ID: 948601746

View in Genome Browser
Species Human (GRCh38)
Location 2:239111463-239111485
Sequence GCCACAGTGGGCACAGCGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 285}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948601746_948601751 -5 Left 948601746 2:239111463-239111485 CCCCGCGCTGTGCCCACTGTGGC 0: 1
1: 0
2: 1
3: 21
4: 285
Right 948601751 2:239111481-239111503 GTGGCCCGCGTTGCACCCTCAGG 0: 1
1: 0
2: 0
3: 3
4: 56
948601746_948601754 6 Left 948601746 2:239111463-239111485 CCCCGCGCTGTGCCCACTGTGGC 0: 1
1: 0
2: 1
3: 21
4: 285
Right 948601754 2:239111492-239111514 TGCACCCTCAGGCTGCACAAAGG 0: 1
1: 0
2: 0
3: 9
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948601746 Original CRISPR GCCACAGTGGGCACAGCGCG GGG (reversed) Intronic
900251221 1:1671037-1671059 CCCACAGCGAGGACAGCGCGTGG - Intronic
901015285 1:6225840-6225862 GGCAAAGTGGGCACAGCGTGGGG - Intronic
902450355 1:16492832-16492854 GCCAAAGTGGGCAGATCACGAGG + Intergenic
903204924 1:21774452-21774474 GCCAAGGTGGGCAGATCGCGAGG + Intronic
905986388 1:42287104-42287126 GCCAAAGTGGGCAGATCACGAGG + Intronic
907431438 1:54414412-54414434 GCCCCCGTGGGCACAGTGCAGGG + Intergenic
908522252 1:64955779-64955801 GCAGCAGTGGGGACAGCGAGTGG + Intronic
910312089 1:85835362-85835384 GCCACCGTGGGCAGATCACGAGG - Intronic
910882455 1:91934472-91934494 GCCAAGGTGGGCAGATCGCGAGG - Intergenic
912385296 1:109268453-109268475 GCAACAGTGAGCACAGAGGGAGG + Intronic
912790263 1:112642447-112642469 GCCAAAGTGGGCAGATCACGAGG - Intronic
913157916 1:116118147-116118169 GCCAAGGTGGGCACAGCAAGAGG + Intronic
914060212 1:144202623-144202645 GTCACAGTGGGCACAGTCCTGGG + Intergenic
914118938 1:144763746-144763768 GTCACAGTGGGCACAGTCCTGGG - Intergenic
914728079 1:150345581-150345603 GCCAAAGTGGGCAGATCACGAGG - Intronic
915912702 1:159924522-159924544 GCCCCAGGAGGCACAGGGCGCGG + Intronic
922467315 1:225853192-225853214 GCCATGGTGGGCACTGTGCGAGG - Intronic
924666015 1:246072376-246072398 GCCACAGTGAGCACAGTGGAAGG - Intronic
1062842557 10:682209-682231 GCCCCAGTGTGCCCAGCGCAGGG - Intronic
1063160755 10:3416403-3416425 GCCACAGTGGGAACAGGACCTGG + Intergenic
1066398416 10:35050086-35050108 GCCAAGGTGGGCACATCACGAGG + Intronic
1066559550 10:36654295-36654317 GCCACAGTGGGCAGATCACAAGG - Intergenic
1067604512 10:47649639-47649661 GCCACGGTGGGCAGATCACGAGG - Intergenic
1067837588 10:49651106-49651128 GCCCGAGTGGGCACAGCTTGGGG + Intronic
1069537457 10:69265520-69265542 GTCACACTGGGCACATCCCGGGG + Intronic
1069905576 10:71730393-71730415 GCCACAGTGGGCCAAGCCCTGGG + Intronic
1071620069 10:87111074-87111096 GCCACAGTGGGCAGATCACGAGG - Intronic
1072486474 10:95861120-95861142 GCCACAATGTGCCCAGCTCGAGG - Intronic
1072856341 10:98951509-98951531 GCCACATTGTGCACAGGGCCAGG + Intronic
