ID: 948601987

View in Genome Browser
Species Human (GRCh38)
Location 2:239112518-239112540
Sequence CTCTCTGATGAGATGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 220}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948601983_948601987 -4 Left 948601983 2:239112499-239112521 CCTGCTGGTGGGGATGTGCCTCT 0: 1
1: 0
2: 3
3: 16
4: 186
Right 948601987 2:239112518-239112540 CTCTCTGATGAGATGGAGCTGGG 0: 1
1: 0
2: 3
3: 20
4: 220
948601975_948601987 22 Left 948601975 2:239112473-239112495 CCAGGACCTTTGGGGCCTAGAGC 0: 1
1: 0
2: 1
3: 11
4: 142
Right 948601987 2:239112518-239112540 CTCTCTGATGAGATGGAGCTGGG 0: 1
1: 0
2: 3
3: 20
4: 220
948601977_948601987 16 Left 948601977 2:239112479-239112501 CCTTTGGGGCCTAGAGCAGGCCT 0: 1
1: 0
2: 0
3: 17
4: 135
Right 948601987 2:239112518-239112540 CTCTCTGATGAGATGGAGCTGGG 0: 1
1: 0
2: 3
3: 20
4: 220
948601980_948601987 7 Left 948601980 2:239112488-239112510 CCTAGAGCAGGCCTGCTGGTGGG 0: 1
1: 0
2: 1
3: 27
4: 285
Right 948601987 2:239112518-239112540 CTCTCTGATGAGATGGAGCTGGG 0: 1
1: 0
2: 3
3: 20
4: 220
948601974_948601987 23 Left 948601974 2:239112472-239112494 CCCAGGACCTTTGGGGCCTAGAG 0: 1
1: 0
2: 1
3: 17
4: 117
Right 948601987 2:239112518-239112540 CTCTCTGATGAGATGGAGCTGGG 0: 1
1: 0
2: 3
3: 20
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948601987 Original CRISPR CTCTCTGATGAGATGGAGCT GGG Intronic
900227120 1:1538493-1538515 CTTTCTGATGCTCTGGAGCTCGG + Intronic
901214362 1:7547308-7547330 CTCTCTCAGTAGATAGAGCTGGG + Intronic
901401582 1:9018481-9018503 CCCTCCGTGGAGATGGAGCTCGG + Intronic
903372326 1:22844706-22844728 TTCTCTGAGGAGACGAAGCTGGG + Intronic
903780708 1:25818421-25818443 CTCTCTGTTGAGAGAGATCTGGG + Intronic
903864506 1:26388509-26388531 GTCACTGATGAGATGGGGATTGG - Intergenic
904882841 1:33713803-33713825 CTCTCTGATGAGTTGACGTTTGG - Intronic
905656780 1:39690852-39690874 CTCCCTGATGAGAAGTGGCTAGG + Intronic
905957133 1:42007164-42007186 CTCTCTGCTGTGGTGGAGATGGG - Intronic
906295518 1:44646767-44646789 CTCTATGATGAGGTGGAGACTGG + Intronic
907310890 1:53538476-53538498 CTCACTCATGGGATGGAGCCTGG + Intronic
908224316 1:62040607-62040629 CTCTCAGGTGAGAATGAGCTGGG + Intronic
909555988 1:76954799-76954821 CTCTGTGGTCAAATGGAGCTGGG + Intronic
909977024 1:82057515-82057537 ATCACTGATGAGAAGGGGCTGGG + Intergenic
915095621 1:153460251-153460273 CCCTCTGTGGAGCTGGAGCTGGG + Intronic
916383063 1:164234733-164234755 CCCTCAGATAAGTTGGAGCTTGG - Intergenic
917079887 1:171246900-171246922 CTCACTCATAAGTTGGAGCTAGG - Intergenic
918102064 1:181385029-181385051 GTCTCTGCTGAGATGGATTTTGG + Intergenic
