ID: 948602257

View in Genome Browser
Species Human (GRCh38)
Location 2:239114034-239114056
Sequence GACCCAAGCCTGCCACACAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 158}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948602257_948602260 -10 Left 948602257 2:239114034-239114056 CCCGTGTGTGGCAGGCTTGGGTC 0: 1
1: 0
2: 1
3: 22
4: 158
Right 948602260 2:239114047-239114069 GGCTTGGGTCTAGGTGCTCCAGG 0: 1
1: 0
2: 4
3: 16
4: 211
948602257_948602261 -3 Left 948602257 2:239114034-239114056 CCCGTGTGTGGCAGGCTTGGGTC 0: 1
1: 0
2: 1
3: 22
4: 158
Right 948602261 2:239114054-239114076 GTCTAGGTGCTCCAGGTACAAGG 0: 1
1: 0
2: 0
3: 8
4: 102
948602257_948602264 20 Left 948602257 2:239114034-239114056 CCCGTGTGTGGCAGGCTTGGGTC 0: 1
1: 0
2: 1
3: 22
4: 158
Right 948602264 2:239114077-239114099 CCCCACACTGATTCATTCAGTGG 0: 1
1: 0
2: 0
3: 10
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948602257 Original CRISPR GACCCAAGCCTGCCACACAC GGG (reversed) Intronic
900374028 1:2345219-2345241 GTCCCCAGGCTGCCACACTCAGG + Intronic
900896556 1:5486933-5486955 CACCCAGGCCTGACACCCACAGG - Intergenic
901021356 1:6257568-6257590 GGCCCAGGTCTGGCACACACTGG + Intronic
902983917 1:20143912-20143934 GACCCCTGCCTGCCTCACACTGG + Intronic
903139727 1:21332264-21332286 GTCCCATCCCTGCCAGACACTGG + Intronic
906180020 1:43810213-43810235 GCCCCAAGGATGCCAAACACAGG + Intronic
906789915 1:48650140-48650162 GCACCAAGCCTGCCAGACCCTGG - Intronic
910432658 1:87174382-87174404 GTCCCAGCTCTGCCACACACTGG - Intergenic
910637751 1:89428290-89428312 GACCCAAGCATGCCATCCAGGGG - Intergenic
912797756 1:112703155-112703177 GCCCCAACCCTGCCACCCAAAGG + Intronic
913209083 1:116568896-116568918 GACCCAAGCCTGCCTCATTAGGG - Intronic
915336584 1:155146595-155146617 GACCCCAGTCTGCCAGACACAGG + Intergenic
915594513 1:156888482-156888504 TACCCAGGCCAGCCACCCACCGG + Intergenic
916559287 1:165919130-165919152 GCCCCAAGCCTGGCTGACACAGG - Intergenic
918395247 1:184107784-184107806 AACCCAAGCCTTCTACACAACGG + Intergenic
921174895 1:212585204-212585226 GCCCCAGAGCTGCCACACACAGG - Intronic
923084696 1:230694607-230694629 GCCCCCAGCCTGCCACAAAGAGG + Intergenic
923469728 1:234279754-234279776 GGCCAAAGCCTGCCTCACAGTGG + Intronic
1063535704 10:6881140-6881162 GATGCCTGCCTGCCACACACGGG + Intergenic
1068175676 10:53454846-53454868 GACCCAAACATGCAATACACGGG - Intergenic
1068949216 10:62760695-62760717 GGCCCAGGCCTGCAACAGACGGG + Intergenic
1069831787 10:71286231-71286253 GACCCAGGTCTGCCAGACCCGGG + Intronic
1069908553 10:71746469-71746491 GACCCAGGCCCGCCACACAATGG + Intronic
1072661971 10:97368849-97368871 GACTCAAGCCAGTCACACATGGG + Intronic
1073060444 10:100730522-100730544 GACCCAAGCCCGCCAGACGGTGG - Intergenic