1073072152 10:100801506-100801528 GCCACAGTGGACAGAGCACCTGG + Intronic
1073475246 10:103748378-103748400 GCCACAGGTTGCACAGCCCGGGG - Intronic
1074798905 10:116979037-116979059 GCCACAGTGGGTGCAGCTCTGGG - Intronic
1075380464 10:122014627-122014649 GCCACAGTGGGCAGAGCAGGTGG - Intronic
1075810122 10:125219017-125219039 GCCACAGGGGCCACAGCTCCAGG - Intergenic
1075890254 10:125943044-125943066 GCCGCAGTGGGCAGATCACGAGG - Intronic
1076769905 10:132657196-132657218 GGCAGAGTGGCCACAGCACGTGG + Intronic
1076872370 10:133200303-133200325 GCCACAGTCTCCACAGGGCGGGG - Intronic
1077147628 11:1053051-1053073 GCCACAGAGGGCACAGGCCGGGG + Intergenic
1077561280 11:3263298-3263320 GCCACAGTGGGAACAGGACCTGG - Intergenic
1077567176 11:3309127-3309149 GCCACAGTGGGAACAGGACCTGG - Intergenic
1079095971 11:17510332-17510354 CCCACTGTGGGGACAGCGGGAGG - Intronic
1084539306 11:69776224-69776246 GCCATAATGGGCACAGTGGGAGG - Intergenic
1084601307 11:70147421-70147443 GCCACAGGGGGCCCAGCAGGAGG - Intronic
1088224353 11:107603302-107603324 GCCAAGGTGGGCACATCGCTTGG + Intronic
1088667178 11:112104863-112104885 GCCAAAGTGGGCAGATCACGAGG + Intronic
1088739002 11:112751533-112751555 GCTACAGTGGGCCCTGCGGGAGG + Intergenic
1089332495 11:117699676-117699698 GCCACTGTGGGTACTGGGCGGGG - Intronic
1089744210 11:120605732-120605754 GCCACGCTGGGCACAGAGCGTGG + Intronic
1091422504 12:354531-354553 GCCACAGTGGGCAGATCACGAGG + Intronic
1091671869 12:2457666-2457688 GCCGCAGGGGGCGCAGCACGCGG - Exonic
1093059649 12:14589367-14589389 ATCACAGTGGGCACAGGGAGTGG + Intergenic
1096243792 12:49973465-49973487 GCCACATAGGCCACAGCACGGGG - Exonic
1096732499 12:53625921-53625943 GCCCCGGGGGGCACAGGGCGTGG - Intronic
1098021171 12:66157990-66158012 GCCAAGGTGGGCACATCACGAGG + Intronic
1098442630 12:70534497-70534519 ACCACAGTGGGCCCAGCACCCGG + Exonic
1098667390 12:73180801-73180823 GCCACAGGGAGCACAGCTCATGG - Intergenic
1100257851 12:92902506-92902528 GCCAAAGTGGGCATAACACGAGG + Intronic
1103976448 12:124705732-124705754 GCCAGAGTCAGCACAGGGCGGGG - Intergenic
1104418993 12:128619659-128619681 GGCACAGTGGGGACAGCGCAGGG - Intronic
1105273486 13:18900173-18900195 ACCACAGTGGACACAGCGTCAGG + Intergenic
1105557886 13:21463215-21463237 GCCACAGTGGGCAGATCACCAGG + Intergenic
1105927083 13:25018300-25018322 GCTGCAGAGGGCCCAGCGCGGGG - Intergenic
1106840409 13:33680529-33680551 GCCAAAGTGGGCAGATCACGAGG + Intergenic
1107936431 13:45349148-45349170 GCCAAAGTGGGCAGATCACGAGG - Intergenic
1108229186 13:48319303-48319325 GCCCCAGAGGGCCCAGCGCCGGG - Intronic
1108260614 13:48651936-48651958 GCCAAAGTGGGCAGATCACGAGG - Intergenic
1108431144 13:50355037-50355059 ACCACAGTAGGCACAGGGCCAGG - Intronic
1109498091 13:63201131-63201153 GCCAAAGTGGGCAGATCACGAGG - Intergenic
1112064556 13:95779356-95779378 GCCGCAGTGGGCAGATCACGAGG - Intronic
