ID: 948601228

View in Genome Browser
Species Human (GRCh38)
Location 2:239108461-239108483
Sequence CTCCTCAGCCTGCTGCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 1, 1: 0, 2: 2, 3: 52, 4: 424}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948601228_948601235 13 Left 948601228 2:239108461-239108483 CCCTGCTGCAGCAGGCTGAGGAG 0: 1
1: 0
2: 2
3: 52
4: 424
Right 948601235 2:239108497-239108519 GGAGGTCTGCCCTGGGTGGCTGG 0: 1
1: 0
2: 3
3: 35
4: 350
948601228_948601231 -5 Left 948601228 2:239108461-239108483 CCCTGCTGCAGCAGGCTGAGGAG 0: 1
1: 0
2: 2
3: 52
4: 424
Right 948601231 2:239108479-239108501 AGGAGAAAACAGTGATGAGGAGG 0: 1
1: 1
2: 5
3: 67
4: 626
948601228_948601234 9 Left 948601228 2:239108461-239108483 CCCTGCTGCAGCAGGCTGAGGAG 0: 1
1: 0
2: 2
3: 52
4: 424
Right 948601234 2:239108493-239108515 ATGAGGAGGTCTGCCCTGGGTGG 0: 1
1: 0
2: 1
3: 25
4: 205
948601228_948601232 5 Left 948601228 2:239108461-239108483 CCCTGCTGCAGCAGGCTGAGGAG 0: 1
1: 0
2: 2
3: 52
4: 424
Right 948601232 2:239108489-239108511 AGTGATGAGGAGGTCTGCCCTGG 0: 1
1: 0
2: 0
3: 19
4: 194
948601228_948601230 -8 Left 948601228 2:239108461-239108483 CCCTGCTGCAGCAGGCTGAGGAG 0: 1
1: 0
2: 2
3: 52
4: 424
Right 948601230 2:239108476-239108498 CTGAGGAGAAAACAGTGATGAGG 0: 1
1: 0
2: 2
3: 30
4: 392
948601228_948601238 23 Left 948601228 2:239108461-239108483 CCCTGCTGCAGCAGGCTGAGGAG 0: 1
1: 0
2: 2
3: 52
4: 424
Right 948601238 2:239108507-239108529 CCTGGGTGGCTGGACCTTGCAGG 0: 1
1: 1
2: 4
3: 15
4: 340
948601228_948601239 24 Left 948601228 2:239108461-239108483 CCCTGCTGCAGCAGGCTGAGGAG 0: 1
1: 0
2: 2
3: 52
4: 424
Right 948601239 2:239108508-239108530 CTGGGTGGCTGGACCTTGCAGGG 0: 1
1: 1
2: 1
3: 39
4: 259
948601228_948601233 6 Left 948601228 2:239108461-239108483 CCCTGCTGCAGCAGGCTGAGGAG 0: 1
1: 0
2: 2
3: 52
4: 424
Right 948601233 2:239108490-239108512 GTGATGAGGAGGTCTGCCCTGGG 0: 1
1: 0
2: 0
3: 15
4: 184
948601228_948601240 25 Left 948601228 2:239108461-239108483 CCCTGCTGCAGCAGGCTGAGGAG 0: 1
1: 0
2: 2
3: 52
4: 424
Right 948601240 2:239108509-239108531 TGGGTGGCTGGACCTTGCAGGGG 0: 1
1: 0
2: 1
3: 22
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948601228 Original CRISPR CTCCTCAGCCTGCTGCAGCA GGG (reversed) Intronic
900415462 1:2532581-2532603 CTCCAAAGCCTGCGGGAGCAGGG - Intergenic
900582484 1:3415922-3415944 CTCCGCAGCCCGGAGCAGCAGGG - Intronic
900626295 1:3610251-3610273 GTCCCCAGCCAGCTGCAGCTTGG + Intronic
900864078 1:5254940-5254962 CTCCTCAGCATCCTTCAGCAAGG - Intergenic
900890099 1:5443413-5443435 CTCCTCAGCCTCCGGAAGCATGG + Intergenic
901358882 1:8678084-8678106 CTTCTCAGGCTGCAGAAGCATGG + Intronic
901404217 1:9035393-9035415 ATCCTTGGCCTTCTGCAGCAAGG - Exonic
901821909 1:11835741-11835763 CCCATCAGCCTGGTACAGCAGGG + Intronic
902606509 1:17572270-17572292 CTCCTCAGCCCCCTGCTCCATGG + Intronic
902628777 1:17692470-17692492 CTCCTCTGCCTGGAGCAGCTGGG - Intronic
902916183 1:19641009-19641031 CTCCCCATCAGGCTGCAGCAGGG - Intronic
902983982 1:20144263-20144285 CTCCTCCCACTGCTGCAGCCGGG + Intronic
903014399 1:20352601-20352623 CACCTCAGCATGCTGTAGCAGGG + Intronic
903162555 1:21499628-21499650 CTCCACAGCCTGCTGAATCTTGG + Intergenic
903468089 1:23566468-23566490 CTCCTAAGCCTGCTGATGCTTGG - Intergenic
904674789 1:32192363-32192385 CTCCTGGGCCTGCTGGAGCTTGG - Exonic
904675084 1:32194138-32194160 CTCCTCAGCCATCTCAAGCAGGG - Exonic
905243355 1:36595717-36595739 TTCCTCGGCCTCCTGCAGCGGGG - Intergenic
905528622 1:38658900-38658922 CTCCTGAGCCTGCTGCATTAGGG - Intergenic
905622924 1:39464419-39464441 CTCCTCAGGAGACTGCAGCATGG - Intronic
905863765 1:41366147-41366169 CCCCCCAGCCTGCTCCAGCAGGG + Intronic
905886425 1:41494381-41494403 CTCCTCGGCCTGCGTCAGCGAGG + Intergenic
906100674 1:43258608-43258630 CTCCTCAGCATGAAGCAGCCAGG - Intronic
906273741 1:44501029-44501051 CCCCACAGCCTTCTGCAGCCTGG - Intronic
906382010 1:45338877-45338899 CACCTCAGCCTCCTGTAGCTGGG + Intronic
906988565 1:50713044-50713066 CACCTCAGCCTCCTGTAGCTGGG - Intronic
909393011 1:75136790-75136812 GTCCTCTGTCTGCTGCAGGAGGG - Intronic
912199162 1:107436819-107436841 GCCCTCTGCCTGCTGCAGCATGG + Intronic
912588598 1:110790409-110790431 CACCTCTGCTTGCTGCATCATGG - Intergenic
915060090 1:153174498-153174520 CTCCTCAGCCAGCCGCAAAAGGG + Intergenic
917118782 1:171627704-171627726 CTCCTCAGTCTGGTGAAGAATGG + Intergenic
917854580 1:179090152-179090174 CTCCCCACCCTGCTGTGGCATGG - Intronic