1073402849 10:103273272-103273294 GACACAGCCCTGGCACACACAGG + Intergenic
1074883024 10:117673127-117673149 GTCCCAAGCCTGCCATAGGCAGG + Intergenic
1075837858 10:125471275-125471297 GATCCCAGCGTGCCACTCACCGG - Intergenic
1077574554 11:3372168-3372190 AACCCAAGCTTGCCACTTACAGG - Intronic
1077843731 11:6002368-6002390 GAGTCCAGCCTGCCACAAACTGG + Exonic
1085260675 11:75203015-75203037 GCCCCAGGCCTGGCACACAGTGG - Intronic
1089697715 11:120226136-120226158 GCCCCTAGCCTGTCACACACGGG - Intronic
1091791328 12:3273785-3273807 GAGCCAGGCCTGCCCCGCACAGG - Intronic
1092209853 12:6639145-6639167 GACCCAGGTCTTCCACACACAGG + Intronic
1093055007 12:14547299-14547321 CAGCCAGTCCTGCCACACACAGG + Intronic
1097160603 12:57044075-57044097 GGCCCAAGCCTGCCTCACCCTGG + Intronic
1097195975 12:57242687-57242709 CACCCCAGCCTGCCTCTCACTGG + Intergenic
1100583330 12:95956501-95956523 GCCCCTAGTCTGCCAGACACTGG - Intronic
1102034098 12:109761147-109761169 GTCCCAGCTCTGCCACACACTGG - Intronic
1103480413 12:121246877-121246899 CACCTATGCCTGGCACACACTGG + Intronic
1103507844 12:121453629-121453651 GACACAGGCCTTCCACAGACTGG + Intronic
1103721323 12:122977024-122977046 GACCCCAGCATCCCACACCCAGG - Intronic
1103816281 12:123659502-123659524 GTCACAAGCCTGCAAGACACAGG - Exonic
1104188686 12:126457540-126457562 GACCCTAACCTGGCACACACAGG + Intergenic
1106517338 13:30466194-30466216 AACCCAAGCCAGCCCCACACCGG + Intronic
1111132609 13:83996636-83996658 GGCCCAAGTGTCCCACACACAGG + Intergenic
1113046198 13:106158055-106158077 GACCCAACTCTGCCACATGCGGG - Intergenic
1115729953 14:36258009-36258031 GAACCAACCCTGCCACAAACTGG - Intergenic
1118637618 14:67762362-67762384 GCCCCAAGCATGCCACGCCCCGG + Exonic
1122370199 14:101225382-101225404 GACCCTAGCCTGGCACCCAGTGG + Intergenic
1122890725 14:104731008-104731030 GACCCAAGCCTGCACCACAGAGG + Intronic
1124377772 15:29139646-29139668 GAGCAGAGGCTGCCACACACTGG + Intronic
1124852338 15:33352479-33352501 GAGCCAAGCCCACCACACTCTGG + Intronic
1125584535 15:40810672-40810694 GACCCAAGCCCAGCAGACACAGG + Exonic
1126545691 15:49871732-49871754 AACCAAAGCATGCCAGACACTGG + Intronic
1127929517 15:63583050-63583072 GACCCCATGCTTCCACACACGGG + Intronic
1129413479 15:75362213-75362235 GAGCCAGCCCTGCCACACAGCGG + Intronic
1129701956 15:77773349-77773371 CACTCAAGCCTGGCACACAGTGG - Intronic
1130230349 15:82092244-82092266 GTCCCAAGCCTGCCTGACTCCGG + Intergenic
1132416365 15:101622246-101622268 GACCGCATCCTCCCACACACAGG + Intronic
1132826496 16:1907991-1908013 GCCCTAAGCCTTGCACACACGGG - Intergenic
1133023901 16:2979568-2979590 GGCCCAACCCTGGCACACTCGGG + Intronic
1133286955 16:4694910-4694932 GGGCCAGGCCTGCCACACAATGG - Intronic
1134317115 16:13128703-13128725 GACCCAAGTCTGCCTCCCAGTGG - Intronic