1112302998 13:98247349-98247371 GCCAAAGTGGGCCCAGCCAGGGG - Intronic
1113655126 13:112063132-112063154 GCGACGGTGGGGACCGCGCGGGG - Intergenic
1113737866 13:112690650-112690672 GTCTAGGTGGGCACAGCGCGGGG + Intronic
1114716302 14:24829052-24829074 GGCACAGGGGGCACAGGGCCTGG - Intronic
1115022466 14:28699272-28699294 GCCGAAGTGGGCAGAGCACGAGG + Intergenic
1116019167 14:39440914-39440936 TCCACAGAGGGCACAGCCCCAGG - Intergenic
1118773875 14:68961539-68961561 GCCACACGGGGCACAGGGCGCGG + Intronic
1119418595 14:74493114-74493136 GCCCCAGGGGTCTCAGCGCGGGG + Intronic
1120051360 14:79870615-79870637 GCCAAAGTGGGCAGATCGCAAGG - Intergenic
1120918029 14:89727335-89727357 GCCACAGTGGCCACAGCCCAGGG - Intergenic
1122151087 14:99726664-99726686 GCCGCAGGGTGCACAGCACGGGG - Exonic
1122786148 14:104164145-104164167 GCCGCAGTGGGGGCAGCGAGAGG + Intronic
1123701665 15:22918658-22918680 GGCACAGCGGGCACAGGGCGTGG + Intronic
1124086514 15:26555450-26555472 ACAACAGTGGCCACAGCGCTGGG - Intronic
1128082152 15:64863168-64863190 GCCAAAGTGGGCAGATCACGAGG - Intronic
1129228034 15:74181139-74181161 GCCACAGGAGGCACAGCGCAGGG + Intronic
1130137991 15:81197580-81197602 TCCAAAGTGGGCACAGCGGGTGG + Intronic
1132286649 15:100668445-100668467 GCCACAGGGGGCTCAGGGCCAGG - Intergenic
1132457908 16:34212-34234 CCCACAGTGGGCCCAGCACAGGG - Intergenic
1132660127 16:1057624-1057646 GGCACAGTGGGCCCTGCGTGAGG - Intergenic
1132672182 16:1106459-1106481 GCCACAGGGGGCATCGCGCCTGG - Intergenic
1132672486 16:1107557-1107579 CACACAGTGGACACAGCGGGCGG - Intergenic
1136194096 16:28639685-28639707 GCCACGGTGGGCAGATCACGAGG - Intronic
1136628413 16:31475786-31475808 GGCACAGCAGGCACAGCGCCTGG - Intronic
1136664188 16:31793836-31793858 CCCACACCGGGCACAGCGAGCGG + Intronic
1138376651 16:56568859-56568881 GGCACATTTGGCACAGCCCGGGG - Exonic
1138448214 16:57077864-57077886 CCCGCAGTGGGCACAGGGCAGGG + Intronic
1138827113 16:60333881-60333903 GCCAAAGTGGGCAGATCACGAGG - Intergenic
1139824060 16:69743129-69743151 GCCACACATGGCACAACGCGAGG + Intronic
1139857858 16:69994872-69994894 GCCGCAGTGGGCAGATCACGAGG + Intergenic
1140531247 16:75668459-75668481 GCCACAGTGGGCGAATCACGAGG - Intronic
1140540615 16:75753407-75753429 GCCCCAGTGGGCACAGGGGAAGG - Intronic
1141721500 16:85758485-85758507 GCCAAAGTGGGCAGATCACGAGG + Intergenic
1141903557 16:87008143-87008165 GCCCCTGTGGGCACAGCGGTGGG + Intergenic
1142212742 16:88816223-88816245 GAGACAGTGGGCACAGGGCAGGG - Intronic
1142635204 17:1252886-1252908 GCCAAAGTGGGCAGATCACGAGG - Intergenic
1142635532 17:1254913-1254935 GCCAAAGTGGGCAGATCACGAGG - Intergenic
1144782731 17:17816051-17816073 GTCACAGTGGACACAGCCTGGGG + Intronic
1149802519 17:59583644-59583666 GCCACAGTGGGCGGATTGCGAGG + Intronic