918192391 1:182188251-182188273 CTCTCTTTTGAGATGGAGTCTGG + Intergenic
920310331 1:205044548-205044570 CCCTCTGCTCAGAAGGAGCTGGG + Intronic
920560712 1:206936523-206936545 CTCTGGGATGAGAAGGAGCTGGG + Intronic
923244019 1:232113495-232113517 CTCACTTATTAGTTGGAGCTAGG + Intergenic
924172337 1:241356279-241356301 CTCTCTGATGGGCTGCAGGTGGG - Intronic
1063168365 10:3484281-3484303 GGCCCTGATGAGGTGGAGCTGGG + Intergenic
1063270192 10:4499892-4499914 CCCTCTGATGAGGAGAAGCTGGG + Intergenic
1063844130 10:10106646-10106668 CTCTCTCAGGAGATAGAGCATGG - Intergenic
1063954858 10:11256307-11256329 CTCTGTGCTGAGAAGGGGCTGGG - Intronic
1066438436 10:35415157-35415179 CACTCAGAGGAGATGGAGCCTGG + Intronic
1066438507 10:35415496-35415518 CTCTCAGAGGAGATGGAGCTGGG + Intronic
1067522654 10:47019837-47019859 TCCTCTGAGAAGATGGAGCTTGG + Intergenic
1067982180 10:51098974-51098996 CTCTCTGAGGCAAGGGAGCTAGG - Intronic
1068634200 10:59330568-59330590 CTCTCTAATGAGCTAGAGATTGG + Intronic
1069558037 10:69410591-69410613 CTCTCTGATGAGCTGCAGGCTGG + Intronic
1070353387 10:75614918-75614940 CTCCCTGGGGAGATGGAGTTAGG + Intronic
1070445457 10:76496392-76496414 CAGTTTGCTGAGATGGAGCTGGG - Intronic
1070499109 10:77053768-77053790 CTTTCTTAAGAGATGGAGGTAGG - Intronic
1071495820 10:86167111-86167133 CTCCCTGATAAGATTGTGCTGGG - Intronic
1072243241 10:93517468-93517490 CTCTCTGAGGAGATGGCATTTGG + Intronic
1073028472 10:100506069-100506091 CTCTGTGATGGGTAGGAGCTGGG - Exonic
1073320111 10:102610825-102610847 CTGGCTGATTACATGGAGCTAGG - Intronic
1073578901 10:104646055-104646077 ATCTCAGTTGAGATGTAGCTGGG + Intronic
1076282596 10:129261123-129261145 CTGACTCTTGAGATGGAGCTTGG - Intergenic
1078067111 11:8085782-8085804 GTCTCTGAAGAGAGGGAGTTCGG + Intronic
1078098806 11:8316923-8316945 TTCTCAGTTGAGTTGGAGCTAGG + Intergenic
1078405601 11:11067699-11067721 CTCTCTGGTGGGATGGGGTTGGG + Intergenic
1078619441 11:12893664-12893686 CCCTCTGTAGAGATGGTGCTGGG + Intronic
1079314975 11:19399851-19399873 TTCTCTGATGGGATGGCTCTAGG + Intronic
1079880844 11:25924172-25924194 CTCACTTATAAGAAGGAGCTAGG - Intergenic
1080099744 11:28446054-28446076 CTCTCTGTCCAGATTGAGCTGGG + Intergenic
1080575563 11:33596108-33596130 CATTCTGAGGACATGGAGCTGGG - Intronic
1082177189 11:49074259-49074281 ATCTCTCATCAGATGGTGCTTGG - Intergenic
1082765177 11:57162055-57162077 CTCTGAGATGGGAGGGAGCTTGG - Intergenic
1082933426 11:58632559-58632581 TTCCCTGATGAGAAGGAGCTAGG + Intergenic
1085250755 11:75142121-75142143 CTCTCTGCTGAGCCGGAGCTGGG + Intronic
1085324527 11:75596442-75596464 CTCTCTAAGGAGATGCAGTTGGG - Intronic
1085918397 11:80920593-80920615 GTCTCTGATGTGATGATGCTAGG + Intergenic