918031021 1:180811399-180811421 GTCCACAGCCTGCACCAGCATGG + Exonic
918190571 1:182170178-182170200 CACCTCAGCCTCCTGTAGCTGGG - Intergenic
919795575 1:201319635-201319657 CTCATCAGCCTGGTGCAGGTGGG - Intronic
919839306 1:201597632-201597654 GCCCTCAGCCTGGTGGAGCAGGG - Intergenic
919920919 1:202165960-202165982 CTCCTGGGCCTGCCCCAGCAGGG - Intergenic
919956959 1:202427100-202427122 CTCCCCAGTGTGCAGCAGCATGG - Exonic
920435993 1:205947552-205947574 CTCCTCTGCCTGCTCCTGCCAGG - Intergenic
921082950 1:211758059-211758081 CTCCTCACCCTGCTGTATCTTGG + Intronic
922320438 1:224481981-224482003 CTCCTCTGCCTGCTGGGGAAAGG - Intronic
922418270 1:225441718-225441740 TGCCTCAGCCAGCTACAGCAGGG + Intergenic
923306480 1:232693528-232693550 CTCCTCAGCCTTCTTTAGCCAGG - Intergenic
923539648 1:234878705-234878727 CTCCTCAGCCAGCAGTTGCATGG + Intergenic
923757004 1:236800880-236800902 TTCCTCATCTTGCTGAAGCATGG + Intronic
924646836 1:245885589-245885611 CTCTTCAGCCTGCAGGAGAAAGG - Intronic
1064695425 10:17960268-17960290 CTCCTCTTCCTGATACAGCAAGG + Intronic
1065805751 10:29392189-29392211 CTCTTTAACCTGCAGCAGCAAGG - Intergenic
1065869901 10:29947415-29947437 TTCCTCAGTCTGCAGCTGCATGG - Intergenic
1068964595 10:62899001-62899023 TTCCTGAGCCTGGTGGAGCATGG - Intronic
1069119813 10:64555778-64555800 CTCGTCAGCGTGCTGCAGAGGGG + Intergenic
1069490645 10:68857717-68857739 CTCATGAGCCTGGAGCAGCATGG - Intronic
1069715758 10:70520185-70520207 CTTCTCAGACTGCAGCAGAAAGG - Intronic
1070350824 10:75590859-75590881 TGCCTCAGCCTCCTGCAGCTGGG + Intronic
1070959803 10:80490647-80490669 CTCCTCAGCCGACTCCAGCTGGG - Intronic
1071248589 10:83791660-83791682 CTCCTCTGTCCGCAGCAGCAGGG + Intergenic
1072138294 10:92567855-92567877 CACCTCAGCCTCCTGTAGCTAGG - Intronic
1072623384 10:97095639-97095661 CTTCTCTTCCTGCTGCAGTATGG - Intronic
1072982965 10:100115176-100115198 CTTGTCCGCCTGCTGCGGCAGGG + Intergenic
1074315322 10:112356304-112356326 CAACTCAGCCTGCAGCACCAAGG - Intergenic
1074591984 10:114822098-114822120 CTCCACGGCGTGCTGCAGGATGG - Exonic
1074762184 10:116675324-116675346 CTGCACCGCCTGCTGCAGCAGGG + Exonic
1074882823 10:117671848-117671870 TTCCTGAGCCTGCTCCAGGAAGG + Intergenic
1075269813 10:121038838-121038860 CTCCTCAGCCAGGTGAAGGAAGG + Intergenic
1075390539 10:122087809-122087831 CTCCTTAGCCTGCTGGGGCCTGG - Exonic
1076151910 10:128169235-128169257 TTCCTCAGCATCCTGCAGCCAGG - Intergenic
1076844113 10:133060662-133060684 CTCCCCAGCCTGCAGCAGGCTGG - Intergenic
1077130383 11:969135-969157 CTCCACAGCCTGCTGGAGGCTGG + Intronic
1077195336 11:1277045-1277067 CTCCTCCCCCATCTGCAGCAGGG + Exonic
1077239041 11:1501083-1501105 CTCCTCAGCCTGCGACAGACAGG + Intronic
1077370714 11:2180441-2180463 CTCCTCAGCCTGCTACCCCATGG + Intergenic
1077925927 11:6682194-6682216 CTCCTAAACCAGCTGCTGCAGGG - Exonic
1079053893 11:17188454-17188476 CTCCTGATGCTGCTGCACCAGGG - Intronic
1080513563 11:32999615-32999637 CTACTCAGGAGGCTGCAGCAGGG - Intergenic
1080650550 11:34219427-34219449 CTCCTCAGCCTCCCACAGCTGGG - Intronic
1080735792 11:35012562-35012584 CTTCTCAACCTGCTGGGGCATGG - Intronic
1080763385 11:35273913-35273935 CTCCTCATCCTGCTAGATCATGG - Intronic
1081695788 11:45108317-45108339 CCCCTCAAGCTGCTGCATCATGG - Intronic
1082004001 11:47409774-47409796 CTCCTCAGCCACCGGCGGCACGG - Intronic
1083802195 11:65053210-65053232 CGCCTCACCCTTCTTCAGCAGGG + Exonic
1084546835 11:69818890-69818912 CTGCTCAGCCTGCTGGAGCCCGG - Exonic
1084639362 11:70415399-70415421 CTCCCCAGCATGCGGCAGCAGGG - Intronic
1084951352 11:72667683-72667705 CTCCTCAGCCTGAGGCAGAGAGG + Intronic
1085322547 11:75583714-75583736 CTCCCCGGGCGGCTGCAGCAGGG + Intergenic
1085808314 11:79657276-79657298 CTCCCCAGGCAGCTCCAGCATGG - Intergenic
1086127773 11:83367175-83367197 CTTCTCTTCCTGGTGCAGCAAGG + Intergenic
1087293238 11:96341648-96341670 CTCCTGAGCCTTGTACAGCATGG - Exonic
1087766348 11:102159285-102159307 GTGCTCAGCCTGCAGCAGGAGGG + Intronic
1088457654 11:110049831-110049853 GTCCTCATCATGGTGCAGCAGGG + Intergenic
1088790620 11:113223147-113223169 CTCCTCCTTCTGCTGCAGCCTGG + Intronic
1089172664 11:116526216-116526238 CTCCTCACCCTGCAGCAGGTGGG - Intergenic
1089489678 11:118874373-118874395 TTCCTCAGCCTCCTAAAGCACGG - Intergenic
1090386280 11:126359168-126359190 GTCCTCTGCCAACTGCAGCATGG + Intronic
1090826728 11:130392446-130392468 CTCTTCACACTGCCGCAGCAGGG + Intergenic
1091454514 12:596806-596828 CACCTCAGCCTCCTGTAGCTGGG - Intronic
1092157715 12:6295185-6295207 CTTCCCAGCCTACAGCAGCAGGG - Intergenic