1149843972 17:59991848-59991870 GCCACAGTGGGCGGATTGCGAGG - Intergenic
1150046052 17:61914463-61914485 GCCACAGAGGGCGCATCACGAGG + Intronic
1151657062 17:75501055-75501077 GTCACAGTGGGCACTGCTGGAGG + Exonic
1152668322 17:81585427-81585449 GCCAAAGTGGGCAGATCACGAGG + Intronic
1152679431 17:81658316-81658338 GCCAAAGTGGGCAGATCACGAGG - Intronic
1157054153 18:44205349-44205371 GCCAAAGTGGGCAGATCACGAGG - Intergenic
1160383641 18:78479715-78479737 GGCACAGTGGGCAGAGGGCACGG - Intergenic
1160934061 19:1584888-1584910 GCCACAGGGTGCAGAGCGCAAGG - Intronic
1161138134 19:2632884-2632906 GCCACAGTGGGCTCTGCACTGGG + Intronic
1162362897 19:10230451-10230473 GGGACTGTGGGCTCAGCGCGTGG + Intronic
1162519592 19:11171906-11171928 GCCAAAGTGGGCAGATCACGAGG - Intronic
1163024221 19:14500691-14500713 GCCAAAGTGGGCAGATCACGAGG - Intergenic
1163368165 19:16887852-16887874 GCCCCAGTGTGCTCAGCGCTGGG - Intergenic
1163460424 19:17434132-17434154 GCCACGGTGGGCAGATCACGAGG - Intergenic
1164746342 19:30617582-30617604 GCCACAGTGGGCAGATCACGAGG - Intronic
1165255518 19:34575472-34575494 CCCACAGTGGGCACAGCGTTAGG - Intergenic
1165280423 19:34792627-34792649 GCCAAAGTGGGCAGATCACGAGG + Intergenic
1165383239 19:35495518-35495540 GCCACAGGGGGGAGAGCGCGGGG - Intronic
1165441930 19:35833392-35833414 TCCACAGTGGGCACATGGCCCGG + Intronic
1165486086 19:36097058-36097080 GCCACTGTGGGCAAAGCGGCTGG + Exonic
1165678017 19:37745014-37745036 GCCAAAGTGGGCACATCACGAGG - Intronic
1165754916 19:38287429-38287451 GCCAGGGTGGGCAGATCGCGAGG - Intronic
1166370825 19:42299886-42299908 GCCACAGTTGGCACAGTTCTAGG - Intronic
1167275865 19:48538899-48538921 GCCAAGGTGGGCAGATCGCGAGG + Intergenic
1167309050 19:48726157-48726179 GCCAAGGTGGGCAGACCGCGAGG - Intronic
1167344839 19:48938896-48938918 TCCACAGTGGGCAGATCACGAGG - Intronic
1202699616 1_KI270712v1_random:154508-154530 GTCACAGTGGGCACAGTCCTGGG + Intergenic
926942907 2:18156651-18156673 GCCACAGTGGACACAGTGAATGG - Intronic
928253801 2:29704752-29704774 GCCACAGTGAGAACAGGGTGGGG + Intronic
928967880 2:36995321-36995343 GCCAAAGTGGGCAGATCACGAGG - Intronic
932812991 2:74839884-74839906 GCCAAAGTGGGCAGATCACGAGG - Intronic
934636211 2:95992089-95992111 GCTGCAGAGGGCCCAGCGCGGGG - Intergenic
934675199 2:96244904-96244926 CCCACAGTGGATACAGAGCGTGG + Intergenic
934797439 2:97113337-97113359 GCTGCAGAGGGCCCAGCGCGGGG + Intergenic
934835973 2:97590102-97590124 GCTGCAGAGGGCCCAGCGCGGGG - Intergenic
936108749 2:109647913-109647935 GCCTCAGTGGGCACTGAGTGAGG - Intergenic
937252572 2:120533928-120533950 GCCACAGGGGCCACAGCCCGGGG + Intergenic
937305698 2:120869167-120869189 GCCCCAGTGGGGACAGGGAGGGG + Intronic
938027747 2:127965060-127965082 GCCAAGGTGGGCAGATCGCGAGG + Intronic
940896536 2:159086485-159086507 ACAACAGTGGGCATAGCTCGAGG + Intronic
