ID: 948599754

View in Genome Browser
Species Human (GRCh38)
Location 2:239101516-239101538
Sequence GGGGTTGCAGGGGCAAGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 859
Summary {0: 1, 1: 1, 2: 8, 3: 69, 4: 780}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948599754_948599768 30 Left 948599754 2:239101516-239101538 CCTCTCCTTGCCCCTGCAACCCC 0: 1
1: 1
2: 8
3: 69
4: 780
Right 948599768 2:239101569-239101591 GCCTTCCTAGGGTCCTGCTCAGG 0: 1
1: 0
2: 0
3: 23
4: 230
948599754_948599765 19 Left 948599754 2:239101516-239101538 CCTCTCCTTGCCCCTGCAACCCC 0: 1
1: 1
2: 8
3: 69
4: 780
Right 948599765 2:239101558-239101580 TCTCCCTCTCTGCCTTCCTAGGG 0: 1
1: 0
2: 2
3: 66
4: 636
948599754_948599764 18 Left 948599754 2:239101516-239101538 CCTCTCCTTGCCCCTGCAACCCC 0: 1
1: 1
2: 8
3: 69
4: 780
Right 948599764 2:239101557-239101579 TTCTCCCTCTCTGCCTTCCTAGG 0: 1
1: 0
2: 5
3: 109
4: 859

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948599754 Original CRISPR GGGGTTGCAGGGGCAAGGAG AGG (reversed) Intronic
900135449 1:1115497-1115519 GGGGTTCTCGGGGCAGGGAGGGG - Intronic
900141741 1:1141641-1141663 GGGGTTGGAGGGGCACTGTGGGG - Intergenic
900394306 1:2446872-2446894 GGGGCTGCAGGGGCAGGAGGAGG - Intronic
900471420 1:2856814-2856836 GGGGAGGCAGGGGCACAGAGAGG + Intergenic
900619463 1:3580263-3580285 GGGGGTGCAGGGGGGAGGGGTGG + Intronic
901131255 1:6963341-6963363 GGGGCGGCGCGGGCAAGGAGGGG - Intronic
901357203 1:8661324-8661346 GAGGTTGAAGGGGCAGGGGGAGG + Intronic
901780970 1:11594232-11594254 GTGGTTGCTGGGGAAGGGAGAGG + Intergenic
902272727 1:15316309-15316331 AGGGTTGTCGGGGGAAGGAGGGG - Intronic
902560290 1:17273147-17273169 GGGGCTGGAGGCTCAAGGAGGGG - Intronic
902707582 1:18216311-18216333 TGAGTTGGAGGGGCAAAGAGAGG + Intronic
902974862 1:20081295-20081317 GAGGTGGCAGAGGCATGGAGTGG - Intronic
903168707 1:21538784-21538806 GGGCTTGCAGTGGCAGGGAGGGG - Intronic
903268907 1:22175559-22175581 GGGGTTCCTGGGGAGAGGAGTGG + Intergenic
903306540 1:22417087-22417109 GGGGCTGAAGGGGCAGGTAGGGG - Intergenic
903322839 1:22553058-22553080 TGGGTGGCGGGGGCAAGGGGGGG - Intergenic
903365852 1:22805096-22805118 GAGGTGGTGGGGGCAAGGAGAGG - Intronic
903686648 1:25136715-25136737 GGGGTTGTAGGGGCCAGAAAAGG - Intergenic
904371443 1:30050024-30050046 GGGGTTGGAGGGGTGAGCAGGGG - Intergenic
904382640 1:30121777-30121799 GGGGTTGCACAGGGAAGGAGGGG - Intergenic
904600706 1:31671222-31671244 GGAGTCACAGGGGCATGGAGAGG + Intronic
904606240 1:31699408-31699430 GAGGTTGAAGAGGCAAGCAGGGG + Intronic
904806837 1:33137961-33137983 GAGGTGGCAGGGGAAAGGGGTGG + Intergenic
904832476 1:33313996-33314018 GGATTTGTAGGGGCAGGGAGTGG - Intronic
905300410 1:36982815-36982837 GGGGGTGGTGGGGGAAGGAGGGG + Intronic
905675128 1:39819424-39819446 GGAGTTGCAGGGACAAGGAGAGG + Intergenic
905893942 1:41533354-41533376 GTGGTGGAAGGGGCTAGGAGAGG - Intronic
906061496 1:42952057-42952079 GGGCAGGCAGGGGCAAGGATGGG + Intronic
906119284 1:43377518-43377540 GGAGCTGCAGAGGGAAGGAGAGG + Intergenic
906279843 1:44545652-44545674 GGGTTCACAGGGCCAAGGAGAGG + Intronic
906287547 1:44597353-44597375 GGGGGAAAAGGGGCAAGGAGGGG + Intronic
906477590 1:46180435-46180457 GGGGCAGCAGGGTCAAGGAGAGG + Intronic
906544172 1:46609780-46609802 GGGGTTGCTGGGGGAAGGCCAGG - Intronic
906563440 1:46778465-46778487 GGGGTTGCAGGGGGCTGGTGGGG + Intronic
906616993 1:47240262-47240284 GAGGTTGCAGTGAGAAGGAGAGG + Intergenic
907045493 1:51297754-51297776 TGGCTTGCAGGGGACAGGAGTGG - Intronic
907089242 1:51709301-51709323 GGGCTTGCATGGGGAAGCAGTGG - Intronic
907239174 1:53071153-53071175 GGGACTGCAGGGCCAAGGAGGGG + Intronic
907447749 1:54519865-54519887 GGGGTGGCAGGAGCACAGAGAGG - Intergenic
907880651 1:58546573-58546595 GGGGGCGCCCGGGCAAGGAGTGG - Intronic
908441815 1:64162878-64162900 GGGGATGTAGGGGCAAGGGAAGG - Intronic
908568989 1:65388898-65388920 GGAGTTGCTGGGGCCAGGATAGG + Intronic
909975504 1:82042048-82042070 GGGGCTGGAGGAGGAAGGAGCGG - Intergenic
910001241 1:82344875-82344897 GGGGATGCAGAGGCCAGGAGCGG + Intergenic
910103507 1:83604438-83604460 TGGGTTGCAGGGGAAAGAGGAGG - Intergenic
910941500 1:92539866-92539888 GGGGTTGGAGGGGAAGAGAGGGG - Intronic
911079683 1:93916337-93916359 GGTGTTGCAGGGGCGGGGGGCGG - Intergenic
911694262 1:100870729-100870751 GGGGTAGGAGGGACAGGGAGTGG - Intergenic
911808461 1:102242610-102242632 GGGGGGTCGGGGGCAAGGAGAGG - Intergenic
912607225 1:111003541-111003563 GGAGGTGGAGGGGCAAGGGGAGG + Intergenic
912697779 1:111854539-111854561 GGGGTCAGAGGGGCAAGGAAAGG + Intronic
912852740 1:113141131-113141153 GGAGTGGCAGGGGGAAGGAAGGG - Intergenic
913274092 1:117121401-117121423 TGGGATGCAGTGGAAAGGAGGGG - Exonic
913328781 1:117650361-117650383 GGGTTGGCAGGGGCAGGGGGTGG + Intergenic
913485341 1:119328143-119328165 GGGTTAGCAGGGGCCTGGAGTGG + Intergenic
915224990 1:154405541-154405563 GGGGTGGCAGGGGCGGGGCGGGG - Exonic
915250820 1:154587155-154587177 GTGGTTGCCAGGGCCAGGAGTGG - Intronic
915310189 1:155002610-155002632 GGGGTGGCAGGGGCGGGGGGAGG + Exonic
915555058 1:156656764-156656786 GGGGTAGCAGGAGCCTGGAGGGG - Intronic
915581022 1:156813602-156813624 GGAGTCAGAGGGGCAAGGAGAGG - Intronic
915902243 1:159855287-159855309 GGGATTGCAGGGGCCTGGAGGGG - Exonic
917263780 1:173197673-173197695 CCTGTTGCAGGGGCAAGGGGAGG + Intronic
917531914 1:175843171-175843193 GGGGTTGCTGGGGAGAGAAGGGG + Intergenic
917685510 1:177411848-177411870 GGGGTTTCAGGTATAAGGAGGGG - Intergenic
918232458 1:182548622-182548644 GGGGTTCTGGGGGCCAGGAGAGG + Intronic
919829312 1:201529184-201529206 GGGGATGGAGGGGGAAAGAGAGG - Intergenic
920199712 1:204252083-204252105 GGAGGGGCAGGGGCAGGGAGAGG - Intronic
920687806 1:208122832-208122854 GTGGTTGCCAGGGGAAGGAGAGG + Intronic
920852489 1:209637873-209637895 GGGGTGGCAGTGGATAGGAGAGG - Intronic
922419860 1:225452202-225452224 GCGCTTGCAGGGGCCAGCAGCGG + Intergenic
923290756 1:232543391-232543413 GAGGTGGAAGGGGCCAGGAGAGG - Intronic
923767126 1:236902340-236902362 GGTGTTACAGAGGCAAGAAGAGG - Exonic
924282557 1:242452843-242452865 GGGGGTGCAGAGGAAAGGACTGG - Intronic
924807177 1:247370935-247370957 GGGGGGGCGGGGGCAAGGCGGGG - Intergenic
1063121343 10:3106986-3107008 GGAGGGGCAGGGGCGAGGAGAGG - Intronic
1063368235 10:5504387-5504409 GGGGGTGCAGGAGCTAGCAGGGG - Intergenic
1063415515 10:5869760-5869782 GGGGTTGCTGGGGGGAGGGGTGG + Intronic
1063602370 10:7493946-7493968 TTGGATGCAGGAGCAAGGAGGGG + Intergenic
1064602410 10:17007180-17007202 TGGGTTGCAGGGGGAGGGGGTGG - Intronic
1064731156 10:18332034-18332056 GGGGATGAAGGGGCAGAGAGAGG + Intronic
1066059046 10:31706290-31706312 GGGGTGGCATGGGGAAGGGGAGG - Intergenic
1066611937 10:37257965-37257987 GGGGTTGGAGGGGAAGGGAAGGG + Intronic
1067552427 10:47245165-47245187 GGGGTGGCAGGGGGAGGGTGCGG + Intergenic
1067946885 10:50695280-50695302 GGGTTTTCAGGGGAGAGGAGGGG + Intergenic
1068783117 10:60943485-60943507 GGGGTTGCGGGGGAGGGGAGGGG + Intronic
1069028721 10:63572463-63572485 GGAGGGTCAGGGGCAAGGAGAGG - Intronic
1069277740 10:66613358-66613380 GGTGAGGCAGGGGCAGGGAGTGG - Intronic
1070549939 10:77483134-77483156 GGGTTTAGAGGGGCCAGGAGAGG + Intronic
1070824858 10:79385161-79385183 GGGGCTGCAGGGGCCAGCAGGGG + Exonic
1070882196 10:79860273-79860295 GGGTTTTCAGGGGAGAGGAGGGG + Intergenic
1070920979 10:80186282-80186304 GGGACTGAAGGGGGAAGGAGGGG + Intronic
1071525533 10:86355883-86355905 GGGGCAGCAGGGGCAAGACGTGG + Intronic
1071648765 10:87376584-87376606 GGGTTTTCAGGGGAGAGGAGGGG + Intergenic
1071997227 10:91161159-91161181 GAGGCTGGAGGGGCAAAGAGAGG - Intergenic
1072034489 10:91551883-91551905 GGGCTTCCATGGGGAAGGAGAGG + Intergenic
1072450371 10:95534714-95534736 GGGGTTGCAGTGACAAGGGAGGG + Intronic