1092529965 12:9335967-9335989 CTCTTCAGCCTCCTGCTGCAGGG - Intergenic
1095445022 12:42274152-42274174 CCCTTCAGCCTGCTGCTGCACGG - Intronic
1095495136 12:42776411-42776433 TTCCTCCGCCTGCTTCATCATGG - Intergenic
1095830951 12:46586052-46586074 CCCCCCATCCAGCTGCAGCAAGG + Intergenic
1096570016 12:52517224-52517246 CTCCTCATACTGATGCAGCCAGG + Exonic
1096706473 12:53425206-53425228 CTCCTCCTCCTGCTGCTGCTGGG + Exonic
1097040628 12:56153980-56154002 CTGCTAAGCCAGCAGCAGCAGGG + Exonic
1097521774 12:60679386-60679408 TTACTCAAGCTGCTGCAGCATGG - Intergenic
1099713793 12:86264741-86264763 CTTCTGAGCCTGCTGGGGCAAGG - Intronic
1100386254 12:94106732-94106754 CTCCCCAGCTAGATGCAGCAAGG + Intergenic
1102058634 12:109915494-109915516 CTCCGCCTCCTGCTGCAGCAGGG - Exonic
1102491442 12:113291739-113291761 CTCTTCAGCCTGCAGCGTCAGGG + Intronic
1102871450 12:116417290-116417312 CTCTCCAGCCTGCTTCACCAAGG - Intergenic
1103932560 12:124458304-124458326 CTCCTCTCTCTGCTGCAGCCCGG - Intronic
1104025510 12:125023336-125023358 CTCTTCTGCCTGCTGGAACATGG - Intronic
1104563822 12:129862328-129862350 ATCCTCAGCCAGCCCCAGCAAGG - Intronic
1104709321 12:130974252-130974274 CTCCTCTGCCTCCTGCTACAGGG - Intronic
1104710713 12:130983837-130983859 CTCCTGAGCTTGCTGCTGGAAGG - Intronic
1105388713 13:19957620-19957642 CTCCACAGCCCGCTGCATCGCGG - Intergenic
1105634585 13:22204774-22204796 CTTCTCAGCCTGCTCCAGCTTGG - Intergenic
1106113946 13:26801205-26801227 CTCCTCAGACTGCGGGTGCAGGG + Intergenic
1106589724 13:31089007-31089029 CTCCTCAGGCAGCTTCAGCATGG + Intergenic
1106600331 13:31181818-31181840 CCTCTCAGCCTGCTGCAGAGTGG - Intergenic
1106915093 13:34505233-34505255 CTCCTGAGCCTGGTGCAAGATGG - Intergenic
1107512939 13:41103228-41103250 CACCTCAGCCTCCTGTAGCTGGG - Intergenic
1108349847 13:49581901-49581923 CGCCTCAACCTGCTGCAACCTGG - Intronic
1108802440 13:54116095-54116117 GTCCTCAGCCTCCTGAAGCCTGG - Intergenic
1109348385 13:61145154-61145176 CTTCTGAGCCTGCTGAGGCAAGG - Intergenic
1109687703 13:65843442-65843464 CTTCTGAGCCTGCAGGAGCAGGG - Intergenic
1111154070 13:84298979-84299001 TTCCTCAGCCTCCTGTAGCTGGG + Intergenic
1111581101 13:90224775-90224797 CTCTTCCACCTGCTGCAGCCTGG - Intergenic
1112780163 13:102891799-102891821 CTACTCAGGAGGCTGCAGCAGGG - Intergenic
1113681501 13:112248017-112248039 CTCCTGAGCCTGGGCCAGCAGGG - Intergenic
1115467139 14:33727918-33727940 GTGCACAGCCTGCTGCAGAATGG + Intronic
1117161592 14:52995171-52995193 CACATTAGCCTGCTGCGGCAGGG + Intergenic
1117966651 14:61213377-61213399 CTCCTCTCCCTGCTGAGGCATGG - Intronic
1118156261 14:63245394-63245416 CTCCTCAGCCTCCTAAAGTATGG - Intronic
1118818390 14:69328549-69328571 CTCCTTCACCCGCTGCAGCATGG - Exonic
1119776650 14:77253294-77253316 CTCCTCCTCGGGCTGCAGCAGGG - Exonic
1119788758 14:77330992-77331014 CTGCTCCCCCTGCTGCATCAGGG + Intronic
1120123168 14:80707359-80707381 CTCCTCAGGCAGCTCTAGCACGG - Intronic
1120405521 14:84090394-84090416 GCCATCAGCCGGCTGCAGCAGGG + Intergenic
1121469238 14:94139033-94139055 CTCCTTCTCCTACTGCAGCAGGG + Intergenic
1122292979 14:100689359-100689381 GTCCTCATCCTGGTTCAGCAGGG - Intergenic
1122562560 14:102626788-102626810 CTGCTGAGCCTGCTTCAGCTGGG + Intronic
1122687830 14:103518428-103518450 CCCCCCAGCCTTCTGCACCAGGG + Intergenic
1122747319 14:103906235-103906257 CTCCTCTGGATGCTGGAGCAAGG + Intergenic
1122938688 14:104971682-104971704 CACCTCACCCTGCTGCACCCTGG + Intronic
1124512768 15:30340703-30340725 CCCCTCAGCCTGCATCAGGAGGG + Intergenic
1124636359 15:31367280-31367302 TCCCTCAGCCTGCTGCAGAGAGG - Intronic
1124720886 15:32109980-32110002 CTCCTCTGCCTGCTGAATGATGG - Intronic
1124730147 15:32190047-32190069 CCCCTCAGCCTGCATCAGGAGGG - Intergenic
1125574337 15:40745043-40745065 CTCGTCGGCCTGCTGCAGGAGGG + Exonic
1125733731 15:41909266-41909288 CCCTTGAGCCTGCAGCAGCAAGG + Intronic
1126105536 15:45144650-45144672 CTCCTCTGCCTTCTCCAGTATGG + Intronic
1127147087 15:56035598-56035620 CTGCTCAGCCTGCTGCCACTGGG - Intergenic
1128046561 15:64623081-64623103 CTTCTCAACCTGCTTCTGCAGGG + Intronic
1129029668 15:72609172-72609194 GTCCTCCTCCTGCTGCTGCATGG - Intergenic
1129108266 15:73323298-73323320 CTGCTCACCCCGCTGCAGCCAGG - Exonic
1129153386 15:73703027-73703049 GTGCGCATCCTGCTGCAGCACGG - Exonic
1129153699 15:73704431-73704453 GTGCGCATCCTGCTGCAGCACGG - Exonic
1129174842 15:73832559-73832581 CCCCTCAGTCTCCTGAAGCAGGG + Intergenic