1086310080 11:85525793-85525815 CTCTCTGAGAAGATGAAGCTGGG + Intronic
1086688518 11:89761581-89761603 ATCTCTCATCAGATGGTGCTTGG + Intergenic
1086717341 11:90078364-90078386 ATCTCTCATCAGATGGTGCTTGG - Intergenic
1089330558 11:117686166-117686188 CTATGTGGAGAGATGGAGCTGGG + Intronic
1090642840 11:128744030-128744052 CTCTGTGATGAGAGGATGCTTGG + Intronic
1090941140 11:131389314-131389336 CTTCCTAATGAGATGGAGCTGGG + Intronic
1091628536 12:2140996-2141018 CTCTCTGAGGAGGTGGCACTGGG + Intronic
1091678788 12:2511255-2511277 CTTTATGGTGAGATGGAGTTGGG - Intronic
1094208985 12:27870589-27870611 CTCTCTGAAGTGCTGGAGCCCGG - Intergenic
1095594023 12:43938547-43938569 CACACTGAGGAAATGGAGCTGGG + Intronic
1095718046 12:45370310-45370332 CACTCTTATGAGAGGGAGTTAGG - Intronic
1100098906 12:91078118-91078140 CTTTTGGATGAGATAGAGCTGGG + Intergenic
1101825277 12:108215614-108215636 CTCTCTGATTATAGGTAGCTAGG + Intronic
1103851639 12:123937274-123937296 CTCTTTGATGAGGTGGACCTCGG + Exonic
1106099165 13:26679536-26679558 CTTTCTGATGAGATGAGGGTAGG - Intronic
1106247155 13:27960408-27960430 CTCTGGGAAGAGATGGGGCTTGG - Intergenic
1106448829 13:29861563-29861585 CACTCTGAAGAGAAGAAGCTTGG - Intergenic
1108507220 13:51123337-51123359 CAATCTGTTGAGATGAAGCTTGG - Intergenic
1110466948 13:75813257-75813279 CTCTCTGATTTGAAGCAGCTTGG + Intronic
1118105164 14:62650369-62650391 TTCTCTGTGGAGATGGGGCTTGG + Intergenic
1121938633 14:98045165-98045187 CTCTCTGAGGACATGGCACTTGG - Intergenic
1123785168 15:23664029-23664051 CTCTCTGAGGAGATGACCCTTGG - Intergenic
1124013674 15:25859461-25859483 CCCTCTGATCATATGGACCTCGG - Intronic
1126105000 15:45141662-45141684 CATTCGGCTGAGATGGAGCTCGG + Intronic
1126766176 15:52013655-52013677 CTCTCTCATGAGATACAGTTTGG + Intronic
1127475433 15:59328096-59328118 CTCTCAAAGGAGATGGGGCTGGG + Intronic
1127723815 15:61728171-61728193 CCCTCTTCAGAGATGGAGCTTGG + Intergenic
1129114285 15:73356633-73356655 CTTTTTGATGGGATGGAGCTTGG + Intronic
1129919414 15:79307319-79307341 CTCTGTGATGAGAGGGAGGCTGG + Intergenic
1131110986 15:89765423-89765445 CTCTCTGAGTTGATGGAACTGGG + Intronic
1132463956 16:69073-69095 CTCTCTGAGGGGCAGGAGCTGGG + Intronic
1133521058 16:6557640-6557662 ATCTCTGATGAAATGGAGAAGGG + Intronic
1134183619 16:12066366-12066388 CTCTGTGATGGGATGGAGGGTGG + Intronic
1134542393 16:15078218-15078240 GTCTCAGAAGAGCTGGAGCTTGG - Intronic
1136416532 16:30107576-30107598 ATCCCTGATGAGAGGGGGCTGGG - Intronic
1136507215 16:30712367-30712389 CTTGCTGATGAGATGGGGCTTGG + Exonic
1137914126 16:52410311-52410333 ACCTCTCATGAGATGGAGTTGGG + Intergenic