1072918032 10:99551937-99551959 GGGGTTGGAGGGGGAAGTAGGGG + Intergenic
1073051347 10:100669428-100669450 AGGGTTTGAGGGGCAAGCAGTGG - Intergenic
1073053431 10:100684027-100684049 GGGGCTGCAGGGGGGAGGGGAGG + Intergenic
1073327234 10:102650015-102650037 GTGGTGGGAGGGGCAAGAAGAGG - Intronic
1073616798 10:105004402-105004424 GGGCCTGAAGGGGCAAGGACAGG + Intronic
1073697741 10:105889869-105889891 GGGGTATTGGGGGCAAGGAGAGG - Intergenic
1074108289 10:110404819-110404841 GGGGTGGAAGGGGCCAGGATGGG - Intergenic
1074496012 10:113980756-113980778 GTGGTTGCAGAGGGAAGGATGGG - Intergenic
1075251129 10:120874957-120874979 GGGGATTGAGGGGCAAGGGGAGG - Intronic
1076799297 10:132813282-132813304 GGGGCTGCAGGGGCAGGGCTGGG - Intronic
1076921187 10:133455597-133455619 GGGGTTGCAGAGGCCTGGAGAGG + Intergenic
1077166027 11:1139264-1139286 GGGGTGGCTGGGGGAGGGAGGGG + Intergenic
1077182942 11:1224538-1224560 GGGGCTGTAGGGCCAGGGAGGGG + Intronic
1077212832 11:1381164-1381186 GAAATTGCAGGGGCAGGGAGTGG + Intergenic
1077233851 11:1470586-1470608 AGGGTGGCAGGGTCAAGGTGTGG - Intronic
1077283230 11:1754731-1754753 GAGCATGGAGGGGCAAGGAGGGG + Intronic
1077331724 11:1986941-1986963 GGGGGTGCAGGCGGCAGGAGCGG + Intergenic
1077349910 11:2088040-2088062 GGGGTACCAGGGGCTAGGGGAGG + Intergenic
1077532483 11:3103727-3103749 AGGGTTGCAGAGGCAGGAAGGGG - Intronic
1079441867 11:20523055-20523077 TGAGTTGGAGGGGCAAGGAGTGG + Intergenic
1079566095 11:21885090-21885112 GTAGTTGCAGGGGGAAGCAGGGG + Intergenic
1081582069 11:44359392-44359414 GAGGTTGCAGAGACAGGGAGAGG + Intergenic
1081634392 11:44711273-44711295 GGGGTGGGAGGAGCAACGAGTGG + Intergenic
1081920952 11:46775822-46775844 GGGGTTAGCGGGGCAAGGGGAGG + Intronic
1082973077 11:59043804-59043826 GGGGTTCAAGGGGGAAGGGGAGG + Intergenic
1083327978 11:61883216-61883238 GTGGTTGCCGGGGCAGGGGGAGG - Intronic
1083329293 11:61890185-61890207 GGGGTGGAAGGGGAAAAGAGGGG + Intronic
1083712641 11:64558704-64558726 TGGGAGGCAGGGGCAGGGAGTGG - Intronic
1083953119 11:65967603-65967625 GGGGTGGGAGGGGCAGGGACAGG + Intronic
1083958806 11:66002613-66002635 GGGGTTGCGGGGAGAAGGGGAGG + Intronic
1083993895 11:66262795-66262817 GGGGCTGCAGGGCCAAGGGCAGG - Exonic
1084560533 11:69903162-69903184 GGGGGTTCAGGTGCAAGGAAGGG + Intergenic
1085454119 11:76656188-76656210 GGGGCTGCAGGGCCAAGGGGAGG + Intergenic
1085809136 11:79664781-79664803 ATGGTTGCAGGGGGCAGGAGGGG + Intergenic
1085977241 11:81672777-81672799 GGGGTTGCAGTGGGGAGGTGGGG + Intergenic
1086132262 11:83413155-83413177 GGGGGTGCAGGGGAAAGGGAGGG - Intergenic
1086641270 11:89159624-89159646 GATGTTGCAGGGGAGAGGAGGGG - Intergenic
1086927578 11:92656966-92656988 GGGGGTGCAGGGGTAAGGTGGGG + Intronic
1086947145 11:92854282-92854304 GAGCTTGCAGGGGAAAGGGGTGG + Intronic
1087004458 11:93455360-93455382 GGGGTTGGTGGGGCTAGGGGAGG + Intergenic
1088792997 11:113242813-113242835 GTGGTTGCAAGGGCAGGAAGAGG - Intronic
1089206999 11:116772641-116772663 GGGGCGGCAGAGGCAAGGCGGGG + Intronic
1089369852 11:117947574-117947596 GGGGGTGAAGGGGCAGGTAGGGG + Intergenic
1090001208 11:122960441-122960463 GGTGGTAGAGGGGCAAGGAGTGG - Intergenic
1090166631 11:124555832-124555854 GGGGGTTGAGGGGCAAGGGGAGG - Intergenic
1090272792 11:125399743-125399765 GGAGTTGGAGGGCCCAGGAGGGG - Intronic
1090684101 11:129096529-129096551 GGGGTGGCAGGGGCGGGGCGGGG - Intronic
1090960007 11:131547771-131547793 GGAGTTGCGGGGACTAGGAGGGG - Intronic
1091010875 11:131999158-131999180 GAGGGTGCAGAAGCAAGGAGGGG + Intronic
1091023111 11:132118925-132118947 GGGGGTGAAGGGGCTGGGAGGGG + Intronic
1091239690 11:134044089-134044111 GGAGCTGCATGGGGAAGGAGAGG - Intergenic
1091363412 11:134996709-134996731 GGGGTTGCGGGGGCAGGGACCGG + Intergenic
1202814705 11_KI270721v1_random:42117-42139 GGGGGTGCAGGCGGCAGGAGCGG + Intergenic
1091488988 12:916601-916623 GGGGCCGCAGAGGAAAGGAGGGG + Intronic
1091618168 12:2065879-2065901 GGTTTTGCAGGGGGAAGAAGTGG + Intronic
1091628584 12:2141163-2141185 GGGGTTGGAGGGGCAGACAGGGG + Intronic
1091749311 12:3012573-3012595 GGAGTGGCAGGGGCATGGGGGGG + Intronic
1091815819 12:3437075-3437097 GGGGTTGAAGGGGTAAGGGGTGG - Intronic
1092006708 12:5076290-5076312 CAGGCTGCAGGGGCAGGGAGAGG + Intergenic
1092067048 12:5599406-5599428 GGGGTTGAAGGGGGAAGGTAGGG - Intronic
1092085165 12:5751102-5751124 GAGGTTGCACGGGGAAGGGGAGG + Intronic
1092160567 12:6313266-6313288 GGGGGTGCATGGACAAGGCGTGG - Intronic
1092209815 12:6638913-6638935 GGGGGTGCTGGGAGAAGGAGGGG + Intronic
1092230259 12:6772292-6772314 GGTGGGGCAGGGGCGAGGAGGGG + Intergenic
1092376282 12:7958163-7958185 GGGGTTGGAGGAGTAAGGAAGGG - Intergenic
1092651737 12:10642135-10642157 GCTCTTGCAGGGACAAGGAGAGG - Intronic
1092932075 12:13325474-13325496 GGGATTTCAGGGGCCAGGTGTGG - Intergenic
1093234347 12:16587807-16587829 GGGGTTTCAGGGGGAGGGAGAGG + Intronic
1095826001 12:46531069-46531091 GGGCCTGCAAGGGCAAGGTGGGG - Intergenic
1096618178 12:52846409-52846431 GGGGCTGGAGGAGGAAGGAGGGG - Intronic
1096673595 12:53214610-53214632 GTGGGTGGAGGCGCAAGGAGAGG + Intronic
1096814851 12:54195681-54195703 GTTGTGGCAGGGGCTAGGAGAGG - Intergenic
1097107302 12:56633346-56633368 GGGGGTGCTGGGGGGAGGAGAGG - Intronic
1097234448 12:57529700-57529722 GGTGTTGGAGGGGTAAGGGGAGG - Exonic
1097939071 12:65283976-65283998 GAGATGGCAGGGGGAAGGAGAGG + Intronic
1099901523 12:88716439-88716461 GTCTTTGCAGGGGAAAGGAGGGG + Intergenic
1101120258 12:101571759-101571781 GGGGTTGAAAGGGAAAGAAGAGG - Intronic
1101190606 12:102328653-102328675 GGGGCTGCAGGGGCCAGGGAAGG + Intergenic
1101602717 12:106224460-106224482 GGGCTTGCTGAGGTAAGGAGGGG - Intergenic
1101751502 12:107586139-107586161 GACGTTGCAGGGGCAGGGACAGG + Intronic
1101934789 12:109048438-109048460 GGGGTTGAAGGGGGGTGGAGGGG + Intronic
1103397514 12:120619378-120619400 GGGTTTGCAGGAGGAAGGGGAGG + Intergenic
1103409838 12:120703093-120703115 TGGCTTGCAGGGGTAGGGAGGGG + Intergenic
1103451322 12:121031405-121031427 AGGATGGCAGGGGCAAGGAGAGG - Intronic
1103518228 12:121521103-121521125 GGGGTGGGAAGGGCAAGGAGAGG + Intronic
1103723084 12:122985032-122985054 GGGATTGCCGGGGCCAGGTGAGG + Exonic
1103905534 12:124325558-124325580 GGGGTTGTAGGGGAATGGCGTGG + Exonic
1103914606 12:124369832-124369854 GGGGCTGCAGGGGAGAGGACGGG + Intronic
1103996176 12:124831650-124831672 GGGGTTGAGGGGACAGGGAGTGG - Intronic
1104785301 12:131444807-131444829 GGGGATGGGGGGGGAAGGAGCGG - Intergenic
1104819490 12:131666659-131666681 GGGGCTGCAGGGGCCGGGAAGGG + Intergenic
1104857764 12:131909903-131909925 GGGGATGCTGGGGCAAGAGGAGG - Exonic
1104919555 12:132283481-132283503 GGAGGTTCCGGGGCAAGGAGGGG - Intronic
1105465073 13:20632360-20632382 GAGGTTGCAGGGCCAAGGAAGGG + Intronic
1107192686 13:37608353-37608375 GGGGGTTGAGGGGCAAGGGGAGG + Intergenic
1108282755 13:48876082-48876104 GGGGTGCCAGGGGCAAGCAGTGG - Intergenic
1111271571 13:85893327-85893349 AGGTTTGGAGGGGCCAGGAGTGG + Intergenic
1111276161 13:85950197-85950219 GAGGCTGCAGGGGCAAGATGAGG - Intergenic
1111396026 13:87671627-87671649 GGGGTTTCTGGGGGAAGGGGGGG - Intergenic
1112375659 13:98837757-98837779 GGGGTGGGAGGGGGAAGGAAGGG + Intronic
1112490827 13:99861794-99861816 GGTGGTGCACCGGCAAGGAGGGG + Intronic
1112503589 13:99959854-99959876 GGGGGTGCAGAGGGAAGAAGAGG + Intergenic
1112765186 13:102734255-102734277 GCAGATGCAGAGGCAAGGAGTGG - Exonic
1113201260 13:107868543-107868565 GGTCTGGCAGGGGCAAGGGGCGG - Intergenic
1113596917 13:111540034-111540056 GGGGGTGCTGGGGACAGGAGTGG - Intergenic
1113657533 13:112077857-112077879 GGGGCTGCAGGGGCAGGCATGGG - Intergenic
1113772432 13:112918575-112918597 GGGGATGCAGGGGCGTGGGGTGG + Intronic