1135987700 16:27196113-27196135 TACTCAAGCCTGCCACTCAAAGG + Intergenic
1138094198 16:54199464-54199486 GCCCCAAGCCTGCCAGCCCCAGG - Intergenic
1138580912 16:57939991-57940013 GCCCCAAGCCAGGCACCCACAGG + Intronic
1138598987 16:58043998-58044020 GAGCCAAGCCTGCCCCACTCAGG - Intronic
1141911038 16:87058336-87058358 CCACCAAGCCTGCCACACCCAGG + Intergenic
1142266125 16:89064750-89064772 GACCCCGGCCTCCCACCCACAGG + Intergenic
1143575673 17:7791822-7791844 GACCCAGGCTTTCCACACTCTGG + Intronic
1143621768 17:8084887-8084909 GACCCCAGCCCACCACACAAGGG + Intronic
1143881741 17:10035232-10035254 GACCCAAGGCAGCCACACCTTGG + Intronic
1145003344 17:19320942-19320964 GATCCAAGCCTGACACACAGAGG - Intronic
1145056714 17:19707930-19707952 GAGCCATGCCTGCCCCACACGGG - Intronic
1146610913 17:34304246-34304268 GACCTAAGCCTGTCATAAACAGG - Intergenic
1146920124 17:36704531-36704553 GACCCAGGCCTGACTCACCCAGG - Intergenic
1147600325 17:41741148-41741170 TACCTCAGCCTTCCACACACTGG + Intergenic
1150226413 17:63527039-63527061 CACCCACGCCTGCCCCGCACTGG + Intronic
1151231432 17:72688017-72688039 GACCCAAGCCGGGGACAAACAGG + Intronic
1152652043 17:81499354-81499376 GACCCCCGCCTGCCGCACCCCGG + Intergenic
1152944618 17:83192167-83192189 GACCCCAGCCTGCCCCACACTGG + Intergenic
1154002204 18:10491541-10491563 GACCCAAGCCAGGAACACTCAGG - Intergenic
1155506542 18:26538926-26538948 AACGGAAGCCTGCCACACACCGG + Intronic
1156508710 18:37616826-37616848 GACCCAAGCATGGGAAACACAGG - Intergenic
1157580122 18:48769210-48769232 GGCCCAAGCCAGGCACACCCAGG + Intronic
1160027584 18:75231173-75231195 GCCCCAAGCCTGGCACAGAGTGG + Intronic
1161184067 19:2904294-2904316 AACCCAAGCCTGACAAACGCTGG - Intronic
1161592851 19:5136582-5136604 GTCCCAGGCCTGCCACAGCCGGG + Intronic
1163582105 19:18145101-18145123 GGCCGCAGGCTGCCACACACGGG - Exonic
1164571527 19:29378237-29378259 GAACTAGGCCTGCCACACCCAGG + Intergenic
1165848031 19:38831543-38831565 GACCCCAGACTGCAAGACACAGG + Intronic
1167097392 19:47381657-47381679 CACCCAGGGATGCCACACACTGG + Intronic
1167632989 19:50637426-50637448 GCCCCATCCCTCCCACACACAGG - Exonic
926101887 2:10123055-10123077 GCCCCACGCCCGCCACTCACCGG - Exonic
926704145 2:15824983-15825005 GCCCCAACTCTGCCACTCACAGG + Intergenic
927138403 2:20113765-20113787 GGCGCAACCCTGCCAGACACTGG - Intergenic
927422557 2:22948509-22948531 GGCCAAAGGCTGTCACACACGGG + Intergenic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
933207144 2:79519877-79519899 GAAACAAGCCAACCACACACTGG - Intronic
937835715 2:126468633-126468655 GCACCAAACCTGCCACACATTGG + Intergenic
941711826 2:168722829-168722851 GATGCAACCCTCCCACACACAGG + Intronic
941772791 2:169362258-169362280 GACCCGACCCTGCCACAGCCGGG + Intronic
946723984 2:222642876-222642898 GAACCAATCCTTCCAGACACAGG + Exonic
