ID: 948602884

View in Genome Browser
Species Human (GRCh38)
Location 2:239117279-239117301
Sequence AAGCATGCCCTGCTGCAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948602884 Original CRISPR AAGCATGCCCTGCTGCAGAC AGG Intronic
900519299 1:3097980-3098002 ACACCTGCCCTGTTGCAGACAGG - Intronic
900630775 1:3634019-3634041 AAGCATGCTCTGCTGCTGTGTGG + Intronic
900679647 1:3909754-3909776 GAGCATGGGCTGCTGCAGCCCGG + Intergenic
900811309 1:4803356-4803378 CAGCATCCCCAGCTGCAGGCAGG - Intergenic
902843853 1:19094035-19094057 AAGCAGGCCCTGGAGCACACTGG + Exonic
905001350 1:34672151-34672173 AAGGATGACCAGCTGCAGAGAGG + Intergenic
905295312 1:36950946-36950968 ATGCAGCCTCTGCTGCAGACTGG + Intronic
905869101 1:41392850-41392872 ATGCATGCCATGCAGCAGGCAGG + Intergenic
915903456 1:159862333-159862355 ACCCTTGCCCTGCTGCAGCCGGG - Intronic
919738381 1:200967927-200967949 GGGCATGGCCAGCTGCAGACTGG - Intergenic
920137065 1:203778506-203778528 CAGCATTCCCAGCTCCAGACTGG + Intergenic
920703463 1:208234974-208234996 ATGCAAGCCCTGTTGCAGCCAGG + Intronic
920857661 1:209675913-209675935 AAGCAAGCCCTGCAGGAGAAAGG + Exonic
923472362 1:234303393-234303415 CAGGGTGCTCTGCTGCAGACCGG - Intronic
1064527479 10:16272652-16272674 AAGATTGGCCTGTTGCAGACAGG - Intergenic
1069771789 10:70905155-70905177 AAGCACGGCCTCCTGCAGCCTGG + Intergenic
1069782974 10:70968444-70968466 CAGCATGCCCTGCGACAGATGGG - Intergenic
1070610081 10:77926832-77926854 GAGCATGCCCGGCTGGAGCCCGG - Intergenic
1073111343 10:101064740-101064762 AAGCATAGCCTTCCGCAGACTGG + Intronic
1075650901 10:124128023-124128045 AAGCAGGCCCTCCTGCTGGCGGG + Intergenic
1075772431 10:124950905-124950927 AATCATGGCCCGCTGCAGCCTGG - Intronic
1075844047 10:125530682-125530704 AACTCTGCCCTGCTGCTGACAGG - Intergenic
1076385016 10:130049445-130049467 AAGCATGGTGTGCGGCAGACCGG + Intergenic
1078020916 11:7655324-7655346 AAGCATGCCCTGGAGAAGCCAGG + Intronic
1078057102 11:8017921-8017943 ATGCCTGCCATGCTGAAGACAGG + Intergenic
1078089165 11:8253255-8253277 AAGCTTGCCCTGCTCCAGACAGG - Intronic
1078161071 11:8840156-8840178 CAGCATGCCCTTCTCCAGAGAGG + Intronic
1078849241 11:15149145-15149167 AAGCAGGCTTTGCTGCAGATTGG + Exonic
1078937717 11:15966217-15966239 AAGTATTTCCTGCTGCAGCCAGG + Intergenic
1079082785 11:17425472-17425494 AAGCTTGCCCTTCTGCTGATTGG + Intronic
1079447024 11:20566830-20566852 AATCATGTCTTGCTGCAGCCTGG - Intergenic
1080315167 11:30939164-30939186 AAGCAAGCCCTGCGGCAACCAGG - Intronic
1080688733 11:34537798-34537820 CAGCATCCCCTGCTGGGGACAGG + Intergenic
1080737665 11:35032848-35032870 AAGCATCCCCTCCAGCAGTCAGG - Intergenic
1080788090 11:35494232-35494254 AAGCCTGCCCTGGAGCAGAGTGG - Exonic
1080897830 11:36460990-36461012 AAGCATGCCCATCTGGAGATAGG - Intronic
1081602765 11:44506664-44506686 AAGGAGGCCCTGCTGGGGACCGG - Intergenic
1084659498 11:70538606-70538628 ATGCATTTCCTGCAGCAGACAGG - Intronic
1099942754 12:89209054-89209076 AATCATACTCTGCAGCAGACTGG + Intergenic
1102071122 12:110020655-110020677 CCGCATACCCTTCTGCAGACAGG + Intronic
1103025148 12:117567699-117567721 AACCAAGCCCTGCTGCAAAGGGG - Intronic
1106213235 13:27670242-27670264 AAGCATGCCCTTTTACACACAGG + Intergenic
1111898280 13:94168874-94168896 AAGTAGGCCCTGGTGAAGACTGG + Intronic
1112917504 13:104569615-104569637 AAGCATGTCCTGGTACAGGCTGG - Intergenic
1112994555 13:105557143-105557165 CAGAATGCCCTGGTGCAGACTGG - Intergenic