1113891604 13:113738655-113738677 GGGCTTGGAGGGGCTATGAGTGG + Intergenic
1114613957 14:24058661-24058683 GGAGCTGCAGGGACAAGGTGAGG - Exonic
1115631577 14:35251022-35251044 GGGGATTCAGGGGAAAAGAGTGG - Intronic
1115773210 14:36687761-36687783 GAGGTGGCAGTGGCCAGGAGAGG - Intronic
1116167191 14:41349540-41349562 TGGGTTCCAGGAGCAGGGAGAGG - Intergenic
1116962262 14:50978445-50978467 GGCCTTGCATGGGCAAGGAATGG - Intronic
1117631447 14:57696918-57696940 GGGGTTGTGGGGGAAAGGGGAGG + Intronic
1118935678 14:70285685-70285707 GGGGATGCCAGGGCAAGGAAAGG - Intergenic
1119322323 14:73739360-73739382 AGGGTTGCAGGGGCAGTGACTGG + Exonic
1119381742 14:74233597-74233619 TGGGGTGCAGGGGCAGGGGGTGG - Intergenic
1119516794 14:75254706-75254728 GGGGTGGCAGTGCCAGGGAGTGG - Intronic
1119948459 14:78719549-78719571 GGGTTGGCAGAGGCCAGGAGTGG + Intronic
1121325607 14:93018023-93018045 GGGGTTGCAGGGGCAGGCAGCGG - Intronic
1121509645 14:94502859-94502881 GGGGTTTCTGGGGCAGGAAGGGG - Intronic
1121509653 14:94502878-94502900 GGGGTTCCTGGGGCAGGAAGGGG - Intronic
1121519540 14:94576673-94576695 GGGTGTCCTGGGGCAAGGAGAGG - Intronic
1121563671 14:94893174-94893196 GGGGTGGGAGGGGGAAGGGGGGG - Intergenic
1121605662 14:95238112-95238134 GGGGCTGGAGGGGCAGGCAGGGG - Intronic
1122023519 14:98858636-98858658 GGAGGTGCTGGGGCAAGGGGAGG - Intergenic
1122055636 14:99096368-99096390 AGTGGTTCAGGGGCAAGGAGAGG + Intergenic
1122056467 14:99101663-99101685 CGGGTTGCGGGGGGCAGGAGGGG - Intergenic
1122187230 14:100009186-100009208 GGGGTTGCATGGTCAAGCATTGG + Intronic
1122250335 14:100434716-100434738 GGGATTGGAGTGGAAAGGAGGGG - Intronic
1122324761 14:100875554-100875576 AGGGGTGCATGGGGAAGGAGGGG - Intergenic
1122739779 14:103865484-103865506 GGGGTTGGGGAGGCAAGGGGAGG + Intergenic
1122819709 14:104335342-104335364 TGGGCTGCAGGGACAGGGAGTGG - Intergenic
1122897714 14:104768775-104768797 GGGGCTGCAGGGGGCGGGAGGGG - Intergenic
1123452304 15:20376403-20376425 GGGGGTTGAGGGGTAAGGAGAGG + Intergenic
1124053117 15:26217411-26217433 GGGGGTGGGGGGGCAAGGGGAGG + Intergenic
1124114784 15:26831164-26831186 GGGAGTGCAGGTGCACGGAGCGG - Intronic
1124243447 15:28050931-28050953 GGGGGTGCAGGGCAGAGGAGGGG - Intronic
1124244314 15:28056748-28056770 GGACTTGCAGGGGCAGGGATAGG - Intronic
1124417858 15:29488943-29488965 TGGCTTCCAGGGGCTAGGAGAGG + Intronic
1124495822 15:30186285-30186307 GGGGCTGGGGGGGGAAGGAGGGG - Intergenic
1125323794 15:38515761-38515783 GGGGGTGCGGGGGCGGGGAGAGG - Intronic
1125531419 15:40415963-40415985 GAGGAAGCAGGGGCATGGAGAGG - Intronic
1125612132 15:40978744-40978766 GGGGTTGGTGGGACAAGGAGTGG - Intergenic
1125728462 15:41880109-41880131 AGGGAGGCAGGGGCAAGGCGAGG + Intronic
1126103786 15:45135064-45135086 GGGGGTGCTAGGGCAAGCAGAGG - Intronic
1126665942 15:51076740-51076762 GGGGTGGCAGGGGCAGGGCAGGG - Intronic
1127347998 15:58120429-58120451 GGGGTTGCAGGAGCAAGGAAAGG - Intronic
1127572258 15:60255092-60255114 GGGGGTGGGGGGGCAAGGGGTGG + Intergenic
1127833287 15:62769632-62769654 GGGGTGGCTAGGGCAAGGTGAGG - Intronic
1127964629 15:63914473-63914495 GGGCTTGCAGGTGCACAGAGTGG - Intronic
1128091500 15:64922101-64922123 GGGGCTGGAGGGGCAAGCAGGGG - Intronic
1128542123 15:68543526-68543548 GGGGTGGGAGGAGGAAGGAGGGG - Intergenic
1128549117 15:68586407-68586429 GAGGTAGCAGGTGAAAGGAGGGG + Intronic
1128632975 15:69284051-69284073 GGTGTTGCAGGAGAGAGGAGAGG + Intergenic
1128689875 15:69715509-69715531 GGGATCTCAGGGGTAAGGAGGGG - Intergenic
1128711049 15:69872278-69872300 GGGCATGCAGGGGCCAGGATGGG - Intergenic
1128743373 15:70097739-70097761 GGGTTTGCCGGGGCGCGGAGAGG - Exonic
1128764558 15:70243255-70243277 GGGCTGGCAGGGGCAGGGTGGGG - Intergenic
1128767724 15:70261314-70261336 GGGGCTGGAGGGACAGGGAGAGG + Intergenic
1128780014 15:70353102-70353124 GTGGTTGCAGGGGCTCGGGGAGG - Intergenic
1128792832 15:70445562-70445584 TGGGTCCCAGGGGCAAGCAGGGG - Intergenic
1129153191 15:73702170-73702192 GGGTTAGCAGGGGCAGGGAGCGG + Intronic
1129206047 15:74037566-74037588 GGTGAAGAAGGGGCAAGGAGGGG - Intronic
1129319682 15:74767692-74767714 GGGGCAGCAGGGACTAGGAGGGG - Intergenic
1129430555 15:75498367-75498389 GTGGTTGCAGGGGTTAGGAATGG + Intronic
1129468462 15:75737625-75737647 GTGGCTGCAGGGGCAGGGATGGG - Intergenic
1129608794 15:77037557-77037579 GATGTGGCAGGGGCAAGAAGGGG + Intergenic
1129623614 15:77173598-77173620 GGGGTTGATGGGGAAAGGAGAGG - Intronic
1129631729 15:77267455-77267477 GAGGTAGCAGGGGCATGAAGTGG - Intronic
1129727110 15:77906871-77906893 GTGGCTGCAGGGGCAGGGACGGG + Intergenic
1129883042 15:79019490-79019512 GCCCTTGCAGGGGCCAGGAGGGG - Intronic
1130118323 15:81024740-81024762 GTGGAGGCAGGGGGAAGGAGGGG + Intronic
1130259014 15:82339589-82339611 GGGGTTGTAGGGACATGGTGGGG + Intergenic
1130462002 15:84166829-84166851 GGGGTTGTAGGGACATGGTGGGG - Intergenic
1130473621 15:84245751-84245773 GGGGTTGTAGGGACATGGTGGGG - Intergenic
1130481036 15:84359815-84359837 GGGGTTGTAGGGACATGGTGGGG - Intergenic
1130490676 15:84427944-84427966 GGGGTTGTAGGGACATGGTGGGG + Intergenic
1130502263 15:84506714-84506736 GGGGTTGTAGGGACATGGTGGGG + Intergenic
1130595905 15:85250352-85250374 GGGGTTGTAGGGACATGGTGGGG - Intergenic
1131054158 15:89365819-89365841 GGGGCTGCGGAGGCAGGGAGGGG - Intergenic
1131154036 15:90063852-90063874 TAGGCTGCAGGGGAAAGGAGAGG + Intronic
1131189149 15:90300397-90300419 GGGGTGGCAGGGACATGGTGGGG - Intronic
1131544527 15:93305063-93305085 GAGATTGCTGGAGCAAGGAGAGG + Intergenic
1131586145 15:93695010-93695032 GGGGATTCAGGGGGAAAGAGTGG - Intergenic
1132224671 15:100131218-100131240 GGGGGTTGAGGGGCAAGGGGAGG + Intronic
1132242045 15:100265611-100265633 GTGGTTGGAGGCACAAGGAGTGG + Intronic
1132318633 15:100909038-100909060 GGGTTTGCACGCGCATGGAGGGG - Intronic
1132553211 16:561602-561624 CGGGCTGCAGGGGCAGGCAGAGG - Intronic
1132597488 16:760053-760075 GGGGTTTCAGGGGCAGGGAGGGG + Intronic
1132665086 16:1077906-1077928 GGGGTTCCAGGGCCTGGGAGGGG + Intergenic
1132990006 16:2787487-2787509 GGGGCTGCAGGGGCAGCCAGTGG - Intronic
1133248722 16:4466177-4466199 GGGCTTTCTGGGGCAAGAAGTGG + Exonic
1133277244 16:4646462-4646484 GGGCTTGCCTGGGCATGGAGGGG + Intronic
1133356954 16:5143616-5143638 GGGGTGGCAGGGGCAGGGATGGG + Intergenic
1134062300 16:11206464-11206486 GGGGATGCAGTGACAAGAAGTGG - Intergenic
1134070450 16:11256692-11256714 GGTGGAGCAGGGGCTAGGAGGGG - Intronic
1135290149 16:21229424-21229446 GGGGTGGCAGGGGCAGCGGGGGG - Intergenic
1135522944 16:23191221-23191243 GAGGTGGCTGGGGCATGGAGAGG - Intronic
1135969303 16:27060742-27060764 GGGATTGCATGGGGAATGAGAGG - Intergenic
1135998119 16:27268663-27268685 GGGGTTGGAGGGGAAAGAAGAGG - Intronic
1136238791 16:28931942-28931964 GGGGATGCTGGGGCAGGCAGGGG - Exonic
1136251641 16:29009379-29009401 GGGGAGGGAGGGGCAGGGAGAGG - Intergenic
1136296019 16:29302377-29302399 GGCATCGCAGGGGTAAGGAGCGG + Intergenic
1136403820 16:30031880-30031902 GGCGTTGGAGGGGCAAGGAGTGG + Intronic
1136645928 16:31614902-31614924 GGGGTTTCGGGGGTAAGGGGAGG + Intergenic
1137396163 16:48117415-48117437 GGTGTTGCTGGGGCAAGGCCAGG + Intronic
1137533169 16:49296391-49296413 GGTGTTTCAGGTGGAAGGAGTGG + Intergenic
1137533614 16:49300253-49300275 AGGCCTGAAGGGGCAAGGAGTGG + Intergenic
1137534945 16:49313225-49313247 GGGGGGGCAGGGGCGTGGAGGGG - Intergenic
1137540279 16:49357062-49357084 GGGGCTGCAGAGGAAGGGAGGGG - Intergenic
1137549473 16:49427457-49427479 GGGGTTCCAATAGCAAGGAGCGG + Intergenic
1137552520 16:49449351-49449373 TGAGTAGCTGGGGCAAGGAGGGG - Intergenic
1137716269 16:50600155-50600177 GGGGTTGGAGGGGCAAGTGGTGG + Intronic
1137773855 16:51039896-51039918 GAGGCTGCAGGGGAAAGGTGGGG + Intergenic
1137917235 16:52445416-52445438 GGAGTTGCAAGGGGAAGGAGAGG + Intronic