947570675 2:231231886-231231908 GACACAAGCCTGGCCAACACGGG - Intronic
948135789 2:235635200-235635222 GACCCACTGCTGCCACACACAGG - Intronic
948602257 2:239114034-239114056 GACCCAAGCCTGCCACACACGGG - Intronic
1169194734 20:3677047-3677069 TACCCCAGCCTGGCACTCACTGG + Exonic
1170554690 20:17505668-17505690 GGCCCAAGCCTGGGACACAGGGG + Intronic
1172693992 20:36809186-36809208 GGCCCAGCCCTGCCACACTCTGG + Intronic
1172869419 20:38126529-38126551 CCCCCAAGCCTGCCCCACTCCGG - Intronic
1173424611 20:42932018-42932040 GTCCCATGAATGCCACACACGGG + Intronic
1175261320 20:57675818-57675840 GACCCCAGACAGTCACACACCGG - Intronic
1175551286 20:59819628-59819650 GGCCCAACCAGGCCACACACGGG - Intronic
1178983756 21:37285845-37285867 CACCCACCCCTGCCACACTCTGG - Intergenic
1179131009 21:38637030-38637052 GTTCCAAGCCTGCCTCCCACTGG - Intronic
1179261107 21:39758647-39758669 GACCCAGGCCTTGCACACACAGG - Intronic
1181047504 22:20222630-20222652 CAGCCGAGCCTGGCACACACTGG - Intergenic
1181992889 22:26850973-26850995 GACCCATGCCTGAGACAAACAGG - Intergenic
1183688002 22:39373095-39373117 GACACAATCCTGCCAGATACAGG - Intronic
1183964249 22:41431851-41431873 GGCCCTGGCCTGCCAGACACAGG - Intergenic
1184115517 22:42419645-42419667 GACGTCAGCCTGCCACACTCCGG + Intronic
1184457869 22:44621733-44621755 GGCTCACTCCTGCCACACACAGG + Intergenic
1184660433 22:45963171-45963193 GAGCCAGGCCAGCCCCACACAGG + Intronic
1185277448 22:49955905-49955927 GGCCCAGGCCTGGGACACACAGG + Intergenic
950310018 3:11948992-11949014 GACCCAATCCTGGCACTCATTGG - Intergenic
953916017 3:46921720-46921742 GACACATTTCTGCCACACACAGG + Exonic
964507495 3:157415491-157415513 GACCCAGGCATCCCACACATGGG + Intronic
967682190 3:192377221-192377243 GGCCCCTGCCTGCCTCACACGGG + Intronic
975290721 4:72675714-72675736 GACCAAAGCTTGACATACACTGG - Intergenic
976200151 4:82569979-82570001 GACACCAGCCTGTCAGACACTGG - Intergenic
978400271 4:108323661-108323683 GACCCAGGCCTGGCTCACAGTGG + Intergenic
985548498 5:521715-521737 GGCCCAAGCCTGCACCACAGCGG - Intronic
985788102 5:1910485-1910507 GAGCCCAGCCAGCCACGCACAGG + Intergenic
992351406 5:75932827-75932849 GACCTAAGCCTGTCATAAACAGG - Intergenic
994718119 5:103347982-103348004 GACTCCAGCCTACCTCACACAGG - Intergenic
998041267 5:138952272-138952294 GACCCAAGCACATCACACACTGG + Intronic
999229888 5:150055486-150055508 AGCCTAAGCCTGCCACACACTGG - Intronic
999270826 5:150295475-150295497 GGCCCAGGCCTGACACACCCTGG - Intergenic
1000359615 5:160434864-160434886 GAACCAACCCTGCCACACCTCGG - Intergenic
1001267252 5:170282804-170282826 GACCCAATCCTTCCATTCACAGG - Intronic
1002299460 5:178249097-178249119 GGCCCAACCCAGCCACATACCGG + Exonic
1002324111 5:178394294-178394316 GAACAGTGCCTGCCACACACTGG + Intronic