1129257018 15:74339401-74339423 CCCCCCAGGCTGCTGCAGCTAGG - Intronic
1129678251 15:77643811-77643833 CACCTCTTCCTGCTCCAGCATGG + Intronic
1129745079 15:78012990-78013012 CTCCAGCGCCTTCTGCAGCAAGG + Exonic
1131406422 15:92168629-92168651 CACCTAAGACTGCTGTAGCATGG + Intronic
1132947940 16:2542868-2542890 CTCCTCAGCCCTCTCCAGCACGG - Intronic
1132966507 16:2658474-2658496 CTCCTCAGCCCTCTCCAGCACGG + Intergenic
1136024520 16:27461234-27461256 CTGCCGAGCCTCCTGCAGCAGGG - Exonic
1138331358 16:56218425-56218447 CTGCCGAGCCTGCTGCAGCAGGG - Intronic
1138336112 16:56253820-56253842 CTCCCCAGCCTGGGGTAGCAGGG + Intronic
1138438857 16:57022374-57022396 CTCCACAGCCTCCTCCAGCTTGG - Intronic
1138656170 16:58492809-58492831 CTCCTCAGCCCGCTTGTGCAAGG + Intronic
1139390123 16:66601998-66602020 ATCATCACCCAGCTGCAGCAGGG - Intergenic
1139634964 16:68252927-68252949 CTCCTCACTGTGCTGCAGCCTGG + Intronic
1141121044 16:81356905-81356927 CCGCTCAGCCAGCCGCAGCAAGG + Exonic
1141655858 16:85416273-85416295 CTCGCCAGCCTGCTGGAGGAGGG + Intergenic
1141686773 16:85574787-85574809 CTCCTCACCCAGCTACAGCCAGG + Intergenic
1142156141 16:88533606-88533628 GTGCACAGCCGGCTGCAGCAGGG + Exonic
1142211783 16:88811867-88811889 CTGCTCAACCAGCTGCAGCTCGG + Exonic
1142319062 16:89369406-89369428 CTCTGATGCCTGCTGCAGCAAGG + Intronic
1142586201 17:975522-975544 CTGGTCAGCCTGCTCCAGCCAGG - Intronic
1143580724 17:7824191-7824213 GTGCTCTGCCAGCTGCAGCAGGG - Exonic
1144390087 17:14785061-14785083 GTACTCTGGCTGCTGCAGCAGGG - Intergenic
1144780697 17:17807088-17807110 CTCCTCAGCCAGCTGTTCCATGG - Intronic
1145797492 17:27664311-27664333 CTCCCCATCCAGCTGGAGCATGG + Intergenic
1145908344 17:28528520-28528542 CTCTTCAGCCTGGAGCAGCTGGG + Intronic
1146565047 17:33905705-33905727 TTCCTCACCCTGCTGGGGCAGGG + Intronic
1146590961 17:34127672-34127694 CTGCTCTTCCTGCTGCAGGACGG + Intronic
1147186555 17:38716406-38716428 CTCCTCTGGCTGCTCCAGCTTGG - Exonic
1148025215 17:44582519-44582541 TTCCTCAGCTTGCTCCAGGAAGG - Intergenic
1148164750 17:45475543-45475565 CTCCTCAGCATCCCGGAGCAGGG + Exonic
1148665709 17:49373100-49373122 CTACTCAGGAGGCTGCAGCAGGG - Intronic
1148960097 17:51385476-51385498 CGCCTCAGCCGCCTCCAGCATGG + Intergenic
1150280983 17:63929528-63929550 CTCCCCAGCCTGGCCCAGCAGGG - Intronic
1150395969 17:64822210-64822232 CTCCTCAGCATCCCGGAGCAGGG + Intergenic
1151354443 17:73550189-73550211 GTTCTAAGCCTGCTGCAGCAGGG + Intronic
1151403494 17:73871667-73871689 CACCTGAGCCTGCAGCAGCAAGG + Intergenic
1151670294 17:75568494-75568516 CTCCTCAGCCAGCACCACCAGGG - Exonic
1151761786 17:76108260-76108282 CACCTCAGCCTCCTGTAGCTGGG + Intronic
1151787224 17:76280945-76280967 CTCCTCGTCCTGCGGCAGGAGGG + Exonic
1152150419 17:78596614-78596636 CACCTCAGCCTCCTGCATAATGG + Intergenic
1152376215 17:79920137-79920159 CTCCCCTGCCCGCTGCAGGAGGG - Intergenic
1152544428 17:80993576-80993598 CTCCTCAGCCTCCTGCCTTAAGG + Intronic
1152655774 17:81518638-81518660 CTCCCCGGCCTGCTGCCGCGGGG - Intronic
1153773961 18:8436734-8436756 CTCCTGAGGCTGCTGCATCCAGG - Intergenic
1153838994 18:8989589-8989611 CTACTCAGCCTGCTCCAGGATGG - Intergenic
1154177110 18:12092991-12093013 CTCTTCAGCCTGGTGTGGCACGG - Intergenic
1154194335 18:12254644-12254666 CTCCTCACCCTCTTGCAGCTGGG + Intronic
1155495134 18:26435544-26435566 CTTCTCAGCCTGCTGCAGTCTGG + Intergenic
1156205701 18:34883423-34883445 CACCTCAGCCTCCTGTAGCTGGG + Intronic
1158949337 18:62477671-62477693 CTCCAGAGGCTGCAGCAGCAAGG + Intergenic
1159035365 18:63272171-63272193 CTCCCCAGCCTGGGTCAGCAGGG - Intronic
1159646152 18:70920985-70921007 CTTCTCTCCCTGCTGGAGCAAGG + Intergenic
1159946279 18:74446894-74446916 GTACTCCTCCTGCTGCAGCAGGG + Exonic
1160094837 18:75861876-75861898 CCCCTCAGCCTTCTGCAGTTTGG - Intergenic
1161087730 19:2342968-2342990 CTCCTCTACCTGCTTCCGCAGGG + Intronic
1161903811 19:7139933-7139955 CTCCTCGGGATGCTGAAGCAGGG - Intronic
1162372370 19:10287253-10287275 CTCCGCACCCCGCTGCGGCAAGG + Exonic
1162566898 19:11449448-11449470 CTCGTCGGCCTGCCCCAGCAAGG + Intronic
1162739018 19:12763402-12763424 CTCCCCAGCTCGCTGCTGCAAGG + Exonic
1163243172 19:16076612-16076634 CTCGTCCGCCTGCTGCTGCAGGG - Intronic
1163478976 19:17543339-17543361 CTGGTCAGCCAGCTGCAGGAAGG - Exonic
1163823087 19:19507501-19507523 CACCTCTGCCTGCTCCAGCTTGG + Exonic
1164824753 19:31277141-31277163 CTCCTCAGCCTCCTCCAGAGTGG + Exonic
1165187918 19:34037982-34038004 CTCCTTAGCCTCCTGCAACTTGG + Intergenic
1165430272 19:35768042-35768064 TTCTGCAGCCTGCAGCAGCAGGG - Exonic