943637235 2:190319646-190319668 GCCACAGTGGGAAAAGGGCCGGG - Intronic
945883485 2:215350712-215350734 ACTACAGTGGGCACAGTGGGAGG + Intergenic
946282732 2:218678023-218678045 GCCAAGGTGGGCAGATCGCGAGG - Intronic
946427262 2:219606017-219606039 GCCACAGTGGTGACAGCTCCCGG - Exonic
946741430 2:222806166-222806188 GCCACAGTGGGGCCAGCTTGAGG + Intergenic
947046621 2:225994412-225994434 GCCAAGGTGGGCACATCACGAGG + Intergenic
947543001 2:230991290-230991312 GCCCCAGTGAGCACACCGGGAGG - Intergenic
948601746 2:239111463-239111485 GCCACAGTGGGCACAGCGCGGGG - Intronic
1169462513 20:5808045-5808067 GCCAGGGTGGGCAGATCGCGAGG + Intronic
1172162685 20:32879404-32879426 GGTTCAGTGGGCACAGCGGGTGG - Intronic
1172341657 20:34162679-34162701 GCCAAAGTGGGCAGATCACGAGG - Intergenic
1172704490 20:36872995-36873017 ACCAGAGTGGGCACAGGGCCAGG + Intergenic
1173000465 20:39101860-39101882 GCTACAGTGGGCTCAGCCCAGGG - Intergenic
1173410740 20:42807476-42807498 GCCACAGAGAGCACAGGGCTCGG - Intronic
1175979831 20:62732908-62732930 ACCACAGCGGGCACAGGGGGCGG + Intronic
1175980707 20:62737272-62737294 GCCACAGCGGCCACAGTGAGTGG + Intronic
1176136661 20:63525655-63525677 GCCACGGTGGGCAGATCACGAGG + Intergenic
1177192036 21:17862756-17862778 TACACAGTGGGCACAGAGAGAGG + Intergenic
1177651450 21:23965571-23965593 ACAACAGTGGGCACAGCGGATGG - Intergenic
1179824645 21:43957299-43957321 GCCACAGTGGGGGCAGCTGGCGG + Intronic
1180944999 22:19687985-19688007 TCCACAGTGTGCACAGGGTGTGG - Intergenic
1180990597 22:19933503-19933525 GACAGAGGGGGCACAGTGCGAGG - Intronic
1180997724 22:19973753-19973775 GCCACAGTGCGCAAAGAGCGCGG - Exonic
1181581637 22:23832052-23832074 GGGACTGTGGGCACAGCGCAGGG - Intronic
1182357463 22:29728764-29728786 TCCACAGTGTGCACAGCCCTGGG - Intronic
1182359499 22:29738288-29738310 CCCCCAGGGGGCACAGCGGGAGG + Intronic
1182492145 22:30680340-30680362 GCCAAAGTGGGCAGATCACGAGG - Intergenic
1183891303 22:40931079-40931101 GCCAAAGTGGGCAGATCACGAGG - Exonic
1184176646 22:42792906-42792928 GCCCCAGTGGGCCCAGCTCTGGG + Intergenic
1184532023 22:45062157-45062179 GCCACAGTGGAGACAGTGTGGGG + Intergenic
1184581530 22:45421061-45421083 GCCAAAGTGGGCAAATCACGAGG + Intronic
949667681 3:6359373-6359395 GCCACAGTGGGCAGATCATGAGG + Intergenic
949994350 3:9604456-9604478 GCCAAAGTGGGCAGATCACGAGG - Intergenic
952817804 3:37460821-37460843 GCCAAAGTGGGCAGATCACGAGG - Intronic
953323884 3:41996289-41996311 GCCAAGGTGGGCAAATCGCGAGG - Intergenic
953531691 3:43745490-43745512 CACACAGTGGGCACAGCAGGCGG + Intergenic
954803150 3:53199041-53199063 CCCACAGTGAGCCCAGCACGTGG + Intergenic
954954251 3:54505296-54505318 GCCACAGTGTGGACAGCCAGGGG + Intronic
957048724 3:75395965-75395987 GCTGCAGAGGGCCCAGCGCGGGG - Intergenic
957079428 3:75623719-75623741 GCCACCAGGGGCACAGGGCGTGG + Intergenic