1139511922 16:67432467-67432489 CTGTGTGATCAGATGGGGCTGGG + Intronic
1141162452 16:81638453-81638475 CTCTCTGAGGGGATGGTGCCTGG + Intronic
1143120814 17:4605619-4605641 AGCTCGGAAGAGATGGAGCTGGG + Intronic
1143529802 17:7496159-7496181 CTCTGAGATGAGTGGGAGCTGGG + Intronic
1143593328 17:7899134-7899156 CTAGCTGATGAGATGGGGCTAGG + Exonic
1144033389 17:11342086-11342108 ATCTCTGCTGAAATGGAGCGGGG + Intronic
1144293901 17:13855084-13855106 CTCTCTGATCAGGTGGAATTTGG - Intergenic
1145043713 17:19595860-19595882 CTGATTGATGTGATGGAGCTCGG + Intergenic
1146008637 17:29177969-29177991 CACCCTGCTGAGGTGGAGCTGGG - Intronic
1147994923 17:44355077-44355099 CCCACAGATGAGGTGGAGCTGGG + Exonic
1150287325 17:63961671-63961693 CTCACTGAGGCGGTGGAGCTTGG - Intronic
1151730842 17:75910252-75910274 CTCCCTGATGAGCTGGAGAAGGG - Intronic
1151768172 17:76142780-76142802 AACTCTGGTGGGATGGAGCTGGG + Exonic
1155183168 18:23365796-23365818 CTCTCTGAGGAGCTGGATTTAGG - Intronic
1155384379 18:25261251-25261273 CTGTCTGATTAGCAGGAGCTAGG + Intronic
1155549051 18:26945937-26945959 ATCTCATATGACATGGAGCTTGG - Intronic
1157323111 18:46649154-46649176 CTTGCTGGTGAGCTGGAGCTTGG + Intronic
1157810007 18:50688197-50688219 CTCTCTGAAGAGACGAGGCTGGG + Intronic
1158321446 18:56268536-56268558 TTCTTTGAAGAGATGGAGCTGGG - Intergenic
1158474419 18:57767304-57767326 CTTTCTGAGGAAATGGAGCTTGG - Intronic
1160546232 18:79657781-79657803 GTCTCTCCTGAGATGCAGCTGGG - Intergenic
1160764756 19:802488-802510 CTTTCTGATGCGATGGCCCTGGG + Intronic
1162185070 19:8898412-8898434 CTCTCTGTTGAGGTGGAGTGTGG + Intronic
1163683916 19:18699938-18699960 CTCTGTGATGACCTGGGGCTTGG + Intronic
1164628068 19:29742637-29742659 CTCTGTGATGAGATGGGGTGAGG - Intergenic
1166147914 19:40849972-40849994 CTCACTGATCTGATGGAGGTGGG + Exonic
1167053324 19:47093550-47093572 CTCTCTGAAGTAAAGGAGCTGGG - Intronic
1167556115 19:50196875-50196897 CTCTCTGAGGAGGTGTTGCTGGG - Intronic
1167649592 19:50722144-50722166 CTCGATGATGAGAAGGAGCTGGG + Intergenic
1168091875 19:54091009-54091031 CTTTTTTATGAGATGGAGCTTGG + Intergenic
927501062 2:23583555-23583577 CTCTCAGAAGGGAAGGAGCTGGG + Intronic
929312750 2:40444441-40444463 ATCTCAGAAGTGATGGAGCTGGG + Intronic
929572102 2:43029172-43029194 GTGTCTGCTGAGATGGTGCTGGG + Intergenic
936268797 2:111032683-111032705 CTATCTCATGGGATGGAGATGGG + Intronic
936505868 2:113105578-113105600 TTCTCAGAAGAGATGGAACTCGG - Intergenic
937820912 2:126308897-126308919 TTCTCTGATTAAATGCAGCTTGG + Intergenic
940238782 2:151540612-151540634 CTCTCTGATCAGAGGTAGCAGGG + Intronic
941765964 2:169296854-169296876 CTCCCTGATGATATCAAGCTGGG - Intronic