1138318287 16:56089201-56089223 GGGGGAGCATGGGAAAGGAGTGG + Intergenic
1138594411 16:58022189-58022211 GGGGTTGCAGGGGCCACCATGGG - Intergenic
1138802426 16:60049511-60049533 GGGGTTGCGGGGGCGGGGGGAGG - Intergenic
1139201728 16:64984231-64984253 GGGGTTGGAGTGGAATGGAGGGG + Intronic
1139246059 16:65445211-65445233 GGGGGATCAGGGGCAAGGGGAGG - Intergenic
1139852908 16:69961576-69961598 GGGGTTACAGAGGAAAGGCGGGG + Exonic
1139881879 16:70184484-70184506 GGGGTTACAGAGGAAAGGCGGGG + Exonic
1140105401 16:71955280-71955302 GGAGGTGCAGTGGCAGGGAGAGG + Intronic
1140222407 16:73053532-73053554 GGTGTGGCAGGGGCAAAGTGGGG + Intronic
1140370632 16:74411022-74411044 GGGGTTACAGAGGAAAGGCGGGG - Exonic
1141554348 16:84827122-84827144 GGGGGTGCGGGGGCAGTGAGAGG - Intronic
1141601191 16:85127255-85127277 GGGGTTGGTGGGGTAGGGAGCGG + Intergenic
1141727876 16:85801596-85801618 GGAGTTGTGGGGGCAAGGTGGGG - Intronic
1141805206 16:86337305-86337327 GGAGATGCAGGGGCGGGGAGTGG + Intergenic
1142001726 16:87668155-87668177 GCGGCTGGAGGGGCAGGGAGAGG - Intronic
1142126089 16:88411387-88411409 GGGGCAGCAGGGGCAAGGCCAGG + Intergenic
1142127978 16:88419610-88419632 TGGGCTTCAGGGGCAGGGAGTGG - Intergenic
1142264718 16:89058452-89058474 TGGGTCCCAGGGGCAGGGAGGGG - Intergenic
1142293356 16:89202621-89202643 GGGGCTGCAGGGCCCTGGAGGGG - Intergenic
1142299543 16:89248351-89248373 GGGGCTGCAGGGCCCGGGAGGGG - Intergenic
1142652285 17:1362723-1362745 GAGGTTCCAGGGGCACGGAGAGG - Intronic
1143310811 17:5987391-5987413 GGGTTTGGCGGGGCAAGGGGAGG + Intronic
1143498255 17:7324528-7324550 GGCGCTGCTGTGGCAAGGAGAGG - Intronic
1144095175 17:11893710-11893732 GGGGGTGGAGGGGAAAGGGGAGG + Intronic
1144671964 17:17138045-17138067 GGGGGTGCTGGGGCTGGGAGGGG - Exonic
1144750861 17:17647161-17647183 GGGGCTGCAGGGGGAAGGGATGG + Intergenic
1144788380 17:17844259-17844281 GGTGTGGCAGCGGGAAGGAGGGG + Intronic
1145018837 17:19414966-19414988 GGGGTGTCAGAGGCCAGGAGAGG - Intronic
1145168604 17:20636053-20636075 GGGGCTGCAGGAGCAAGAAATGG - Intergenic
1145256119 17:21323431-21323453 GGGCGTCCTGGGGCAAGGAGTGG + Intergenic
1145320494 17:21764519-21764541 GGGCGTCCTGGGGCAAGGAGTGG - Intergenic
1146271964 17:31490421-31490443 GGGGGTGAAGGGGGTAGGAGAGG + Intronic
1146291775 17:31612919-31612941 GAGGTGGCAGGAGAAAGGAGAGG - Intergenic
1146776768 17:35626009-35626031 TAGGTGGCAGGGGCTAGGAGAGG + Intronic
1146891703 17:36510599-36510621 GGGGTTTGAGGAGCAGGGAGAGG + Intronic
1146972603 17:37084889-37084911 GGTGTTACAGGGCCATGGAGGGG + Intergenic
1147141831 17:38464719-38464741 CAGTTGGCAGGGGCAAGGAGTGG + Intronic
1147316703 17:39624402-39624424 GGGTGGGCAGGGGCAAGGAGTGG - Intergenic
1148088062 17:45006657-45006679 GGGGTTGGAGGGGGTTGGAGGGG - Intergenic
1148088067 17:45006667-45006689 GGGGTTGGAGGGGGTTGGAGGGG - Intergenic
1148088076 17:45006686-45006708 GGGGTTGGAGGGGGTTGGAGGGG - Intergenic
1148088081 17:45006696-45006718 GGGGTTGGAGGGGGTTGGAGGGG - Intergenic
1148088086 17:45006706-45006728 GGGGTTGGAGGGGGTTGGAGGGG - Intergenic
1148088095 17:45006725-45006747 GGGGTTGGAGGGGGTTGGAGGGG - Intergenic
1148088100 17:45006735-45006757 GGGGTTGGAGGGGGTTGGAGGGG - Intergenic
1148088132 17:45006794-45006816 GGGGTTGGAGGGGGTTGGAGGGG - Intergenic
1148088137 17:45006804-45006826 GGGGTTGGAGGGGGTTGGAGGGG - Intergenic
1148088142 17:45006814-45006836 GGGGTTGGAGGGGGTTGGAGGGG - Intergenic
1148711770 17:49687092-49687114 AGGGTTGCTGGAGCAAGGACAGG - Intergenic
1149428002 17:56573662-56573684 GGGGAAGGTGGGGCAAGGAGAGG + Intergenic
1150195886 17:63298912-63298934 GGGGATGTGGGGGCAAGGGGAGG - Intronic
1151002088 17:70389517-70389539 GGGATTACAGGGGCCAGGCGGGG - Intergenic
1151388121 17:73767843-73767865 GTGGTTACAGGTGCAAGGAGTGG + Intergenic
1151468898 17:74305468-74305490 GGGGATGCAGGAGACAGGAGGGG + Intronic
1151510670 17:74557499-74557521 AGGGGTGCAGGGGCAGGAAGGGG - Intergenic
1151577135 17:74958508-74958530 CGGGTGGGAGGGGGAAGGAGGGG + Intronic
1151756933 17:76080439-76080461 GGGGCTGCAGGGTTGAGGAGGGG + Intronic
1151842280 17:76627010-76627032 GGGGCTGGAGGGGGCAGGAGAGG + Intronic
1151987926 17:77556082-77556104 GGGGCTCCAGGGGAAAGGGGTGG - Intergenic
1152356569 17:79810418-79810440 GGGGGTGCGGAGGCGAGGAGCGG - Intergenic
1152374929 17:79914148-79914170 GGGGTGGCAGGGGATAGCAGGGG - Intergenic
1152447710 17:80355515-80355537 GGGCTTACAGGGGGAAGAAGCGG + Intronic
1152447760 17:80355664-80355686 GGGCTTACAGGGGGAAGAAGCGG + Intronic
1152565039 17:81096552-81096574 GGTGTTGCAGGGGCATGGGTGGG + Intronic
1152617598 17:81345123-81345145 GGGGCTCCGGGGGCTAGGAGGGG + Intergenic
1152623963 17:81379963-81379985 GGGGGTGGAGGGGTAGGGAGCGG - Intergenic
1152646976 17:81473780-81473802 TTGGTTGCAGGGGCAGGGTGGGG - Intergenic
1152855643 17:82663523-82663545 GGGGGTGCTGGGGGAGGGAGAGG + Intronic
1152884654 17:82842460-82842482 GGGGCAGAAGGGGCAAAGAGAGG - Intronic
1153285271 18:3450433-3450455 GGGTCTGGAGGGGCCAGGAGCGG - Intronic
1153360370 18:4188457-4188479 GGGGTGTGAGGGGCAAGGGGAGG - Intronic
1154239847 18:12642764-12642786 GGGATGGCAGGGGAAAGGGGAGG + Intronic
1156364436 18:36412860-36412882 TGGGTTTCTGGGGCAAGGAGTGG + Intronic
1157613904 18:48975863-48975885 GGGGAGGCAGGGGGAAGGGGCGG + Intergenic
1157785082 18:50474373-50474395 GCAGGTGCAGGTGCAAGGAGTGG - Intergenic
1158252112 18:55500329-55500351 GGAATAGCAGGGGAAAGGAGTGG + Intronic
1158470904 18:57735958-57735980 GGGGTGGGGGGGGCAAGGAATGG - Intronic
1158522178 18:58180537-58180559 GGGGAGGCAGAGCCAAGGAGGGG - Intronic
1159192229 18:65061398-65061420 GGGGTTGCAAGGGCAGAGAAAGG - Intergenic
1160171540 18:76559367-76559389 GGGGCTGCAGCGGCAAGAGGAGG - Intergenic
1160584402 18:79904433-79904455 GGGGTTGCATGGGACAGGTGGGG - Intronic
1160703451 19:518588-518610 GGGGATGCTGGGGGGAGGAGAGG + Intronic
1160721823 19:600932-600954 GGGGTTGGAGGGGTGAGAAGTGG - Intronic
1161194324 19:2977679-2977701 GGGGCTGCAGGGGCGTGGAGGGG + Intronic
1161241385 19:3225458-3225480 GGGGGTGGGGGGGCAGGGAGGGG - Intronic
1161630397 19:5352086-5352108 GAGGTGGCAGGGGCAAAAAGTGG - Intergenic
1162104875 19:8364251-8364273 GGGGTTCCAGGTGCGAGGACTGG - Exonic
1162237768 19:9321842-9321864 GGGGTAGGAGGGGGAAGGAGCGG - Intergenic
1162328008 19:10010203-10010225 GGGGGTGGAGGGGCGTGGAGGGG - Intronic
1163019972 19:14476657-14476679 GCTGTTTCTGGGGCAAGGAGGGG - Intergenic
1163082373 19:14953274-14953296 GGCGAGGCAGGGGCAAGGTGAGG - Intronic
1163115263 19:15185227-15185249 GGGGCTGCAGAGGGAAGGTGAGG + Intronic
1163183758 19:15622155-15622177 GGGGTTGCAGGGGGACTCAGAGG + Intronic
1163501029 19:17676361-17676383 GGGGATGCAGGGAGAGGGAGGGG - Intronic
1163575942 19:18110715-18110737 AGGGGTGCAGGCCCAAGGAGGGG - Intronic
1163766271 19:19165128-19165150 GGGGATGCAGGAGCAGGGGGTGG + Intronic
1163926167 19:20345720-20345742 GAAGTTGTAGGGGCCAGGAGAGG - Intergenic
1164585629 19:29473074-29473096 GGGGTTGCAGGGGCCGGGGGAGG - Intergenic
1165098723 19:33425469-33425491 GGGCGAGCAGGGGCAAGGGGAGG + Intronic
1165135564 19:33666248-33666270 GGGCTTCCACGGGCATGGAGGGG - Intronic
1165315005 19:35049417-35049439 GAGGCTGCAGGGGCCAGGGGAGG - Intronic
1165491920 19:36128526-36128548 TGGGTTGCAGCGGCGGGGAGGGG - Intergenic
1166089989 19:40502516-40502538 GGGGATGCAGGGGAGAGGCGGGG + Intronic
1166141226 19:40806449-40806471 GGGGAAGATGGGGCAAGGAGGGG + Intronic
1166226549 19:41399269-41399291 AGGGCTGCAGGAGCAAGGTGTGG + Intronic
1166328520 19:42065658-42065680 GAGGATGCAGGGGCAGGGTGCGG + Intronic
1166773399 19:45297967-45297989 GGGATGGCAGGGGCAGGGCGGGG + Intronic
1166824272 19:45599436-45599458 GGGGCTGCAGGGAGAAGGCGGGG - Intronic
1166990537 19:46690079-46690101 AGGGTTGCAGGAGGGAGGAGGGG + Intronic