960982049 3:123238428-123238450 GCCAAAGTGGGCAGATCACGAGG - Intronic
962132268 3:132693637-132693659 GCCAAAGTGGGCAGATCACGAGG + Intronic
963529971 3:146462697-146462719 GCCGCAGTGGGCAGATCACGAGG - Intronic
963535735 3:146525947-146525969 GCCAAAGTGGGCAGATCACGAGG + Intronic
965993764 3:174853129-174853151 GCCAAAGTGGGCAGATCACGAGG + Intronic
968508998 4:987195-987217 GCCGCAGGGGCCACAGCGCGCGG - Exonic
968662338 4:1803963-1803985 CCCACACTGGGCACAGGGCCAGG - Intronic
968732613 4:2276792-2276814 GCCAGGGTGGGCAGAGGGCGGGG + Intronic
968872345 4:3248323-3248345 GCCAGATTCGGCACAGCGTGCGG - Exonic
970757046 4:19439078-19439100 GCCAGAGTGGGCAGATCACGAGG + Intergenic
971784381 4:31082018-31082040 GCCAAGGTGGGCAGATCGCGAGG - Intronic
972290643 4:37686816-37686838 GCCACGGTGGGCAGGGCGCAAGG - Intergenic
972471984 4:39414634-39414656 GCCAAGGTGGGCACATCACGAGG + Intronic
972505233 4:39714781-39714803 GCCAAGGTGGGCACATCACGAGG - Intronic
973341888 4:49013486-49013508 TGCACAGTGGGCACAGCCCATGG - Intronic
977266795 4:94865239-94865261 GCCAAAGTGGGCAGACCGCAAGG - Intronic
977562557 4:98547184-98547206 GCCTCAGTGGGAGCACCGCGTGG - Intronic
979315999 4:119263835-119263857 GCCAAAGTGGGCAGATCACGAGG + Intronic
979383110 4:120031820-120031842 GGCACTGTGGGCACAGCACTCGG + Intergenic
980906187 4:138950816-138950838 GCCAAAGTGGGCAGATCACGAGG - Intergenic
981537595 4:145815980-145816002 GCCAAAGTGGCCACAGCCCTGGG + Intronic
983557194 4:169069111-169069133 GCCAAAGTGGGCAGATCACGAGG + Intergenic
985587405 5:747913-747935 CTCACAGTGGGCACAGCGGTAGG - Intronic
985601957 5:840005-840027 CTCACAGTGGGCACAGCGGTAGG - Intronic
985877776 5:2613292-2613314 GCAACAGTGGGCACAGAGGCAGG - Intergenic
988264051 5:28927854-28927876 GCTGCAGAGGGCCCAGCGCGGGG - Intergenic
988807465 5:34753679-34753701 GCCACGGTGGGCAGATCACGAGG + Intronic
988841402 5:35087222-35087244 GCCAAGGTGGGCAGAGCACGAGG - Intronic
989523212 5:42424484-42424506 GACACAGCGCGCAGAGCGCGCGG + Exonic
994399073 5:99256677-99256699 GCCACTGTGGGCACTGGGGGTGG + Intergenic
995625014 5:114066811-114066833 GCCAAAGTGGGCAGACCACGAGG - Intergenic
997564453 5:134876208-134876230 GCCACACAGGGCACAGAGCACGG - Intronic
998777871 5:145623214-145623236 GCCACAGTGGGCAGATCATGAGG + Intronic
999461525 5:151760954-151760976 GCCAAAGTGGGCAGATCACGAGG - Intronic
999751260 5:154629669-154629691 GCCACAGTGTTCACAGGGCCAGG + Intergenic
1001713158 5:173794045-173794067 GCCCCAGTAGGCATAGCGCCGGG - Intergenic
1001873052 5:175174357-175174379 GCCAAGGTGGGCAGATCGCGAGG + Intergenic
1002197826 5:177510665-177510687 GCCACAGTGGGCACAGAGCTGGG - Intronic
1002857355 6:1050149-1050171 GAGACAGTGGGCACAGAGAGGGG + Intergenic
1003144368 6:3497518-3497540 GCCAAAGTGGGCAGATCACGAGG + Intergenic
1003620670 6:7696643-7696665 GCCAGAGTGGGTACAGGGCCAGG - Intergenic