1165488799 19:36111361-36111383 CTCCTCAGACTGCAGCAGCCTGG + Exonic
1167483474 19:49746718-49746740 CTCCTCCGGCTCCTGCAGCTCGG + Exonic
1167771951 19:51526175-51526197 CTCCCCAGCTTGGAGCAGCAGGG - Intronic
1168141516 19:54391102-54391124 CTCCTCAGCCTGGAGGACCAGGG - Intergenic
1168156916 19:54478926-54478948 CTCCTCAGCCTGGAGGACCAGGG + Intergenic
1168157237 19:54481549-54481571 CTCCTCAGCCTGGAGGACCAGGG + Intergenic
1168374632 19:55866389-55866411 CTCCTCACGCCTCTGCAGCAGGG - Intronic
925155930 2:1648964-1648986 CACCGCGGCCTGCTGCGGCAGGG - Exonic
925385942 2:3461753-3461775 CCCCTCTGGCTTCTGCAGCAGGG + Intronic
926099425 2:10104820-10104842 CTCTTCTGCCTGCTCCAGCCAGG - Intergenic
926224917 2:10960890-10960912 CTCCACACCCTGCTGCCGCCCGG + Intergenic
926519661 2:13895407-13895429 CGGCTCAAGCTGCTGCAGCATGG - Intergenic
927847366 2:26478504-26478526 CTCCCCAGCCTGGGGAAGCAGGG - Intronic
929464615 2:42133433-42133455 CTCCTCAGCCAACACCAGCAAGG + Intergenic
930019058 2:46990101-46990123 CTCTTCAGCCTGCTGCTGTTGGG + Intronic
932629539 2:73327441-73327463 CACCTCAGCCTCCTGTAGCTGGG + Intergenic
932706841 2:74032524-74032546 CTCCTCAGCCAGACCCAGCAAGG - Intronic
932732060 2:74228256-74228278 CTGCTCAGCCTGCAGGGGCATGG + Intronic
934518878 2:95007005-95007027 CCCTCCAGCCTGCTGCAGCCAGG + Intergenic
937453717 2:122023623-122023645 AACCACAGCCTGCTGGAGCAGGG - Intergenic
937459616 2:122074625-122074647 CTGCTTAGCCTGCTGCTGCTAGG - Intergenic
938342357 2:130544158-130544180 CTCCCCAGCCTGCTGGCCCAGGG + Intronic
938347475 2:130576551-130576573 CTCCCCAGCCTGCTGGCCCAGGG - Intronic
940905106 2:159162035-159162057 CTCCTCCTGCTGCTGCAGCCTGG - Intronic
941873697 2:170411817-170411839 CTCCACAGCCAGATGCAGCCAGG - Intronic
945253246 2:207782376-207782398 CACTTTGGCCTGCTGCAGCAGGG - Intergenic
946133164 2:217623188-217623210 TTCCCCAGCCTTCTGCATCAGGG + Intronic
946253867 2:218429693-218429715 CCCCTCAGCCTACTGCAGCCTGG + Intronic
946285428 2:218699001-218699023 CTGCTCAGCCTTCTGCTGCTTGG + Exonic
946929080 2:224655209-224655231 CCCTTCAGCCCGCTGCTGCATGG + Intergenic
947201715 2:227620236-227620258 ATCCACAGCCTGGGGCAGCAAGG - Intronic
947389228 2:229622500-229622522 CCCCTCAGCCTGAGTCAGCACGG + Intronic
947603390 2:231468276-231468298 CCCCTGAGCCTGCTGGAGGAGGG + Intronic
947707224 2:232286048-232286070 CACCCCAGCCTGTTGGAGCATGG - Intronic
948564878 2:238878438-238878460 CTCCTCATCCTAGTGCAGCATGG + Intronic
948601228 2:239108461-239108483 CTCCTCAGCCTGCTGCAGCAGGG - Intronic
948699720 2:239751994-239752016 CTCCACAGCCTGCTCCTGCTGGG - Intergenic
1169200158 20:3705403-3705425 CTCCCCAGCATCCTCCAGCACGG + Intronic
1169815273 20:9650039-9650061 CTACACAGCATGCTGCACCATGG - Intronic
1170657842 20:18306321-18306343 CTCATCACCCAGCTGGAGCAAGG + Exonic
1171159517 20:22908736-22908758 CTCCTCACCCTTCTGGAGAAGGG + Intergenic
1171486514 20:25490007-25490029 CTCATCAGGCTCCTGCAGGACGG + Intronic
1172152599 20:32800981-32801003 CTTCTCAGGCTGCTGCACCTGGG - Intronic
1172208653 20:33182134-33182156 TGCCACAGCCTGGTGCAGCATGG - Intergenic
1172783311 20:37450142-37450164 CTCCACACGATGCTGCAGCAGGG - Intergenic
1172834440 20:37863970-37863992 CTCCACACCCTGCTGCAGACTGG - Intronic
1172863486 20:38076581-38076603 CTTCTCAGCCTGTTGCAGCTTGG + Intronic
1173750094 20:45469821-45469843 CTCCTCAGCCTGCTGCTGTTCGG + Exonic
1173981909 20:47230970-47230992 TTCCGCTGCCTGCTGCAGCACGG - Intronic
1174619334 20:51862285-51862307 CTTCTGAGGCTGGTGCAGCAGGG + Intergenic
1175857436 20:62129821-62129843 CTGCACAGCCTGCTCCACCATGG - Exonic
1176305678 21:5121884-5121906 ACCCTCAGTCAGCTGCAGCAAGG + Intronic
1176408814 21:6436743-6436765 AGCCTGAGACTGCTGCAGCAGGG + Intergenic
1177809435 21:25909622-25909644 CTCCTAAGGCTGATGCAACAAGG + Intronic
1179174990 21:39001636-39001658 CTACTCCGGATGCTGCAGCAGGG + Intergenic
1179684307 21:43045065-43045087 AGCCTGAGACTGCTGCAGCAGGG + Intergenic
1179727131 21:43346890-43346912 CTCCTCAGCCTGCTGCAGGCAGG - Intergenic
1179791177 21:43756900-43756922 GTGCTCAGCCTGCTGCACCACGG - Exonic
1179851379 21:44140147-44140169 ACCCTCAGTCAGCTGCAGCAAGG - Intronic
1180222285 21:46366637-46366659 CTCCTGGGCCTCCTGCAGGAAGG - Exonic
1180557873 22:16592188-16592210 CTGCTCTGCCTGTTCCAGCAAGG + Exonic
1180744128 22:18075522-18075544 TTGCTCAGCCTGCTGTAGCAGGG - Intergenic
1181964605 22:26647731-26647753 ATCTTCAGGCTGCTGCAGCAAGG + Intergenic
1182048899 22:27298513-27298535 CTCCTCGGCTGGCTGCAGAAGGG + Intergenic