1167419710 19:49395677-49395699 GGGATTGCAGGTGGGAGGAGGGG - Intronic
1167699736 19:51035353-51035375 GGAGGGGCAGGGGGAAGGAGAGG + Intergenic
1168277432 19:55285368-55285390 GGGGCTCCAGGGCCAGGGAGGGG + Intronic
1168317220 19:55489561-55489583 TGGCTTGCCGGGGCAACGAGGGG + Exonic
1168326423 19:55540980-55541002 GGGGTTGCAAGGGAACAGAGAGG - Exonic
1168381907 19:55931273-55931295 TGGGTTGCGGGGGCAGGGCGGGG + Intronic
925585781 2:5462639-5462661 GGGGTTTCACAGGCCAGGAGGGG - Intergenic
925818368 2:7775401-7775423 GGGGTTGTGGGGGGAAGGAGGGG + Intergenic
925897730 2:8486329-8486351 GGGGTTGGAGAGGCAGGAAGTGG - Intergenic
926107217 2:10160000-10160022 GGGCCTGGAGGGGCAGGGAGAGG - Intronic
926178447 2:10617910-10617932 GTGGTTGCAGGGGCTGGGAGAGG + Intronic
926192641 2:10740370-10740392 GGGGATGCAGGAGCAAGGCCAGG - Intronic
926295575 2:11566408-11566430 GGGGTCACAGGGGCAAAGGGAGG - Intronic
926314743 2:11701010-11701032 GGGGGAGCAGGGCCAAGGAAGGG - Intronic
926482885 2:13421928-13421950 GGGGGTTGAGGGGTAAGGAGAGG - Intergenic
927478670 2:23433416-23433438 GGGGGAGGAGGGGCAGGGAGTGG + Intronic
927578131 2:24217402-24217424 GGAGCTGCAGGGGCCAGGTGTGG + Intronic
927667585 2:25042833-25042855 GGGGCGGCAGGGGCAGGCAGAGG - Intronic
927844563 2:26464806-26464828 GGGGTTTCAGAGGCCAGGAGGGG - Intronic
927981375 2:27377139-27377161 GGGGAAGCAGGGGCAGTGAGAGG - Intronic
928586064 2:32759737-32759759 GTGGTTGCAGGTGCCAGGATGGG - Intronic
928689259 2:33782278-33782300 TGGGGTGCTGGGGCAGGGAGAGG - Intergenic
929242274 2:39665674-39665696 GGGGGCGCCGGGGCGAGGAGAGG + Intronic
929455320 2:42061095-42061117 GGGGCTGCAGAGTCAAGGGGTGG - Intergenic
929795572 2:45055996-45056018 GGGGAGGCAGGGGCAGGCAGAGG + Intergenic
931728223 2:65130593-65130615 GGGGGTGCGGGGGCGGGGAGGGG + Intergenic
932356691 2:71073329-71073351 GGGGTGGCAGGGGGTGGGAGAGG - Intronic
932466793 2:71929226-71929248 AGGGTTTCAGGAGCCAGGAGTGG - Intergenic
932606822 2:73170935-73170957 TGGTTTGCAAGGGGAAGGAGGGG + Intergenic
932996988 2:76867066-76867088 GGGGGTGGTGGGGCAAGGGGAGG + Intronic
933454828 2:82507808-82507830 CGGGTGGCAGGAGCAGGGAGAGG - Intergenic
933782710 2:85813262-85813284 GGGGTTGTAGGGGGAAGGGTGGG - Intergenic
933925606 2:87089475-87089497 TGGTTTGCAAGGGGAAGGAGGGG - Intergenic
934522721 2:95030139-95030161 AGGGGTGCTGGGCCAAGGAGAGG - Intronic
934528000 2:95063812-95063834 AGGGGTACAGGGGCAAGGAGGGG - Intergenic
934993106 2:98935535-98935557 GCAGTTGCAGGGGAAAGGAGTGG - Intronic
935001245 2:99017801-99017823 GGGGATTCAGGGGGAAGGATGGG + Intronic
936256528 2:110919406-110919428 GGGGGTGGGGGGGCAAGGGGAGG + Intronic
936444810 2:112587102-112587124 AGGGCTGCAGGGGCAGAGAGAGG - Intronic
937221362 2:120344725-120344747 GGGGTGGGAGGGGAGAGGAGGGG + Intergenic
937274107 2:120673188-120673210 GGGGTTCCAGGGGGAGAGAGTGG + Intergenic
937293582 2:120796595-120796617 AGGGTTGCAGGGGCACAGCGGGG - Intronic
937663071 2:124452636-124452658 GAGGTTGCAGGGGCCTGAAGTGG - Intronic
937880449 2:126860459-126860481 GAGGAGGCAGGGGCAAGGAAGGG - Intergenic
937886156 2:126901291-126901313 GGGGATGCTGGGGCTTGGAGAGG - Intronic
937900880 2:127018104-127018126 GGGGGTTGAGGGGCAAGGGGAGG + Intergenic
937906589 2:127055606-127055628 GGTGTTGCTGGGGCAGGGTGGGG - Intronic
938330920 2:130447611-130447633 GGGGTTGCGGGGAAAAGCAGAGG - Intergenic
938338106 2:130516930-130516952 GGGAGTGCAGGCTCAAGGAGGGG - Intergenic
938351731 2:130603808-130603830 GGGAGTGCAGGCTCAAGGAGGGG + Intergenic
938359027 2:130673892-130673914 GGGGTTGCAGGGAAAGGCAGAGG + Intergenic
939036379 2:137136148-137136170 GGGGGTGAGGGGGCAAGGGGAGG + Intronic
939273464 2:139970089-139970111 GATGTTCCAGGGGCAGGGAGGGG - Intergenic
939607520 2:144270653-144270675 GGGGGTGGGGGGGCAAGGGGAGG + Intronic
941475549 2:165947481-165947503 GGGGTTGTAGGGGTGGGGAGTGG - Intronic
942721279 2:178955949-178955971 GACATTGCGGGGGCAAGGAGTGG + Intronic
943820465 2:192314929-192314951 GAGCTTGCAAGGGCAAGGGGGGG + Intergenic
944885838 2:204061889-204061911 GGGGGTGGGGGGGCAAGGGGAGG - Intergenic
946515058 2:220402702-220402724 GGGCATGCAGGTGCAAGGGGTGG - Intergenic
946638132 2:221753434-221753456 GGGGTTGCTAGTGCAAGCAGTGG - Intergenic
947020275 2:225666839-225666861 GGGGGTGGGGGGGCATGGAGGGG - Intergenic
947359326 2:229331845-229331867 AGTGCTTCAGGGGCAAGGAGAGG - Intergenic
948144372 2:235697419-235697441 GGGATTGCAGGGGGAAGTGGGGG - Intronic
948326792 2:237128323-237128345 GGGCATGCAGGGGAAAGGGGTGG - Intergenic
948518570 2:238521778-238521800 GGGTTTGCAGGAGCACGGTGTGG + Intergenic
948599754 2:239101516-239101538 GGGGTTGCAGGGGCAAGGAGAGG - Intronic
948725403 2:239930867-239930889 GGGGGGGCAGGGTCCAGGAGGGG + Intronic
948725435 2:239930953-239930975 GGGGGGGCAGGGTCCAGGAGGGG + Intronic
948795940 2:240402159-240402181 TGGGGTGCAGGGACAGGGAGGGG - Intergenic
948869747 2:240792008-240792030 GGGGTGGCAGGGCCAGGGTGGGG - Intronic
948915669 2:241034092-241034114 GGGACTGCAGGGGCAGGGCGGGG - Intronic
949059248 2:241947321-241947343 GGGGCTGCAGGGGCAAAGGGCGG - Intergenic
1168938973 20:1692750-1692772 GGGGGTGGGGGGGCAAGGGGAGG + Intergenic
1170635586 20:18101314-18101336 GGGGCTGGAAGGGCAAGGGGAGG + Intergenic
1170784953 20:19459867-19459889 GAGGTAGCAGAGGCAAGGAAGGG - Intronic
1171096649 20:22338409-22338431 GGGGCTGCGGGGGGAAGCAGAGG + Intergenic
1172034773 20:32003029-32003051 AGAGTTCCAGGGGCATGGAGGGG - Exonic
1172111154 20:32545761-32545783 GGGGCTGGAGGTGCAGGGAGAGG + Intronic
1172777797 20:37417467-37417489 GAGTTTGCAAGGGCCAGGAGGGG - Intergenic
1172799180 20:37564363-37564385 GGGGTTGCCTGGGGAAGGGGTGG + Intergenic
1172809529 20:37637327-37637349 GGGGCTGCAGAGGCAGTGAGGGG + Intergenic
1172813621 20:37669521-37669543 CTGGTTGCAGCTGCAAGGAGTGG + Intergenic
1172979976 20:38933809-38933831 GTGGTTGCCGGGGCCAGGAAAGG - Intronic
1173431003 20:42987142-42987164 CTGGTTGCAGGGGCGAGGATGGG - Intronic
1173948397 20:46969903-46969925 GGGGGTGAAGGGGCATGCAGAGG + Intronic
1174756401 20:53162681-53162703 GGTGTTGCATGGGAAAGGAGGGG + Intronic
1175310285 20:58007016-58007038 GGGGTGGCAGGGCCAAGGAGGGG - Intergenic
1175503571 20:59466905-59466927 GGGGCTGCAGGGGCAGGAGGGGG + Intergenic
1176142259 20:63549944-63549966 AGGGCAGCAGGTGCAAGGAGGGG - Intronic
1176142563 20:63551337-63551359 GTGGTTGCAGGGCTAGGGAGAGG + Intronic
1176214534 20:63941877-63941899 GGTGATGCAGGGGCAGGAAGAGG + Intronic
1176215556 20:63946101-63946123 GGGGGTCCAGGGTCAGGGAGAGG + Intronic
1177087235 21:16721111-16721133 GGGGTTGCAGGGGCTAGGAGAGG + Intergenic
1177296904 21:19187581-19187603 GGGCTTGCATGAGGAAGGAGTGG + Intergenic
1178123983 21:29497947-29497969 AGGGTAGCTGGGGTAAGGAGTGG - Intronic
1178631872 21:34268505-34268527 GTTGTGGCAGTGGCAAGGAGGGG + Intergenic
1178824616 21:36004933-36004955 GGGGAGGCAGGGGGAAGCAGGGG + Intergenic
1179211086 21:39324950-39324972 GGGGCTGGAGGTGGAAGGAGGGG + Intergenic
1179485711 21:41709346-41709368 GTGGTTGCAGGGGCTGAGAGTGG + Intergenic
1179654078 21:42834338-42834360 GTGTTTGCAGGGGCGGGGAGGGG + Intergenic
1179680099 21:43013706-43013728 TGGGTTCCAGGGGCTAGGGGAGG - Intronic
1179731353 21:43369463-43369485 GGGGCTGCAGGGTCGAGGCGTGG + Intergenic
1179801608 21:43813828-43813850 GGGGTGCCAGGGGCAGGGTGAGG - Intergenic
1179812979 21:43884249-43884271 GGGGAAGGAGGGGGAAGGAGGGG - Intronic
1179934349 21:44592784-44592806 GGGGCTGCTGGGGCCAGGGGTGG - Intronic
1179970854 21:44836167-44836189 GGGGCTGCAGGGGTAGGGTGGGG - Intergenic
1180043590 21:45292786-45292808 GGGGTCGCTGGGGACAGGAGAGG - Intergenic
1180717431 22:17881412-17881434 GAGGATGGAGGGGCAAGGAAAGG - Intronic
1180845149 22:18976717-18976739 GAGGTTGCAGGGGCCAGCTGTGG - Intergenic