942892423 2:181007562-181007584 TTCTCTAATGAGATGGAAATTGG + Intronic
944466186 2:200002189-200002211 CACACTGATGAAAAGGAGCTGGG - Intronic
945847882 2:214968795-214968817 CTCTCTGTAGATATGGAGGTTGG - Exonic
946530430 2:220564422-220564444 CTCAGTGATGAGATGGGACTGGG - Intergenic
946770812 2:223086464-223086486 CACTTTGCAGAGATGGAGCTGGG - Intronic
948601987 2:239112518-239112540 CTCTCTGATGAGATGGAGCTGGG + Intronic
1168770104 20:408979-409001 CTCTGTGCTGAGATGGGGCTAGG + Intronic
1170807661 20:19647138-19647160 CTCTGAGAGGAGAGGGAGCTGGG - Intronic
1171988716 20:31678986-31679008 TTCTGTGATGTGATGGAACTGGG + Intronic
1174039847 20:47691375-47691397 CTGAATGATGAGAAGGAGCTGGG + Intronic
1174553270 20:51376469-51376491 CCCTCTGTAAAGATGGAGCTGGG - Intergenic
1175470074 20:59221375-59221397 CTCTGGGACGAGTTGGAGCTTGG - Intronic
1175615284 20:60393140-60393162 CTCTCCGATGAGAATGAGGTTGG - Intergenic
1180257058 21:46637061-46637083 CTCACAGATGTGATGGAGCTTGG + Intronic
1181024264 22:20118809-20118831 CTCTGTGCTCACATGGAGCTGGG + Intronic
1183158687 22:36095436-36095458 CTCACTGATGAGAGAGAGCTGGG + Intergenic
950167808 3:10814907-10814929 CTTTCTGGGGAGATGGAGGTTGG + Intergenic
951919651 3:27840488-27840510 CTCTCTGATGAGATGATATTTGG + Intergenic
953747015 3:45583054-45583076 CTCTCTGAGCAGATGGCCCTGGG + Intronic
954223571 3:49168881-49168903 CTCTCTGCTCAGATAGAGCTGGG - Intergenic
957233233 3:77548736-77548758 CTCTCTGATGGGAGAGAGATAGG - Intronic
957553334 3:81734953-81734975 ATCCCAGGTGAGATGGAGCTGGG - Intronic
961556905 3:127702100-127702122 CACACTGAGGAGATGGAGCGGGG + Intronic
962287915 3:134103845-134103867 CACTTTGAAAAGATGGAGCTGGG - Intronic
962297868 3:134209312-134209334 CTCTCGGGTGAGATAGACCTGGG - Intronic
964082465 3:152776163-152776185 CTCTCTGAAGAAATGGAGCTGGG + Intergenic
966243682 3:177782217-177782239 CTCTCTGATGAGGTGAGGTTAGG - Intergenic
968804164 4:2761906-2761928 CTCCCTGCTGAGTTGGAGCCGGG - Intergenic
969329374 4:6464389-6464411 CTCTCTCCTGAGAAGTAGCTAGG + Intronic
970117675 4:12717663-12717685 CTCTCTGAAGAGGTGCAACTGGG - Intergenic
971159054 4:24114468-24114490 CTGTCTGGTGAGGTGGAGCAAGG - Intergenic
974011660 4:56612996-56613018 GGCTGTGATGAGATGGAGCAGGG - Intergenic
975733806 4:77362891-77362913 GTCTTTGCTGAGATGGAGTTTGG + Intronic
977071167 4:92389711-92389733 TTCACTGATGATATGGAACTGGG + Intronic
977758024 4:100696872-100696894 TTCTCTGATGAAATGCAGGTAGG - Intronic
983051081 4:163048452-163048474 CTCTCTGATGTGATGTTGCATGG + Intergenic
983403924 4:167301612-167301634 CTCTGTGATGATAAGGAACTTGG + Intergenic
985038801 4:185867932-185867954 CTAACAGATGAGATAGAGCTGGG - Intronic