1182439811 22:30356693-30356715 CCCCTCAGCCTGCAGCCGGAGGG - Exonic
1182510110 22:30813591-30813613 ATCCTCACCCAGCTGCTGCAGGG + Intronic
1182606735 22:31511603-31511625 CTCCCCAGCCTAAAGCAGCAGGG - Intronic
1183389554 22:37537655-37537677 CTCCTCAGGAGGCTGCGGCAGGG - Intergenic
1183745530 22:39689499-39689521 CTCCTCAGTAGGCTGCAGCTTGG - Exonic
1183754461 22:39747235-39747257 CTCCTCAGCCTCCCGAAGCTGGG + Intronic
1183927626 22:41217255-41217277 CTCCTCCACCTGCTTCACCAGGG + Intronic
1183936203 22:41263838-41263860 CTCCTCAGCCTGGGGCTCCATGG + Intronic
1184797228 22:46739235-46739257 CACCTCTGCCTGCAGCAGCAGGG - Intergenic
1184898815 22:47430930-47430952 CAGCTCCGCCTGCTGCAACATGG + Intergenic
949890249 3:8728414-8728436 CCCCAGAGCCTGCTCCAGCATGG + Intronic
949894893 3:8761661-8761683 CTCCTCACCCTAATGCAGCAAGG - Intronic
950638436 3:14332606-14332628 CTCCTCTCCCTGCTGCACTAGGG + Intergenic
951411586 3:22372780-22372802 CTCCCCAGCCTGGTGCACCTGGG - Intronic
951898413 3:27633022-27633044 CTCGTCCGCCTGCTGCTGCAGGG - Intergenic
952695568 3:36261626-36261648 CTCTTCTGCCTTCTGCATCAGGG - Intergenic
952846844 3:37695035-37695057 GGCCTCAGCCTGATGCTGCAAGG + Intronic
953356845 3:42263517-42263539 CTCCTCTGCCCGCTGCAGCCCGG + Exonic
956118450 3:65941903-65941925 CACCTCAGCCTCCTGAAGCTGGG + Intronic
958151033 3:89695670-89695692 CTCCCCAGCCCCCTGCAGCTTGG + Intergenic
958165785 3:89876742-89876764 AGACTCAGACTGCTGCAGCATGG - Intergenic
958498487 3:94875218-94875240 CTTCTGAGCCTGCTGGGGCAGGG + Intergenic
959050597 3:101521202-101521224 ATTCTGAGCCTGCTGTAGCAAGG + Intergenic
960108172 3:113820068-113820090 CTCCTCAGCCTGGTCCCACAGGG - Intergenic
960359816 3:116697779-116697801 CTCATCAGCCTTCTGGAGCCTGG + Intronic
961142793 3:124569315-124569337 CTCCACCACCTTCTGCAGCATGG - Intronic
962280668 3:134049465-134049487 CTGCTCAGCCTGCTGCAAACTGG + Intronic
962289634 3:134123233-134123255 GTCCTCAGCCTCCTGCAGCAGGG + Intronic
962525441 3:136233940-136233962 CTACTCAGGAGGCTGCAGCAGGG - Intergenic
963226002 3:142862156-142862178 CTCCTCCACCTCCAGCAGCAAGG - Intronic
965449576 3:168820853-168820875 ATATTCATCCTGCTGCAGCATGG - Intergenic
965859750 3:173134274-173134296 CTCCCCACACTGCTGCATCAAGG - Intronic
966205433 3:177401137-177401159 ACGCTCAGCCTGTTGCAGCATGG + Intergenic
966294001 3:178396412-178396434 CTTCTCTTCATGCTGCAGCATGG + Intergenic
966886520 3:184380355-184380377 CTCCTCGGGCTGCTGCTGCTCGG + Exonic
967007810 3:185400996-185401018 CTCTTCTGCCTCTTGCAGCAAGG - Intronic
967072064 3:185971071-185971093 CTCCTCAGCCTGCTCCCAAAGGG - Intergenic
967269645 3:187722451-187722473 CCCCAAAGCCTGCTGAAGCATGG - Exonic
967853875 3:194101915-194101937 CTCCGCAGCCTGGAGAAGCAAGG + Intergenic
968448076 4:662455-662477 CTCCCCACCCTGCTGGAGCCAGG + Intronic
969042991 4:4315524-4315546 CTCCTGACACTGCTGCAGAAAGG - Intronic
969419597 4:7084485-7084507 CTCTTCAGAGTGCTGCAGGAAGG + Intergenic
969450812 4:7271939-7271961 GTCCTCAGCCAGGGGCAGCAGGG + Intronic
969475594 4:7420920-7420942 CTCCTCTGCCTGCCGTTGCAGGG + Intronic
969541013 4:7788895-7788917 GCACTCACCCTGCTGCAGCAGGG + Intronic
969930629 4:10627654-10627676 CTCCTCCTTCTGCTGCTGCAGGG + Intronic
970136687 4:12932899-12932921 TTCCTCACCCTCCTGCAGCCTGG + Intergenic
970240163 4:14001049-14001071 CACCTCATCCTGCTACAGCTGGG + Intergenic
972339301 4:38137241-38137263 CTCCTCCACCGTCTGCAGCAGGG - Exonic
972379717 4:38508106-38508128 CGTCTCAGCCTGCTGCAGACAGG - Intergenic
972877397 4:43380274-43380296 CTCCTCAGCTTGCTGCAATCTGG + Intergenic
973717716 4:53693708-53693730 CTTCTCAGCCTGCAGAACCAAGG - Intronic
973861890 4:55073729-55073751 TTCCTCAGCCTTCTGTAACAGGG + Intergenic
974207911 4:58730578-58730600 TACCTCAGCCTGCTGCCTCATGG + Intergenic
975169504 4:71216670-71216692 CTCCTCAGCATGGAGCAGGAGGG - Intronic
976070518 4:81234924-81234946 CTGCTCAGTTTGCTGCAGAATGG - Intergenic
977294233 4:95193374-95193396 CTCCTGTGCCGGCTCCAGCACGG - Intronic
977339201 4:95736148-95736170 CTCCTCATGCAGATGCAGCAAGG + Intergenic
978368001 4:108002678-108002700 CTCCAGAGCATGCAGCAGCAAGG + Intronic
979511833 4:121563122-121563144 CTACTCAGGATGCTGAAGCAGGG - Intergenic
981516828 4:145619186-145619208 TTCCGCAGCCTGCTGCAGGCCGG + Exonic
981763853 4:148224951-148224973 TTCCTCTTTCTGCTGCAGCAAGG + Intronic
982678536 4:158403206-158403228 CTGCTCAACCTGCTGCCCCATGG - Intronic
983265375 4:165502291-165502313 CACCTCAGCCTCCTGTAGCTAGG + Intergenic