1003907261 6:10713353-10713375 GCCAAAGTGGGCAGATCACGAGG - Intergenic
1006105706 6:31715189-31715211 GCCCCAGTGGGGACAGGGAGGGG - Intronic
1006420453 6:33930711-33930733 ACCACACTGGGCACAGCTGGAGG + Intergenic
1008405070 6:51109857-51109879 GCCAAAGTGGGCAGATCACGAGG - Intergenic
1009686201 6:66960808-66960830 GCCATGGTGGGCACATCACGAGG + Intergenic
1013496356 6:110701306-110701328 GCCAAAGTGGGCAGATCACGAGG + Intronic
1014170917 6:118278245-118278267 TCCACAGTGAGCACAGAACGTGG + Intronic
1018516082 6:164581443-164581465 GCCCCAGTGGGGACACCGTGTGG + Intergenic
1020016292 7:4834032-4834054 GCCACAGTGTCCACAGGGCCGGG + Intronic
1020251097 7:6469184-6469206 GCCAAGGTGGGCACATCACGAGG - Intronic
1022094470 7:27130276-27130298 GCCGCTGGGGGCACGGCGCGAGG + Exonic
1026611919 7:71867665-71867687 GCCAAAGTGGGCAGATCACGAGG - Intronic
1026852234 7:73732121-73732143 GCCACAGTGGGCAGATCACGAGG - Intergenic
1029223410 7:99008056-99008078 GCCACAGTGGGCGGATCACGAGG - Intronic
1029537825 7:101166387-101166409 GCCGAAGGGGGCACAGCGGGGGG - Intergenic
1031583441 7:123505333-123505355 GCCACAGTGGGCACTCTGTGTGG + Intronic
1034186210 7:149179233-149179255 GCCGCACTGGGCACAGCGGAAGG - Exonic
1034343306 7:150371408-150371430 TCGACAGTGGGCACAGCGATGGG - Exonic
1034867056 7:154650714-154650736 GCCACTGTGGCCACAGCACTCGG + Intronic
1034951281 7:155298317-155298339 GCTCCTGTGCGCACAGCGCGAGG + Exonic
1035164112 7:156974140-156974162 GCCACAGTGGGGAGAGGGGGAGG - Intergenic
1036762319 8:11517929-11517951 CCCTCAGTGGGCACAGGGCTGGG - Intronic
1038871252 8:31496366-31496388 GTCTCAGTGGGCACAGAGTGAGG + Intergenic
1040071249 8:43190515-43190537 GCCTGAGTGGGCACAGAGCTTGG + Intronic
1040106420 8:43544806-43544828 GCCACACCGGGCCCAGCGCAGGG + Intergenic
1044399719 8:91756960-91756982 GCCACAGTGGGCGGATCACGAGG - Intergenic
1044437570 8:92183478-92183500 TCCACAGAGGGCAAAGCGAGAGG + Intergenic
1044796103 8:95899339-95899361 GCCACAGTGGGCAGATCTGGAGG + Intergenic
1045436979 8:102173509-102173531 GCCCCAGTGGGCACTTCGTGTGG + Intergenic
1045948892 8:107829464-107829486 GCCAAGGTGGGCAGATCGCGAGG + Intergenic
1049079295 8:140429322-140429344 GCCACGGTGGGCAGATCACGAGG - Intronic
1049143247 8:140977387-140977409 GCCAAAGTGGGCAGATCACGAGG + Intronic
1049433973 8:142577759-142577781 GCCACAGAGGGTGCAGAGCGTGG + Intergenic
1049584081 8:143425014-143425036 GCCACACTTGGCCCAGCGCCTGG + Intronic
1049798734 8:144508164-144508186 GCCCCAGAGGGCACAGCTCTGGG + Intergenic
1049836890 8:144741269-144741291 GGCACAGTGGTGACAGCTCGTGG + Intronic
1051599875 9:18862090-18862112 GCCTCACTGGGCACAGCACAGGG - Intronic
1051658921 9:19408490-19408512 GCCACAGTGACCGCAGCGAGTGG + Intergenic
1053473910 9:38367801-38367823 GTCAGAGTGGGCACAGTGGGTGG + Intergenic
