGGCCTGAGACTCTCCCTTCGG + Intronic
1034970992 7:155419010-155419032 CAGACCAGAGACTGTCCCATGGG - Intergenic
1035057224 7:156043708-156043730 CAGCCCAGAGACATGGACTTCGG - Intergenic
1040530732 8:48264484-48264506 CAGCACAGAGAATCTGACTTAGG + Intergenic
1044432824 8:92128486-92128508 CAGAACTGAGACTCTCCCTTGGG + Intergenic
1046364077 8:113203315-113203337 CAGAGCAGAGACTCTGTCTCAGG - Intronic
1048314468 8:133351873-133351895 CTGCCCTGAGACTTTCCCTTTGG - Intergenic
1048981848 8:139706606-139706628 CAGCCCAGAGAGTCTGGCTGGGG + Intergenic
1049096480 8:140551271-140551293 CAGGCCGGAGCCTCTGCCTGTGG + Intronic
1049278679 8:141732930-141732952 CAGCCCCGAGACTCAGCCTCGGG - Intergenic
1049591859 8:143466320-143466342 GAGCCCAGGGACACTGCCTGTGG - Intronic
1049611623 8:143558621-143558643 CAGCCCAGGGGCCCGGCCTTTGG + Intronic
1052340613 9:27360939-27360961 CAGCCCATAAACTCTGCATGTGG - Intronic
1055898130 9:81203310-81203332 CAGCCCCCAGCCTCTTCCTTTGG + Intergenic
1057185066 9:93052906-93052928 CATCAGAGAGACTCAGCCTTAGG - Intergenic
1059352272 9:113673851-113673873 CAGGGCACAGACTCTGCCTTAGG - Intergenic
1059470432 9:114501142-114501164 CAGACCAGGGATGCTGCCTTAGG - Intronic
1059619333 9:115986363-115986385 CAGTCCTCAGACTCTGCCTTGGG - Intergenic
1061451680 9:130670370-130670392 CACCCCAGAGACTCTCCCAGAGG + Intronic
1061544110 9:131293910-131293932 CAGCCCAGAGACTGCCCCTGGGG - Intronic
1062076845 9:134594351-134594373 CAGCCCAGAGACTCCGCCCCAGG + Intergenic
1062145146 9:134984922-134984944 CAGCCCACAGTCTCAGCCATCGG - Intergenic
1062179082 9:135181077-135181099 CTGCCCAGTGGCTCGGCCTTTGG - Intergenic
1062729108 9:138098669-138098691 CTGCTCTGAGACTCTGGCTTTGG - Intronic
1186440209 X:9579593-9579615 CACCACAGAGCCTCTGCGTTTGG + Intronic
1187033587 X:15513804-15513826 CAGACCTGAGACTCAGCCTCAGG - Intronic
1187265267 X:17726333-17726355 CAGCCCAGGCTGTCTGCCTTGGG - Exonic
1189202576 X:39210173-39210195 CAGCCCATAGTCTCTTCCTCAGG - Intergenic
1190284888 X:48955393-48955415 GAGCCCTGAGACTCTTCCCTTGG - Intronic
1193772118 X:85599999-85600021 CAGCCCAGAGATACTGATTTTGG + Intergenic
1194948101 X:100092124-100092146 CAGCACAGACACTCTGTCCTGGG + Intergenic
1195045993 X:101055122-101055144 CAGGCCAGAGAATTTACCTTTGG + Intergenic
1195759960 X:108235557-108235579 CAGGCCATAGACTCTGGCCTGGG - Intronic
1196243421 X:113370076-113370098 CCACCCCTAGACTCTGCCTTGGG - Intergenic
1196287167 X:113896318-113896340 CAGCTCAGAGATTTTGCCCTTGG + Intergenic
1196604767 X:117644602-117644624 GAGCCTAGAGACTCTGTCTCTGG - Intergenic
1197675587 X:129326464-129326486 CAGCCCACAGACTCTCCACTGGG + Intergenic
1200951554 Y:8903454-8903476 AAGCCCAGGGCCTCTGCCTACGG - Intergenic
1201291123 Y:12421385-12421407 CAGCCCCCAGCCTCTGCCTCTGG + Intergenic