983612224 4:169660268-169660290 CTCCCTTGCTTGCTGCAGCAGGG + Intronic
984818705 4:183861315-183861337 GTCCTCACCCTGCTGCAGTGGGG + Intronic
985916315 5:2921454-2921476 CTCCCCAGCCTGCAGCCGCTGGG - Intergenic
986548234 5:8923580-8923602 CTCCTCACCCTGCTGAGGGATGG - Intergenic
986578116 5:9233754-9233776 TTCCTCAGCTTGCTGCAGAGTGG - Intronic
986835421 5:11631740-11631762 AGTCTCAGCATGCTGCAGCAGGG - Intronic
986980608 5:13444090-13444112 CTGCAAAGCCTGCTGTAGCAGGG - Intergenic
989126543 5:38058566-38058588 CTCCTCAGCCTCCCAAAGCATGG - Intergenic
990873576 5:60460398-60460420 CTCTTCATCCTCCTCCAGCAGGG + Intronic
992784530 5:80156896-80156918 CTTCTTAGCCTGCTGCATAATGG - Intronic
992810972 5:80388191-80388213 CACCTCAGCCTCCTGTAGCTAGG - Intergenic
993549565 5:89256910-89256932 TTCCTCAGCCTTCTGAAGAAAGG - Intergenic
996543959 5:124658164-124658186 CCCCTGAGCTTGCTTCAGCAAGG + Intronic
998188384 5:140000706-140000728 CACCTCCTCCTGCTGCAGCCAGG + Intronic
998200631 5:140115110-140115132 TTCCTCACCCTGCAGTAGCAGGG - Exonic
998414251 5:141934361-141934383 GTCTGCAGCCTGCTTCAGCAAGG - Exonic
998702776 5:144723356-144723378 CTCCTCAGTGTGCTACAGGACGG + Intergenic
999769761 5:154766583-154766605 CCACCCAGCCAGCTGCAGCAGGG - Intronic
1001819938 5:174702567-174702589 CACCTCAGCCTCCTGTAGCTGGG + Intergenic
1002155318 5:177273672-177273694 CTCTTCAGGAAGCTGCAGCAAGG + Exonic
1002601997 5:180359103-180359125 GGCCTCTGCCTGCTCCAGCAGGG - Intergenic
1002643093 5:180639937-180639959 CTCCCAAGCCTGCAGCAGCGTGG + Intronic
1002813372 6:656445-656467 CTCCTCAGCGTCCTCCAGCGCGG + Exonic
1003264348 6:4552362-4552384 CTCCTCAGCCTACTCCAGCTTGG + Intergenic
1003342973 6:5239674-5239696 CTCCTCACTCTGCTGCAGTCTGG - Intronic
1003400978 6:5790537-5790559 CACCTCTGCCTCCTGGAGCAAGG - Intergenic
1004420516 6:15465335-15465357 CACCTCAGCCTCCTGTAGCTGGG - Intronic
1005952492 6:30642164-30642186 CTCCACTGCCAGCTCCAGCAAGG + Exonic
1006027206 6:31154751-31154773 CACCTCAGCCTGCTGGCTCAGGG + Exonic
1006418210 6:33917814-33917836 CTCCTCAGCCTGCCTATGCAAGG - Intergenic
1006610456 6:35291492-35291514 ATCCCCAGCTTGCTCCAGCATGG + Intronic
1006774111 6:36578497-36578519 CTCCTCTGCCTGCTAATGCAGGG - Intergenic
1007380440 6:41487097-41487119 CTCCTGAGCTGGCTGAAGCAGGG + Intergenic
1013122355 6:107151903-107151925 CCTCTCAGCCTGCTGCTGCCTGG - Intergenic
1014853853 6:126375238-126375260 TTCTTCAGCATGCTACAGCAAGG - Intergenic
1015583278 6:134749733-134749755 CTCCTCAGCCTTCAGCATGAAGG - Intergenic
1015838120 6:137444375-137444397 CTCCACAGCCTGGAGCAGCTGGG - Intergenic
1015905679 6:138114293-138114315 CTCATTAACTTGCTGCAGCAAGG + Intergenic
1018344635 6:162888035-162888057 CTCCTGAGGCTGCTGCAACAAGG - Intronic
1018967240 6:168498592-168498614 CCACTCAGCCTGCAGCAGGAAGG - Intronic
1018988893 6:168658533-168658555 CTCCTCAGCCTGGTGCTACAGGG + Intronic
1019047809 6:169161872-169161894 CTCCTCAACCTGCACCAGCTCGG + Intergenic
1019207271 6:170372714-170372736 CTCCTCAGCCTCCTTTAGCAGGG - Intronic
1019525257 7:1477791-1477813 CTCCTCCTCCTGCAGCAGCAGGG + Exonic
1019576795 7:1741463-1741485 CTCCCCAGCCTGATGGAGGAGGG + Intronic
1020975892 7:15006039-15006061 TTACTGAGCTTGCTGCAGCAAGG - Intergenic
1022505284 7:30905759-30905781 CTCCTCCTCAGGCTGCAGCAAGG - Intergenic
1022530543 7:31064212-31064234 CTCCTTAGCCTGCAGCTGCCGGG + Intronic
1023169140 7:37373811-37373833 CTCCTTTGCCTGCTGCCTCAGGG + Intronic
1023484077 7:40665690-40665712 CTCCTCAACCTGCTGCAAAATGG - Intronic
1024186105 7:46949567-46949589 GTTCTCATCCTGCTGCAGAAAGG - Intergenic
1024334748 7:48195929-48195951 CTCTTCAGGCTGCTGCAGCCTGG - Intronic
1024334964 7:48197494-48197516 CTCTTCAGGCTGCTGCAGCCGGG - Intronic
1025208883 7:57009522-57009544 CCCTCCAGCCTGCTGCTGCATGG + Intergenic
1025663068 7:63567334-63567356 CCCTCCAGCCTGCTGCTGCATGG - Intergenic
1025970029 7:66314397-66314419 CACCTCAGCCTCCTGCAGCTGGG - Intronic
1026150011 7:67779971-67779993 CACCTCAGCCTCCTGTAGCTGGG - Intergenic
1029364826 7:100110029-100110051 CTCCCCTTCCTGCTGCAGCCGGG + Exonic
1030068264 7:105677051-105677073 CTGCTCTGCCTCCTGCAGCCAGG - Intronic
1030683042 7:112452274-112452296 CTCCTCAGCCTCCTGTAGCTAGG + Intronic
1031018394 7:116600094-116600116 CTCCTCACCCAGCTGTAGCGGGG + Intergenic
1031253514 7:119417889-119417911 CTCCTCAGCATGAAGCAGCCAGG + Intergenic
1032319587 7:130874045-130874067 TTCCTCTGCCTTCTGCATCAAGG - Intergenic
1033652924 7:143355691-143355713 CTCCTCAGGCTCCCGGAGCAGGG + Exonic