1181518731 22:23433366-23433388 GGGCTGGGAGGGGCAGGGAGAGG - Intergenic
1181759449 22:25048121-25048143 GGGGATGGATGGGCAAGGTGTGG + Intronic
1181783116 22:25207250-25207272 GGGGCTGCAAGGGCAAGAAGAGG + Exonic
1182342592 22:29635857-29635879 GGGGTGGTTGGGGCAAGGAGGGG + Intronic
1182423091 22:30257939-30257961 GTGGCTGCTGGGGCAGGGAGTGG - Intergenic
1182470452 22:30544970-30544992 GGGGTTCCCGGGGCAAAGAAGGG - Intronic
1182772407 22:32804856-32804878 GGAGTTTCAGGGGCAATGACTGG - Intronic
1182779728 22:32858148-32858170 GGGGTCACTGGGGGAAGGAGGGG + Intronic
1183242517 22:36668557-36668579 GGGGTTGAAGCTGCAATGAGTGG - Intronic
1183329572 22:37212089-37212111 GGGGGGGCAGGGGCAAGGATAGG + Exonic
1183390069 22:37540699-37540721 GGGGATGGAGAGGCCAGGAGAGG - Intergenic
1183437127 22:37802718-37802740 GGAGTTGGAGGGGAAGGGAGGGG - Intergenic
1183607188 22:38872563-38872585 GGGGATTAAGAGGCAAGGAGAGG - Intergenic
1184198903 22:42951547-42951569 GGGGATGCAGGAGCAAGAGGTGG - Intronic
1184508893 22:44920412-44920434 GAGGTTGGCCGGGCAAGGAGCGG - Exonic
1184599156 22:45532411-45532433 GGGGTTACAGGGCCAGAGAGAGG + Intronic
1184628664 22:45758109-45758131 GGGCTGGCAGGGGCAGGGTGTGG - Intronic
1184847915 22:47100389-47100411 TGGGGTGCAGGGGCAAGGCCTGG + Intronic
1184890084 22:47374124-47374146 GGGGTGGCAGGTGCAGGCAGAGG - Intergenic
1185067990 22:48641560-48641582 GGGCGTGCAGGGGGAAGGGGAGG - Intronic
1185108269 22:48886319-48886341 GGAATTGTAGGGGCAGGGAGGGG - Intergenic
1185135635 22:49070513-49070535 GGGGTATCAGGGGGCAGGAGGGG - Intergenic
1185146628 22:49140711-49140733 GGGGCAGCTGGGGCAAGGATGGG + Intergenic
1185275736 22:49949587-49949609 GGGGTTCGAGGGGCGTGGAGAGG - Intergenic
1185403810 22:50633712-50633734 GGGGATGGAGGAGCACGGAGGGG - Intergenic
1185420475 22:50731850-50731872 GGGGTGGCAGTGGCAGTGAGGGG - Intergenic
949343370 3:3052806-3052828 GGGGTTCCAGAGGAAAGGAATGG + Intronic
949904021 3:8843458-8843480 GAGGTGGGAGGGGTAAGGAGAGG - Intronic
950024559 3:9811203-9811225 GGGCTGGAAGGGGCACGGAGAGG - Intronic
950088148 3:10275996-10276018 GGGGTGGCAGGGGCAGGGCAGGG - Intronic
950175601 3:10871854-10871876 GGTGGTGCAGGGGCCATGAGTGG + Intronic
950376453 3:12576381-12576403 GTCGGTGCAGGGGCAAGGGGAGG - Intronic
950647262 3:14384564-14384586 GGGGAGGCAGGAGGAAGGAGAGG - Intergenic
950670998 3:14525383-14525405 GGGGGTGCAGAGGCAATGATGGG - Intronic
951063084 3:18233469-18233491 ATGGTTGCAGGGTCAAGGAAAGG + Intronic
952064974 3:29558326-29558348 GGGGTTGAAGAGGAAAGGGGTGG + Intronic
952970524 3:38648132-38648154 GCTGTTGCAGGAGCATGGAGAGG - Intronic
953428578 3:42817565-42817587 CTGGATGCAGGGGCGAGGAGAGG - Intronic
953627081 3:44580148-44580170 GGGGGTGCTGGGGCTGGGAGGGG + Intronic
953859821 3:46534070-46534092 GGGGCTGGTGGGGCAAGGGGAGG - Intronic
954374603 3:50187686-50187708 GAATCTGCAGGGGCAAGGAGAGG - Exonic
954639994 3:52092156-52092178 GTGTTTACTGGGGCAAGGAGGGG + Intronic
954716077 3:52527580-52527602 GGGGTTGCAGGGCCAGGGAAGGG - Intronic
955034626 3:55254576-55254598 GGGGATGCAGGGGTGAGGCGGGG + Intergenic
955606124 3:60706243-60706265 GGGGTTTGGGGGGCAAGGGGAGG + Intronic
956005662 3:64775825-64775847 GAGGATGCAGGGGGACGGAGCGG + Intergenic
956013579 3:64857754-64857776 TGGGGTGGAAGGGCAAGGAGAGG + Intergenic
956664309 3:71627823-71627845 GTGGTTGCAGGGAGAAGGAAGGG + Intergenic
960348711 3:116567192-116567214 GGGATGGCAAGGCCAAGGAGAGG + Intronic
961080409 3:124022281-124022303 GGGGTTGGGGGGGCGAGGGGAGG - Intergenic
961571752 3:127804300-127804322 AGGGTTGCAGGGCCACGGGGCGG + Intronic
961668113 3:128506672-128506694 AGGGTTGGAGGGGCAATGGGAGG + Intergenic
961937494 3:130600710-130600732 GGGGTTGGTGGGGCAAGGGGAGG + Intronic
962072170 3:132044616-132044638 GGGGATGAAGGGGGAGGGAGGGG + Intronic
962231931 3:133673908-133673930 CGGGCTGCAGGGGCGAGGAGAGG + Intergenic
962360422 3:134737849-134737871 GAGGTTACATGGGGAAGGAGAGG - Intronic
962573674 3:136736271-136736293 GTTGTTCTAGGGGCAAGGAGAGG + Intronic
962943482 3:140146797-140146819 GGTGGTGCAGGAGGAAGGAGGGG - Intronic
963043749 3:141087658-141087680 GAGGTTGCAAGGCCAGGGAGTGG + Intronic
963362236 3:144289149-144289171 GGGGTAGCAATGGCTAGGAGAGG + Intergenic
964064117 3:152559755-152559777 GGGGGAGGAGGGGCGAGGAGTGG - Intergenic
964241577 3:154601033-154601055 GGGCATGCTGGTGCAAGGAGTGG + Intergenic
964397475 3:156260433-156260455 GTGGTTGCTGGGGCTGGGAGTGG - Intronic
964720276 3:159763536-159763558 GGGGTTGGAGGGGCCAAGATAGG - Intronic
965881017 3:173388123-173388145 GGGGGTGCAGGGGCTAGGGGAGG + Intergenic
966735102 3:183181451-183181473 GAGGTGGGAGGGGCAAGGGGTGG + Intronic
967014567 3:185470034-185470056 GGGGTAGGAAGGACAAGGAGGGG + Intronic
967139924 3:186548363-186548385 GGGGTTGGAGGAATAAGGAGTGG + Intronic
967221835 3:187253838-187253860 GGGGGTGGCGGGGCAAGGGGAGG + Intronic
968262054 3:197333467-197333489 GGGGTGTCGGGGGCAAGGGGAGG - Intergenic
968816240 4:2823356-2823378 GTGGGTGAAGGGGCAAGGTGGGG - Intronic
969498666 4:7540221-7540243 GGAGAGGCAGGGGCAGGGAGAGG - Intronic
969582136 4:8071709-8071731 GGGCTCACAGGGGCCAGGAGGGG - Intronic
969675524 4:8612199-8612221 GGGGGTGCAGGGGCTGGGTGGGG + Intronic
969808194 4:9627201-9627223 GGGGTGGCAGAGGCAGGGATGGG - Intergenic
969987497 4:11226715-11226737 CAGGTTGCAGGGGAAGGGAGTGG + Intergenic
970626308 4:17887908-17887930 GGGGTTGCCGGGGTGAGGCGGGG - Intronic
971026269 4:22591338-22591360 AGGGTGGCAGAGGCAGGGAGAGG - Intergenic
971738104 4:30483756-30483778 GGGGTTACAGAGGCTAGCAGGGG - Intergenic
971772201 4:30911158-30911180 GAGGTTGTGGGGGCAAGGGGAGG + Intronic
972396663 4:38664133-38664155 GGGGTGGGAGGGTCAGGGAGGGG - Intergenic
972667792 4:41183827-41183849 GGAGTTGCAGGGGGTGGGAGGGG + Intronic
974188502 4:58472076-58472098 TGGGTTCCTGGGGCCAGGAGTGG - Intergenic
974793565 4:66719901-66719923 GGGGGTGTGGGGGCTAGGAGAGG + Intergenic
976089253 4:81438713-81438735 GGGGCTGGGGGGGCAAGGGGAGG - Intronic
977466479 4:97388120-97388142 AGGGCTGCAGGGGCAAGTAGAGG + Intronic
977942972 4:102878133-102878155 GGGGGGGCGGGGGGAAGGAGGGG + Intronic
978077794 4:104554614-104554636 GAGGTTGCAGTGGTAATGAGGGG + Intergenic
978588315 4:110296523-110296545 AGGCTTGAAGGGGCAGGGAGTGG + Intergenic
981665816 4:147224851-147224873 CGGGTGGTAGGGGCAAGGGGAGG + Intergenic
982070786 4:151692674-151692696 GGGGATGCAGAGGCAAGGCAGGG - Intronic
982112897 4:152072583-152072605 AGGTTTCCAGGGGCAAGGATGGG - Intergenic
982976286 4:162066574-162066596 GGGGGTGGGGGGGCAAGGGGAGG - Intronic
983650920 4:170035586-170035608 GGGGAAGCAGGGACAAGAAGAGG - Intergenic
983903612 4:173162703-173162725 GGGGCTGCAGAGGTAAGCAGAGG + Intergenic
984553016 4:181182967-181182989 AGGGATGCAGAGGAAAGGAGTGG - Intergenic
985486822 5:156557-156579 TGGGTTGCAGGTGCCTGGAGGGG - Intronic
985588212 5:751565-751587 GGGGGTGCAGAGGCAGGGATGGG + Intronic
985719304 5:1481052-1481074 GGGGTGGGAGGTGCAGGGAGAGG - Intronic
985971414 5:3381334-3381356 GCGGGTGGAGGGGCAGGGAGAGG - Intergenic
986146055 5:5078919-5078941 GGTGTTACAGGGGCACAGAGCGG + Intergenic
986183637 5:5416992-5417014 GGGGAGGGAGGGGGAAGGAGGGG + Intergenic
987390965 5:17375244-17375266 GGTCTTGCAGGGGGAGGGAGAGG - Intergenic
988482432 5:31640886-31640908 GGGGTGGCAGGTGCTAGGAGAGG + Intronic
988721172 5:33880843-33880865 GGGGTTGGAGGGGGAAGAAGAGG - Intronic
989201896 5:38772270-38772292 GGAGTGGCAGTGGCAGGGAGAGG + Intergenic
989427003 5:41307589-41307611 GGGGAGGCAGGCGCAAGTAGGGG - Exonic
990754775 5:59056590-59056612 GGGGTTGGGGGAGCAAGGGGAGG - Intronic
991950078 5:71938953-71938975 TGGCTTGCAGGGGAAAGGTGTGG + Intergenic
992440136 5:76790695-76790717 GGGGTGGAAGGGGGAAAGAGTGG + Intergenic
992693217 5:79259804-79259826 GAGCCTGCAGGGGCAAGGTGGGG + Intronic