1056436890 9:86583319-86583341 GCCAACGTGGGCACATCACGAGG + Intergenic
1056830705 9:89915064-89915086 GCCAAAGTGGGCAGATCACGAGG - Intergenic
1057051491 9:91927518-91927540 GCCACAGAGGGCACAGAGATAGG - Intronic
1057196364 9:93117569-93117591 GCCAAAGTGGGCAGATCACGAGG - Intergenic
1057427082 9:94960776-94960798 GCCAAAGTGGGCAGATCACGAGG + Intronic
1059299017 9:113298007-113298029 GACAGAGTGGGCACAGCAGGCGG + Exonic
1059458089 9:114412379-114412401 GCCTCAGTGGGTACAGGGGGAGG - Intronic
1060152882 9:121299906-121299928 GCGACAGCGCGCACAGCGCCAGG - Exonic
1060221851 9:121768332-121768354 GCCATAGTGGGGAAAGCGGGTGG + Intronic
1060473208 9:123965783-123965805 GCCAAAGTGGGCAGATCACGAGG - Intergenic
1061054404 9:128214794-128214816 CCCACGCTGGGCACAGCACGCGG + Intronic
1061418071 9:130458754-130458776 GCCACAGTGCACAGAGCGCAGGG - Intronic
1061929914 9:133827168-133827190 GCCCCAGTGGGCGCAGCGGTAGG - Intronic
1061929934 9:133827264-133827286 GCCTCAGTGGGCGCAGCGGTAGG - Intronic
1061929958 9:133827360-133827382 GCCCCAGTGGGCGCAGCGGTAGG - Intronic
1061929976 9:133827456-133827478 GCCTCAGTGGGCGCAGCGGTAGG - Intronic
1061930017 9:133827648-133827670 GCCCCAGTGGGCGCAGCGGTAGG - Intronic
1061930038 9:133827744-133827766 GCCCCAGTGGGCGCAGCGGTAGG - Intronic
1061930049 9:133827792-133827814 GCCCCAGTGGGCGCAGCGGTAGG - Intronic
1061930060 9:133827840-133827862 GCCTCAGTGGGCGCAGCGGTAGG - Intronic
1061930084 9:133827936-133827958 GCCCCAGTGGGCGCAGCGGTAGG - Intronic
1061930095 9:133827984-133828006 GCCCCAGTGGGCGCAGCGGTAGG - Intronic
1061930106 9:133828032-133828054 GCCTCAGTGGGCGCAGCGGTAGG - Intronic
1061930128 9:133828128-133828150 GCCTCAGTGGGCGCAGCGGTAGG - Intronic
1061930148 9:133828224-133828246 GCCCCAGTGGGCGCAGCGGTAGG - Intronic
1061930171 9:133828320-133828342 GCCCCAGTGGGCGCAGCGGTAGG - Intronic
1061930182 9:133828368-133828390 GCCCCAGTGGGCGCAGCGGTAGG - Intronic
1061930195 9:133828416-133828438 GCCCCAGTGGGCGCAGCGGTAGG - Intronic
1061973890 9:134058800-134058822 GACACAGTGGGCTGAGCGAGGGG - Intronic
1061995311 9:134180180-134180202 GCCACAGAGAGGACACCGCGGGG - Intergenic
1062736237 9:138139205-138139227 CCCACAGCGGGCCCAGCGCAGGG + Intergenic
1187998865 X:24959229-24959251 GCCACAGTGGGCGGATCACGAGG + Intronic
1189120209 X:38386138-38386160 GCCAAGGTGGGCAGATCGCGAGG + Intronic
1191688785 X:63919410-63919432 CCCACAGTGGGCAGAGCTCTTGG + Intergenic
1196119915 X:112038922-112038944 GCCAAAGTGGGCAGATCACGAGG - Intronic
1196729602 X:118927552-118927574 GCCAAAGTGGGCAGATCACGAGG - Intergenic
1196886427 X:120250774-120250796 CCGACAGAGGGCACAGCGCGGGG - Exonic
1199328844 X:146534741-146534763 GCCAAGGTGGGCACATCTCGAGG + Intergenic
1199833180 X:151563664-151563686 GCCCCAGAGTGCAAAGCGCGTGG - Exonic
1200798995 Y:7368515-7368537 GCCTCAGTGGGCAGATCACGAGG + Intergenic