1034574499 7:151985540-151985562 CTCCTCAGCTTGGGGGAGCAGGG + Intronic
1034619444 7:152445817-152445839 CTGCTCTGCCTGTTCCAGCAAGG - Intergenic
1034987618 7:155526779-155526801 CTTCTCTGCAGGCTGCAGCATGG - Intronic
1035098928 7:156380769-156380791 ATCCTTAGCCTTCTGCTGCACGG - Intergenic
1035904983 8:3499873-3499895 GGCCTCAGGCTGCTGCAGCATGG - Intronic
1036210307 8:6835443-6835465 CTGCTCGGCCGCCTGCAGCAGGG + Exonic
1038581600 8:28753170-28753192 CTCCTCAGCGAGAGGCAGCAAGG + Exonic
1039918149 8:41874963-41874985 CTCCTGAGGGTGCTGCAGCGGGG - Intronic
1040622305 8:49103467-49103489 CCCTTCAGCCTGCTGCTGCACGG - Intergenic
1042117483 8:65447902-65447924 TTCCTTAGCTTGCAGCAGCAGGG - Intergenic
1042251906 8:66764582-66764604 CACCTCAGCCTCCTGTAGCTGGG + Intronic
1042465873 8:69129636-69129658 CTCGTCCGCCTGCTACTGCAGGG - Intergenic
1042709425 8:71699846-71699868 ATCCTGAGGCTGCTGCAGCTGGG + Intergenic
1044360889 8:91282370-91282392 CTCATCAGCCTGCTGTTGCCTGG - Intronic
1047298662 8:123593683-123593705 CTCATCATCCTGCTCCAGCCAGG - Intergenic
1047971188 8:130086019-130086041 CTCCTTATCCATCTGCAGCATGG - Intronic
1048451620 8:134538405-134538427 CTCCTCAACTTGCTGAAGCCTGG - Intronic
1048861592 8:138727919-138727941 CTCCACAGACTGCTCCAGCTTGG + Intronic
1049247355 8:141569873-141569895 AGCCTCAGCCTCCTGCAGGATGG - Intergenic
1049510861 8:143026016-143026038 ACCCTCAGCCAGCAGCAGCATGG + Intergenic
1049754533 8:144303956-144303978 GTCCTCAGCCTGCTGTGGCGGGG + Intronic
1050140615 9:2512459-2512481 ATCATTCGCCTGCTGCAGCATGG + Intergenic
1053161375 9:35815463-35815485 CTCCGCCACCTGCTGCAGAAAGG + Intronic
1056122576 9:83504020-83504042 CTCCGCATCCTGCTGCAGTTTGG + Intronic
1056357744 9:85819873-85819895 CGCCTCAGCCTCCAGCAGCTGGG - Intergenic
1057134303 9:92676415-92676437 ATCCTGAGGCTGCTGCATCAGGG - Intergenic
1057185482 9:93055282-93055304 CTCCCCTGCCTCCTCCAGCAGGG + Intergenic
1057411266 9:94818250-94818272 TTCCTAAGCCTACTGAAGCAAGG - Intronic
1057616625 9:96596743-96596765 CACCTCAGCCTCCTGTAGCTGGG - Intronic
1058697982 9:107576004-107576026 CTTCTCAGCCCACTGGAGCAAGG - Intergenic
1058843498 9:108933764-108933786 CTCCTCTGCCTGCTGCGGGCCGG - Intronic
1060059479 9:120446335-120446357 CTCCTCAGTAGGCTGAAGCAGGG - Intronic
1061014522 9:127974182-127974204 CTCCTCTGCCTGCTACCGCCAGG + Intronic
1061242240 9:129381505-129381527 TTCTCCAGCCTGCTGCAGCCAGG + Intergenic
1061925816 9:133805604-133805626 CTCCCCAGCCTCCGGCAGCCTGG + Intronic
1062453332 9:136624624-136624646 CTCCTCAGCCCCCTGGAGCTGGG + Intergenic
1062467380 9:136687200-136687222 CTCGTCTGCCTGCTGCGCCACGG - Exonic
1062488087 9:136791146-136791168 CCCCTCCGCCTGCTGCCGCGCGG + Intergenic
1062554338 9:137107186-137107208 GCCCTCAGCCTGCAGCTGCACGG - Intronic
1186099816 X:6144197-6144219 CTCCTTAGCATGCTTGAGCAAGG + Intronic
1186286056 X:8045284-8045306 CTCTTCAGACGCCTGCAGCATGG - Intergenic
1187706322 X:22013146-22013168 CTCCTCAGCCATCTGCAGGTTGG + Intergenic
1187929553 X:24281321-24281343 CTCCTCAACCTACAGCAGCGGGG - Intergenic
1188224059 X:27575134-27575156 CTCCTCTGACTGCTCCAGCCAGG + Intergenic
1188727862 X:33607368-33607390 CTCCTGAGCCTGCAGGGGCAGGG + Intergenic
1189264122 X:39700513-39700535 CTCCTTAGCCTGCTGCATGCAGG + Intergenic
1189533207 X:41908262-41908284 CTACTCAGGATGCTGAAGCAGGG + Intronic
1190062226 X:47218936-47218958 CTCCTCAGCCGGCGGCGGCCCGG + Intronic
1190689468 X:52901385-52901407 CGCCTCAGCCTCCCGAAGCAGGG + Intronic
1190696515 X:52954407-52954429 CGCCTCAGCCTCCCGAAGCAGGG - Intronic
1192470829 X:71397245-71397267 CTGCTGAGCCTGCTGCTGCAAGG - Exonic
1192554429 X:72078602-72078624 CTCCTTAACCTGCTGCAGTCTGG + Intergenic
1193417380 X:81241026-81241048 CTTCTGAGCCTGCAGAAGCAGGG - Intronic
1193630860 X:83886544-83886566 CTCCTCAGCCTGAAGCACCGTGG + Exonic
1194391880 X:93329114-93329136 CTACCCAGACTTCTGCAGCATGG - Intergenic
1195618858 X:106933601-106933623 CTCCTCAGCTGGCTGAAGCCTGG + Intronic
1195738011 X:108033426-108033448 CTCCTCATGCTGCTGCACCCAGG + Intergenic
1196857693 X:119999573-119999595 CTCCTCAGGCTGCTGCTGCCAGG + Intergenic
1196859588 X:120014921-120014943 CTCCTCAGGCTGCTGCTGCCAGG + Intergenic
1199312646 X:146339387-146339409 CTCCTCAGCTTGCTGCATTTGGG + Intergenic
1199867017 X:151860946-151860968 CTCCTTAGCATGCTGATGCAGGG + Intergenic
1200232561 X:154451300-154451322 TTCCTCAGCCTCCTGGAGCCAGG - Intergenic
1201018512 Y:9627654-9627676 CTCCTCAGCAGGCTGAGGCAGGG - Intergenic
1202576908 Y:26337439-26337461 CTCCCCAGTGTGCAGCAGCATGG + Intergenic