993139126 5:84008142-84008164 GGGGTTGCAGGAGTAAAGTGAGG + Intronic
995181415 5:109234257-109234279 GGGCTTGCAAGGACAAGGTGTGG - Intergenic
995461779 5:112410991-112411013 GGGAATCCAGGGGCAAGGAAAGG - Intronic
996403293 5:123085672-123085694 TGGGCTGCAGGTGAAAGGAGGGG - Intergenic
996732387 5:126728486-126728508 GGGTCTGCAGGGGCAACAAGAGG - Intergenic
997196747 5:131985455-131985477 GGGGCTGCAGGGGTGAGAAGAGG + Exonic
997363309 5:133309239-133309261 GGGGTGGCGTGGGGAAGGAGAGG + Intronic
997378627 5:133418899-133418921 TGGGTTGGAGGGACAGGGAGGGG - Intronic
997475778 5:134141629-134141651 GGGGCTGCCGGGGAACGGAGAGG + Intronic
997878453 5:137569541-137569563 TAGGCTGCAGGAGCAAGGAGTGG + Intronic
998131372 5:139653104-139653126 GGGGTTGCAGGGGGAAGGACTGG - Intronic
998401961 5:141852860-141852882 GGGGTTGAGAGGGCAGGGAGGGG + Intergenic
999254205 5:150200805-150200827 GAGTTTGCAGGGGCAGGGAGTGG + Intronic
1000185242 5:158851893-158851915 GGGGAGGCAGGGGGGAGGAGAGG + Intronic
1001178656 5:169497284-169497306 GGGGTTGGAGGGGTGGGGAGTGG + Intergenic
1001317293 5:170652904-170652926 GGTTTTGCAGGGGCAAGGTGGGG - Intronic
1001355331 5:171016894-171016916 GGGGGTGGGGGGGCAAGGGGAGG - Intronic
1001917182 5:175571594-175571616 GAGGATGCAGGAGCAGGGAGAGG - Intergenic
1001966211 5:175911477-175911499 GGGGTAGCAGGGGGGAGGTGGGG + Intergenic
1002192308 5:177484672-177484694 TGGGTTGCAGGGGCACGCTGTGG - Intronic
1002259253 5:177982624-177982646 GGGGTTGGAGGGGAAAGGAATGG - Intergenic
1002812245 6:641673-641695 GGGGTGCCAGAGGGAAGGAGAGG - Intronic
1003080578 6:3017687-3017709 GGGGTGGCAGAGGGAGGGAGTGG + Intronic
1003087242 6:3069459-3069481 GGGGTTGCGGGGGCAGGGGGAGG + Intronic
1003197245 6:3925970-3925992 GGGGTGGGAGGGAGAAGGAGAGG + Intergenic
1003619281 6:7683529-7683551 AGGGCTGCAGGGGCCAGGTGGGG + Intergenic
1003688338 6:8326978-8327000 GGGGGTGGGGGGGCAAGGGGAGG - Intergenic
1003786967 6:9497588-9497610 GGGGTTGTGGGGGCCTGGAGGGG - Intergenic
1004562202 6:16761318-16761340 GGGGTTGCGTGGGGAAGGGGGGG + Exonic
1004565909 6:16797518-16797540 GTGGTTGTAGGGACAGGGAGGGG + Intergenic
1005372798 6:25153057-25153079 GGGGCAGCCTGGGCAAGGAGGGG + Intergenic
1005386255 6:25288061-25288083 GGGGCTTCAGGAGCACGGAGAGG + Intronic
1005560587 6:27036287-27036309 GGGGGGTCAGGGGCAAGGGGAGG - Intergenic
1005959715 6:30686537-30686559 GGTGTTGGGGAGGCAAGGAGGGG + Exonic
1006096345 6:31659095-31659117 GGGGTTGGAGAGGGAAGGTGAGG - Exonic
1006174955 6:32116134-32116156 TTTGGTGCAGGGGCAAGGAGAGG + Intronic
1006184778 6:32175651-32175673 AGGGTTGCTGGGGATAGGAGAGG - Intronic
1006184790 6:32175688-32175710 AGGGTTGCTGGGGAAAGGAGAGG - Intronic
1006444759 6:34074019-34074041 GGGGTTTCAGAGGCAAGAGGAGG - Intronic
1006601785 6:35231232-35231254 GAGGTTGGAGGGGCAGGGTGGGG - Intronic
1006804785 6:36781068-36781090 GGGCTTGCCTGGGCAGGGAGGGG + Intronic
1006903278 6:37516570-37516592 CGGGCTGCAGAGGCAGGGAGGGG - Intergenic
1007473855 6:42106686-42106708 GGGGGTGCTGGGGGAGGGAGGGG + Exonic
1008322537 6:50134536-50134558 GTAGTTGCAGAGGCCAGGAGTGG - Intergenic
1010162702 6:72877206-72877228 GGGGGGGTCGGGGCAAGGAGAGG - Intronic
1010650720 6:78452671-78452693 GGAATTGAAGGGGTAAGGAGGGG - Intergenic
1011492476 6:87906622-87906644 GGGGCTGCAGGCACAGGGAGAGG + Intergenic
1012872435 6:104688033-104688055 GGGGTGGGAGGGGCAGGGTGGGG - Intergenic
1013774311 6:113662409-113662431 GGTGTGGCAGGGACAGGGAGGGG + Intergenic
1014564343 6:122930184-122930206 GGGGTTGGGGGGTGAAGGAGAGG - Intergenic
1016068355 6:139707596-139707618 TGGGTTGCGGGGGGAGGGAGAGG + Intergenic
1016730135 6:147420016-147420038 GGGGTTGCGGGGGTAAGGGAAGG + Intergenic
1016824017 6:148371752-148371774 GGGGAGGCAGGTGCATGGAGGGG - Intronic
1017029583 6:150209089-150209111 GGGGTGGCAGGGGTGGGGAGTGG - Intronic
1017300016 6:152846175-152846197 GTGGTTGCAGAGGCTGGGAGTGG + Intergenic
1017595438 6:156023525-156023547 AGGGATGGAGGGGTAAGGAGTGG + Intergenic
1018055412 6:160048016-160048038 GGGGCTGCAGGACCAAGGTGGGG + Intronic
1018839530 6:167508105-167508127 GAGGTGGCAGGGGAAGGGAGGGG - Intergenic
1019050193 6:169176798-169176820 GAGGCTGCAGGGTCCAGGAGAGG + Intergenic
1019292365 7:257092-257114 GGGTGTGCAGGGGCGAGGACAGG - Intronic
1019599828 7:1875577-1875599 GGGCTGGGAGGGGCAGGGAGAGG + Intronic
1019982120 7:4629426-4629448 GGGGGTTGAGGGGAAAGGAGGGG - Intergenic
1020031114 7:4933468-4933490 GGGGATGCAGGAGCAAAGACAGG - Intronic
1020409387 7:7874301-7874323 GGGGTGGCCGGGGAAAGAAGTGG - Intronic
1020551087 7:9605699-9605721 GGGGTTCCGGGGGCAAGGGGAGG - Intergenic
1021476961 7:21073155-21073177 AGGGTTGCAGGGGAATGGGGTGG + Intergenic
1021620851 7:22550016-22550038 GACGTTGCAAGGGCTAGGAGCGG + Intronic
1021821488 7:24502217-24502239 GGGGTGTCGGGGGCTAGGAGAGG - Intergenic
1022091862 7:27113387-27113409 TGGGTTGCAGAGGGAAGGAGAGG - Intronic
1022214076 7:28240770-28240792 GGGAATGCAGGGGTAAGGGGTGG - Intergenic
1022465292 7:30649333-30649355 GGGGGTGAAGGGGAAAGAAGTGG + Intergenic
1022735340 7:33070747-33070769 GGGGATGCTGGGGCAAAGGGTGG - Intergenic
1023382487 7:39623235-39623257 GGGGTTCTTGGGGGAAGGAGGGG - Intergenic
1023718496 7:43068664-43068686 GAGGTTGCTGGGGACAGGAGTGG - Intergenic
1023908256 7:44537002-44537024 GGGGTGGGAGGGGAAGGGAGGGG - Intronic
1024715515 7:52075565-52075587 GGGGTTGTGGGGGCAAGGGAAGG - Intergenic
1025020423 7:55475765-55475787 GGGGTAGAAAGGGTAAGGAGAGG + Intronic
1026292154 7:69017548-69017570 GTGGTTGCAAGGGCTGGGAGTGG - Intergenic
1026972681 7:74477716-74477738 GTGGTTGCAGGGGCATGGGTGGG + Intronic
1027466762 7:78524232-78524254 GGGGTAGCAGGGGCAGGGAGAGG - Intronic
1028161185 7:87486159-87486181 GGGGGTGGAGGGGCAAGAAGAGG + Intergenic
1029405339 7:100371592-100371614 TGGGGAGCAGGGGCAGGGAGGGG - Intronic
1029706252 7:102277924-102277946 GGGGGGGGAGGGGCAAGGAAAGG - Intronic
1031172851 7:118313438-118313460 GGGGGTTGAGGGGCAAGGGGAGG - Intergenic
1031225439 7:119032141-119032163 GGGGGTTGCGGGGCAAGGAGAGG - Intergenic
1031384109 7:121125452-121125474 GGGGGTTGGGGGGCAAGGAGAGG - Intronic
1031798682 7:126213750-126213772 GGGGAATCAGGGGCAGGGAGTGG - Intergenic
1032087436 7:128891384-128891406 GGACTTGCAGAGGCCAGGAGAGG - Intronic
1032095313 7:128935258-128935280 GGGGGTGGAAGGGCAAGTAGAGG - Intergenic
1032238201 7:130141944-130141966 GGGGATGGAGGGAAAAGGAGAGG + Intergenic
1032252762 7:130272042-130272064 GAGGTTGTAGGGCCAAGGGGTGG + Intronic
1033313234 7:140277617-140277639 GAGGTTGCAGGAGAGAGGAGGGG + Intergenic
1033385115 7:140865942-140865964 GGGATGGCAGGGGAAAGGAGGGG + Intronic
1033478677 7:141716409-141716431 GAGGGTGCAGGGTGAAGGAGAGG - Intronic
1033597267 7:142866753-142866775 GAGGCTGAATGGGCAAGGAGAGG + Intronic
1034086105 7:148324173-148324195 GGGGTTTCAGAGGCCAGGTGTGG - Intronic
1034229274 7:149508599-149508621 GGAGTTGCTGGGGCTAGGACTGG - Intergenic
1034420277 7:150986958-150986980 GGGGTTTCAGGGGCAGGCTGAGG - Intergenic
1034427872 7:151024044-151024066 GGGGTTGCCGGGGCCAGGGGTGG + Exonic
1034450862 7:151136637-151136659 GGGATTGCAGGCGTAATGAGGGG + Intronic
1034534910 7:151720664-151720686 GGGGATGGAGGGGGATGGAGGGG + Intronic
1034547891 7:151800928-151800950 GGGGCTGCAGGGTCAGGGAGGGG + Intronic
1034561927 7:151885883-151885905 GGGACGGCAGGGGCAGGGAGGGG + Intergenic
1034987132 7:155523348-155523370 GGTGTGGCGGGGGCAGGGAGTGG + Intronic
1035977057 8:4324379-4324401 GGTGGGGCAGGAGCAAGGAGGGG + Intronic
1036405724 8:8453696-8453718 GGGGATCAAGGGGCAAGGATAGG - Intergenic
1036618203 8:10404725-10404747 GGGGTTTCAGGGGCAGCCAGAGG + Intronic
1037353506 8:17991856-17991878 GGGGTTTCAGGGGAAAGGGTGGG - Intronic
1037749317 8:21670117-21670139 AGGGTTTCAAGGGGAAGGAGTGG + Intergenic