1005834116 6:29695081-29695103 TCCCCAAGCCTGCCCCACAATGG + Intergenic
1007299426 6:40855715-40855737 GAGCCAAGCATGCCAAGCACGGG + Intergenic
1012422882 6:99084189-99084211 CACCAAAAGCTGCCACACACAGG - Intergenic
1016559455 6:145378728-145378750 GACCTCAGCCTCCCCCACACTGG - Intergenic
1016888910 6:148986091-148986113 GGCCCATTCCTGCAACACACAGG - Intronic
1017549920 6:155495246-155495268 GACCCAGGCTTGACACACACAGG + Intergenic
1017732213 6:157326672-157326694 CTCAGAAGCCTGCCACACACTGG + Intergenic
1017748696 6:157469950-157469972 GACCCAGGCCCACCACTCACTGG + Intronic
1017813728 6:158002180-158002202 GAACCATGCCTGGCACACAGTGG + Intronic
1017956486 6:159182422-159182444 GACCCAGGGCTTCCACACATGGG + Intronic
1018768072 6:166949755-166949777 GAGCAAAGCCTGCACCACACGGG + Intronic
1019377152 7:698962-698984 AGCTCCAGCCTGCCACACACAGG + Intronic
1023864384 7:44232004-44232026 GACCCACCCCAGACACACACGGG + Intronic
1024159936 7:46663616-46663638 GACTCATGCCTGCCACAGAGTGG - Intergenic
1024978388 7:55134294-55134316 GGCCCACCCCAGCCACACACAGG + Intronic
1035293974 7:157857446-157857468 GCGCCGAGCCTGCCACACAGAGG - Intronic
1037872659 8:22513326-22513348 GACCAAAGCAGGTCACACACAGG - Exonic
1039219630 8:35315307-35315329 GACCCAAGCCTGCCCCATAGGGG - Intronic
1045111697 8:98942684-98942706 TCCCCAAGCCTCCCACTCACGGG - Intronic
1045790010 8:105972536-105972558 GACTCAGGGCTGCCACACACGGG - Intergenic
1045990125 8:108297082-108297104 TACCCACGCCTGCATCACACGGG - Intronic
1047188722 8:122658848-122658870 GACCCAAATCTGCCACAAACTGG + Intergenic
1048059567 8:130904042-130904064 GACCTATGCCTTCTACACACAGG - Exonic
1049182628 8:141230886-141230908 GAACCAGGCCTGCCCCACCCGGG + Intronic
1049224085 8:141441394-141441416 AACCCAAGCCTGGCACGCAGTGG - Intergenic
1049563125 8:143322799-143322821 CACACATGCATGCCACACACAGG + Intronic
1049563160 8:143323184-143323206 CACACACGCATGCCACACACAGG + Intronic
1058505573 9:105662674-105662696 GAGCAAAGCCTGCAACAAACGGG + Exonic
1059060331 9:111029481-111029503 TCCCCAAGCCTGTCACTCACTGG + Intronic
1060662043 9:125410345-125410367 GACCCAGGCCTGCCAATCAAAGG + Intergenic
1060943335 9:127555964-127555986 ACCCCAAGCCTGACACACATGGG + Intronic
1062426104 9:136506997-136507019 GGCCCAAGCCCGCCACACCCCGG + Intronic
1062488923 9:136794987-136795009 GACCCAAGCCAGCCCGACAATGG - Intronic
1185708849 X:2286210-2286232 GACCCAGGCCTCCAGCACACGGG + Intronic
1185708863 X:2286365-2286387 GGCCCAAGCCTCCAGCACACAGG + Intronic
1186573373 X:10739254-10739276 GATCCATGCCACCCACACACAGG - Intronic
1189707059 X:43769358-43769380 GCACCGAGACTGCCACACACTGG - Exonic
1192981666 X:76350774-76350796 CACCACAGCCTGCAACACACTGG + Intergenic
1200135573 X:153873067-153873089 GAACAAAGCCAGCCCCACACAGG + Intronic