986196822 5:5544330-5544352 ATCTCTAATGAGATGGTACTAGG - Intergenic
988858846 5:35255998-35256020 CTCACAAATTAGATGGAGCTTGG + Intergenic
990160087 5:52928264-52928286 ATATCTGATAAAATGGAGCTGGG + Intronic
992086336 5:73281310-73281332 CTCCCTGAGGCGATGGAGCGGGG + Intergenic
994309965 5:98258671-98258693 CTCTGTGCTGATCTGGAGCTGGG + Intergenic
994364468 5:98896404-98896426 CTCGCTGATGAAATGGGCCTTGG - Exonic
996703176 5:126470271-126470293 CTCTCTGATGACATAGAACTAGG - Intronic
997596756 5:135112206-135112228 CTCCCTGATGAGCTGGGGCAAGG - Intronic
998015152 5:138725764-138725786 CTCTCTGGCCACATGGAGCTGGG + Intronic
999298262 5:150474192-150474214 GTCTGGGGTGAGATGGAGCTGGG - Intergenic
999586214 5:153092495-153092517 CTCCCTGATGACAGGGAGATTGG + Intergenic
1001645479 5:173278597-173278619 CTCTCTGATGTCATGTATCTCGG - Intergenic
1003393672 6:5734544-5734566 CTCTCTGTAGAGAGGGAGCAAGG + Intronic
1005525492 6:26643591-26643613 TACTCTGATGAGATGGAGTCTGG + Intronic
1007418367 6:41705281-41705303 CTCATTGTTCAGATGGAGCTGGG - Intronic
1007481897 6:42155681-42155703 CTCTCTGGGGAGATGGAGAGAGG + Intronic
1008637244 6:53423193-53423215 CTCTCTGCTGAGGTGAAGTTTGG + Intergenic
1013154556 6:107481029-107481051 CTCCCTTCTGAGATGGAGCCTGG - Intergenic
1014705941 6:124747483-124747505 TTCTCTGATAAGGTGCAGCTGGG - Intronic
1015536315 6:134270808-134270830 TCCTCTGAAGAGACGGAGCTGGG - Intronic
1017130500 6:151104502-151104524 CTCTCAGATGGGAGGGAACTAGG - Intergenic
1017339316 6:153302200-153302222 CTGTGGGATGAGATGGAGTTTGG - Intergenic
1017472140 6:154749491-154749513 CTTTCTGATGGGGTGGGGCTGGG + Intronic
1017963273 6:159240679-159240701 CTCCCTGAAGAGCAGGAGCTAGG + Intronic
1020868477 7:13596424-13596446 CTCTCTGAGGATATTAAGCTGGG + Intergenic
1022511965 7:30941684-30941706 CTCTCTCATCAGACAGAGCTAGG + Intronic
1022573218 7:31473283-31473305 CTGTGTGATGAGAAGCAGCTTGG - Intergenic
1024666042 7:51548236-51548258 CTCTCAGAAGGGCTGGAGCTGGG - Intergenic
1024727421 7:52214019-52214041 CTGTCTGATGATCTTGAGCTGGG + Intergenic
1028419678 7:90618915-90618937 CTTTTTGATGAGAAGGAGCAGGG + Intronic
1028990589 7:97045027-97045049 CTCTCTGCTGAGGTGTGGCTGGG - Intergenic
1030188407 7:106786641-106786663 CTCTCCAATCAAATGGAGCTAGG - Intergenic
1030400975 7:109049761-109049783 CTCTGTGATAAGGAGGAGCTTGG + Intergenic
1031945102 7:127831339-127831361 CTCTCTGAAGGGCTGCAGCTAGG + Intronic
1032079104 7:128849828-128849850 GCCTCTGGGGAGATGGAGCTGGG - Intronic
1033319999 7:140330720-140330742 TCCTCAGATGAGATGGTGCTTGG + Intronic
1033529668 7:142249054-142249076 CTCTCTAGGGAGATGGGGCTGGG + Intergenic
1034397886 7:150841169-150841191 CTCTCTGATCTTATGGAGCAGGG + Intronic