1037788354 8:21916319-21916341 GGGGTGGAAGGGGCAGGGATGGG - Intergenic
1038152330 8:24953798-24953820 GGGGATGCAGATGCAAGGTGAGG + Intronic
1039373916 8:37014287-37014309 GGGGGTGCAGTGGCTGGGAGAGG - Intergenic
1039564592 8:38542025-38542047 GGGGTTGCTGGGGCTAGGGACGG - Intergenic
1040985172 8:53286410-53286432 GGGTTTGAAAGGGCAAGGAAAGG + Intergenic
1041242783 8:55862507-55862529 TGGCTGGCAGGGGCAGGGAGGGG - Intergenic
1041726840 8:61026025-61026047 GGGGTAGCAGGGGGAGGGAAGGG - Intergenic
1042095876 8:65215204-65215226 GGGGGGTGAGGGGCAAGGAGAGG + Intergenic
1042481015 8:69302457-69302479 GGAGTGTCAGGTGCAAGGAGTGG - Intergenic
1042799226 8:72700194-72700216 GGGGTTTGGGGGGCAAGGGGAGG + Intronic
1044058725 8:87605707-87605729 GTGGTGGCAGGGGGAAGGTGGGG + Intronic
1044459620 8:92429320-92429342 GGGGTGGCAGGGGGAAGGCTTGG + Intergenic
1044560931 8:93611372-93611394 GGGGTTGGGGGGGCTAGGGGAGG + Intergenic
1044807324 8:96021520-96021542 GGGGCTGCAGGGCCAAGAGGTGG - Intergenic
1044953663 8:97457713-97457735 GGGGATTCAGGGGGAAGGATGGG + Intergenic
1045489158 8:102656000-102656022 GGGGGACGAGGGGCAAGGAGTGG - Intergenic
1045503598 8:102762126-102762148 GAGGTTGTCGGGGGAAGGAGAGG + Intergenic
1046015157 8:108596037-108596059 GGGGTTTAAGAGGCAAGGGGAGG + Intergenic
1046069498 8:109233235-109233257 GGGGGGGCAGTGGCACGGAGCGG - Intergenic
1046222304 8:111232116-111232138 GGGGTTTGAGGGGCTAGGGGAGG - Intergenic
1046391713 8:113581632-113581654 ATGGTTGCAGAGGCAGGGAGTGG - Intergenic
1046956260 8:120065788-120065810 GGGGTGGCAGGGGTTAGGAGCGG - Intronic
1047335825 8:123935173-123935195 GGGGTTGGAAAGGAAAGGAGAGG - Intronic
1047424987 8:124736932-124736954 GGGGTGGCAGGGGAACAGAGGGG + Intergenic
1048069402 8:131005780-131005802 GGGCCTGAAGGGGCAAGGGGAGG - Intronic
1048973495 8:139658139-139658161 GAGTTTGCAGAGGCAAGGAGAGG + Intronic
1049181929 8:141227323-141227345 GGGGTGGGGAGGGCAAGGAGTGG + Intronic
1049377399 8:142295803-142295825 GGGGTTGGAGGTGCAGGCAGAGG - Intronic
1049394452 8:142393166-142393188 GCTGCTGCAGGGGCCAGGAGTGG - Intronic
1049623178 8:143608242-143608264 TGGGTTCCTGGGGCCAGGAGGGG - Intronic
1049645767 8:143734969-143734991 GGAGTGGCAGGGGCGAGGGGTGG - Intergenic
1049733437 8:144191027-144191049 GGTGTTGCATTGGCAAGCAGAGG + Intronic
1050737781 9:8784065-8784087 AGGGCTGAAGGGGCAAAGAGTGG - Intronic
1051010437 9:12406521-12406543 GGGCTTGCAAAGGCCAGGAGGGG - Intergenic
1051017557 9:12498180-12498202 GTGGTTACTGGGGCTAGGAGTGG + Intergenic
1052531198 9:29686329-29686351 GGAGGGGCAGGGGCAGGGAGTGG + Intergenic
1052977390 9:34421294-34421316 GGGGGTACAGAGGTAAGGAGGGG + Intronic
1053131511 9:35618184-35618206 GGGGATGCAGGATCAAGGGGAGG + Intronic
1053487453 9:38470697-38470719 GGGGATGGAGGGAAAAGGAGAGG - Intergenic
1053522180 9:38791452-38791474 GGGTTTCCAGGGCCAAGGGGAGG - Intergenic
1054813275 9:69451593-69451615 GGGATTGTAGGGGCAAGCCGAGG - Intronic
1055954433 9:81760994-81761016 TGTGTTCCAGGAGCAAGGAGGGG - Intergenic
1056232062 9:84557130-84557152 TGAGTTGGAGGGGAAAGGAGAGG - Intergenic
1056578527 9:87873411-87873433 TGGGTGGCAGGGGCGAGGTGGGG + Intergenic
1056602177 9:88054898-88054920 GGTGCTGGAGGGGCAAGGTGTGG + Intergenic
1057836700 9:98451178-98451200 GGGGCTGCAGGGGTGGGGAGAGG + Intronic
1058123472 9:101164935-101164957 GGGGTTGGAGGTGAGAGGAGAGG + Intronic
1058132031 9:101264379-101264401 GAGGATGCATGGGGAAGGAGAGG - Intronic
1058392760 9:104515224-104515246 GGGATTGCTGGGTCAAAGAGTGG - Intergenic
1058484841 9:105433594-105433616 GGGGTGGCAGGGGCAGTGGGAGG - Intronic
1058817572 9:108699057-108699079 GGGGATGGAGGGGAAGGGAGGGG + Intergenic
1059676798 9:116547987-116548009 GGGCTGCCAGAGGCAAGGAGTGG - Intronic
1059828037 9:118055555-118055577 GTGGTTGCTGGGGCAGGGACGGG - Intergenic
1059955123 9:119507792-119507814 GGGGTTTGAGGGGCTAGGGGAGG + Intronic
1061059343 9:128242930-128242952 TGGGCTGCAGGGTCAGGGAGGGG - Intronic
1061488112 9:130930556-130930578 TGGGTGGCAGGGGCAGCGAGAGG - Intronic
1061550407 9:131331336-131331358 GGGGGCGCAGGGGCAGGAAGAGG - Intergenic
1061587221 9:131576967-131576989 GGGTGTGGGGGGGCAAGGAGGGG - Exonic
1061926574 9:133808839-133808861 GGGGCTTCAGAGGAAAGGAGAGG + Intronic
1061954895 9:133956287-133956309 GGGGCTGCAGGGCCCAGGGGAGG - Intronic
1061991853 9:134163565-134163587 GGGGAGCCAGGGGCCAGGAGAGG - Intergenic
1062220850 9:135414394-135414416 GGGGCTGTGGGGGCCAGGAGTGG + Intergenic
1062272040 9:135714184-135714206 GGGGTTGCAGGGGTGTGGCGGGG + Intronic
1062349346 9:136131499-136131521 GTGGTTGCAAGAGCAAGGACGGG + Intergenic
1062355807 9:136161725-136161747 GGGAGGGAAGGGGCAAGGAGGGG - Intergenic
1062527700 9:136984979-136985001 GGGGCTGGAGGGGCGAAGAGAGG - Exonic
1062533804 9:137012957-137012979 GGGGGGGCAGGGGCAGTGAGGGG - Intronic
1062560552 9:137139776-137139798 GGGGTTGCAGGATGGAGGAGAGG - Intronic
1185589023 X:1261587-1261609 TGGGATTAAGGGGCAAGGAGGGG - Intergenic
1185630454 X:1513012-1513034 GGGGGTGGGGGGGCAAGGGGAGG - Intronic
1185778807 X:2828838-2828860 GGGGCTGCAGGGAGGAGGAGAGG + Exonic
1186449373 X:9659277-9659299 GTGGTTGCCGGGGCAGGGTGGGG - Intronic
1186518600 X:10186038-10186060 GGAGGTGCTGGGGCCAGGAGGGG + Intronic
1186601616 X:11043911-11043933 GTGGGTGGAGGGGCAAGTAGGGG - Intergenic
1187186345 X:16990272-16990294 GGGGTTGAGGGGGCAAGGGTTGG + Intronic
1187330894 X:18338567-18338589 GGGGAGGAAGGGGCAAGGAATGG + Intronic
1187486462 X:19708692-19708714 GGAGTCGCAGGGGTCAGGAGTGG - Intronic
1187871323 X:23767239-23767261 TGGGCTCCAGGAGCAAGGAGAGG + Intergenic
1190437307 X:50438214-50438236 GGGGTGGAAGGGGCAAGAGGAGG - Intronic
1190684186 X:52855732-52855754 GGGGGGTCGGGGGCAAGGAGAGG + Intergenic
1190895431 X:54613809-54613831 GAGGTGGCAGGGGCAGGGTGGGG + Intergenic
1192216757 X:69164673-69164695 GAGGATGGAGGGGCAAGGAGGGG + Intronic
1192231666 X:69269505-69269527 GGGGGAGCAGGGGCATGGAGAGG + Intergenic
1192437555 X:71152343-71152365 GGGAGAGAAGGGGCAAGGAGGGG - Intronic
1193057148 X:77165265-77165287 GGGGTTGATGGGGAAAGGTGGGG - Intergenic
1193479589 X:82010799-82010821 GGGGTTGCATGGGGAGGCAGGGG + Intergenic
1193739214 X:85197965-85197987 GTAGTGGCAGGGGCAAGGGGTGG - Intergenic
1193874839 X:86849614-86849636 GGGGATGCAGGGGGAAGGCTGGG - Intergenic
1194551168 X:95301249-95301271 GGGGGTGGTGGGGCAAGGGGAGG + Intergenic
1194661575 X:96633846-96633868 GGGGGTTGGGGGGCAAGGAGAGG + Intergenic
1194697484 X:97072221-97072243 GGAGTAGCAGTGCCAAGGAGTGG - Intronic
1197378302 X:125709401-125709423 TGGGTTCCAGGAGCAAGGAGAGG - Intergenic
1198214640 X:134545204-134545226 GGGCTTCCCGGGGCCAGGAGTGG - Intergenic
1198301821 X:135340914-135340936 GGGGTGGCAGGGGCCAAGTGGGG + Intronic
1199158156 X:144574106-144574128 CAAGTTGCAGGGGCAACGAGGGG - Intergenic
1199666535 X:150100728-150100750 GGGCTTTCAGGGGCAAGGGCCGG - Intergenic
1200186705 X:154188099-154188121 GGGCTTGCAGGGTGAATGAGTGG - Intergenic
1200192356 X:154225237-154225259 GGGCTTGCAGGGTGAATGAGTGG - Intronic
1200198111 X:154263041-154263063 GGGCTTGCAGGGTGAATGAGTGG - Intronic
1200310343 X:155071336-155071358 GGGGCTGTGGGGGCGAGGAGGGG - Exonic
1201130169 Y:10946428-10946450 TGGGTTGGAGTGGAAAGGAGTGG - Intergenic
1201409926 Y:13689465-13689487 GGGGTTGGAGGAGCGAGGAAAGG - Intergenic
1201462755 Y:14245274-14245296 TGGGGTTGAGGGGCAAGGAGAGG + Intergenic
1201859770 Y:18584233-18584255 TGGGATGCAGTGGCAAGGAGCGG - Intronic
1201873551 Y:18736148-18736170 TGGGATGCAGTGGCAAGGAGCGG + Intronic
1202167294 Y:22003398-22003420 TGGAATGCAGTGGCAAGGAGTGG + Intergenic
1202224066 Y:22582971-22582993 TGGAATGCAGTGGCAAGGAGTGG - Intergenic
1202319049 Y:23612690-23612712 TGGAATGCAGTGGCAAGGAGTGG + Intergenic
1202551720 Y:26057367-26057389 TGGAATGCAGTGGCAAGGAGTGG - Intergenic