1034940217 7:155225787-155225809 CTACCTGCTGAGATGGTGCTGGG + Intergenic
1035692877 8:1571556-1571578 GTGTCTGATGAGATGGAGAGGGG + Intronic
1039596669 8:38796661-38796683 TTCACTGATGAGCTGAAGCTAGG - Intronic
1042461437 8:69073568-69073590 CTCTCAAATCAGATGGACCTGGG - Intergenic
1042517473 8:69674683-69674705 CTCTCTGATGCCGTGGAGTTGGG - Intronic
1043225604 8:77725758-77725780 CTATCTGCTGATATTGAGCTTGG - Intergenic
1044407027 8:91839419-91839441 CTCTATGATGAGGTAGAGCACGG - Intergenic
1044617668 8:94158737-94158759 CTCTCTGCTGAAATGCAGCAGGG + Intronic
1045571475 8:103372210-103372232 CTCGCTGATCACATGGACCTGGG + Intronic
1046645108 8:116777388-116777410 TTCTCTGATGGGAGGGAGGTGGG - Intronic
1047599421 8:126411324-126411346 CACTCTGTTGCAATGGAGCTTGG + Intergenic
1047689946 8:127341586-127341608 CTCTCAGATGAGAAGGAGCTTGG - Intergenic
1049202922 8:141350639-141350661 CACTCTGCTGAGATGGAGTGGGG - Intergenic
1050435411 9:5604589-5604611 ATCTCTGCTGAGATTGAGCGAGG + Intergenic
1053004791 9:34597252-34597274 CTCTCTGCTGCTATAGAGCTGGG + Intergenic
1053580718 9:39401250-39401272 CTCTCTTTTGAGATGGAGTCTGG - Intergenic
1053845212 9:42229298-42229320 CTCTCTTTTGAGATGGAGTCTGG - Intergenic
1054102305 9:60960055-60960077 CTCTCTTTTGAGATGGAGTCTGG - Intergenic
1054584054 9:66946807-66946829 CTCTCTTTTGAGATGGAGTCTGG + Intergenic
1055247948 9:74269608-74269630 CACTCTGATGAGATGAAGTAAGG - Intergenic
1060281105 9:122216308-122216330 GTCACAGATGGGATGGAGCTGGG - Intronic
1060673861 9:125494695-125494717 CTTTGAGATGAGAAGGAGCTTGG - Intronic
1060912617 9:127362953-127362975 GCCTCTGAAGTGATGGAGCTGGG + Intronic
1062159723 9:135073689-135073711 CTCTGTGAGGAGATGGTGCTGGG - Intergenic
1062265914 9:135686404-135686426 CTTTCTGAGGAGCAGGAGCTGGG - Intergenic
1062438317 9:136556910-136556932 CCCTTTGAGGAGATGGACCTGGG - Intergenic
1062497682 9:136839340-136839362 CCCCCTGCTGAGATGGAGCCGGG + Exonic
1186079263 X:5912809-5912831 CTCTGTGATGTGATGGAGCAGGG + Intronic
1188524539 X:31075010-31075032 CTCTCTGAGGAGAAGGAGGCAGG + Intergenic
1189877997 X:45456686-45456708 CTCTCTCAAGAGATTGACCTGGG + Intergenic
1190327548 X:49216027-49216049 GTCTCTGAAGAGATGAAGCAGGG - Intronic
1191893991 X:65973869-65973891 CTCTCTGTTGAGGTGGAGACGGG - Intergenic
1192001510 X:67156824-67156846 CTCTAGGAAGTGATGGAGCTAGG - Intergenic
1197701036 X:129599840-129599862 CTCTGTGGTGAGAGGGAGCAAGG - Intergenic
1197747873 X:129944952-129944974 CTCTGGAGTGAGATGGAGCTAGG + Intergenic
1201850624 Y:18476000-18476022 CTGGCTGATGAGAGGGAGCCAGG - Intergenic
1201882694 Y:18844377-18844399 CTGGCTGATGAGAGGGAGCCAGG + Intergenic