1113299287 13:108999000-108999022 AAGCATGCCCAGGTTCAGAGAGG + Intronic
1113581658 13:111434404-111434426 AAGCATGACCTGCTCGAGAATGG + Intergenic
1114497547 14:23143416-23143438 CAGCATGCCCTGCTGAGGGCTGG + Intronic
1116188291 14:41628536-41628558 AATCATGGCTTGCTGCAGCCTGG - Intronic
1116955032 14:50914600-50914622 AAGCCAGCCCTGCTGCAGACTGG + Intronic
1119020599 14:71108853-71108875 AGGCAGGCCGTGCTGCACACAGG - Exonic
1120871278 14:89339487-89339509 ACGCTTGCCCTGGTGCAGACGGG - Intronic
1121101780 14:91254357-91254379 AAGCCATCCCTGCGGCAGACAGG - Intergenic
1122592094 14:102861031-102861053 AAGCATTGCCTGCAGCAGGCTGG + Intronic
1123003867 14:105312070-105312092 CAGCAGGCCCTGCTGAAGTCGGG - Exonic
1128565827 15:68699979-68700001 AGGCATCCCCCGCTGCAGCCTGG + Intronic
1130183193 15:81651906-81651928 CAGGATGACCTGCTGCAGAAAGG + Intergenic
1134227153 16:12399980-12400002 ACCCATGTCCTGCTGCAGGCTGG + Intronic
1134895255 16:17880617-17880639 AAACATGCCCTGATGAAGATAGG + Intergenic
1136186932 16:28593804-28593826 GAGCATGCCTTGCTCCAGATCGG - Intronic
1136189517 16:28607313-28607335 GAGCATGCCTTGCTCCAGATTGG - Intronic
1139044520 16:63040437-63040459 AAGCATGCCCTGCTCCCTGCAGG + Intergenic
1141474218 16:84261508-84261530 AAGGATGCCAAGCTGCAGAGAGG + Intergenic
1141819156 16:86433062-86433084 AATCATGCTCAGCTGCAGGCAGG + Intergenic
1143864037 17:9911181-9911203 CAGCATCACCTGCAGCAGACGGG - Intronic
1145992333 17:29086597-29086619 AAGCTAGCCCTCCTGCAAACTGG - Intronic
1146691367 17:34878365-34878387 AAACATGCACTGCTCCAGGCTGG - Intergenic
1147955766 17:44133453-44133475 AACCATGCCCTTTTACAGACAGG - Intergenic
1151353545 17:73545524-73545546 AAACATGCCCTGCCGCAAGCAGG + Intronic
1151539020 17:74755243-74755265 AAGGATGCCCTGCTAGGGACAGG - Intronic
1151748226 17:76022844-76022866 CAGAATGCCCTGCTCCAGCCGGG + Intronic
1152702361 17:81825395-81825417 CAGCCTGCCCTGCTCCAGAGGGG + Exonic
1157546094 18:48547493-48547515 AACCAAGCGCTGCTGCAGTCAGG - Intronic
1160788013 19:910633-910655 AAGCATCCTCTGCTCCAGCCTGG + Intronic
1162504543 19:11075394-11075416 AATCATGGCTTGCTGCAGCCTGG - Intergenic
1163136910 19:15318507-15318529 AAGCATGTCATGCTGAAGAATGG + Intronic
1163648529 19:18503798-18503820 GAGCCTTCCCTGCTGCAGGCTGG + Intronic
1164315246 19:24081673-24081695 GAGCATACCCTGGTGAAGACTGG + Intronic
928252973 2:29697916-29697938 CAGCTGGCCCTGCTGCAGAGTGG + Intronic
928432730 2:31234236-31234258 AAGCATCCCTTGCTGCACGCAGG + Intergenic
929305369 2:40355390-40355412 AGGGATGCCCTGCAGAAGACAGG + Intronic
931962853 2:67501224-67501246 ATGCATGCCATGCTGCATATGGG - Intergenic
933786056 2:85842671-85842693 AAGAATGCCCTTCTTCAGAGGGG - Intronic
935472773 2:103479783-103479805 AAGCATTCCCTGCAGCAGGCTGG + Intergenic
936348847 2:111697274-111697296 CACCATGCCCAGCTGGAGACTGG - Intergenic
940383648 2:153045254-153045276 AAGCATGGACTTCTGCAGAATGG + Intergenic
940499307 2:154474726-154474748 AAGCATTGCCTGCAGCAGGCTGG + Intergenic
943571658 2:189581367-189581389 AGGCATTCTCTGCTGCAGGCGGG - Intronic
948602884 2:239117279-239117301 AAGCATGCCCTGCTGCAGACAGG + Intronic
949077937 2:242073285-242073307 AAGAAGGCCCTGCTGCAGGGTGG + Intergenic
1169445992 20:5671515-5671537 CACCATGCCCTGCTCCAGATTGG + Intergenic
1171349450 20:24491515-24491537 CAGCATGCCCTGCTGCAGGAGGG + Intronic
1171362535 20:24598152-24598174 AGAAATGCGCTGCTGCAGACGGG + Intronic
1173401149 20:42727098-42727120 AAGACTGCCCTGCTGCTGACAGG + Intronic
1173561106 20:44006298-44006320 AAGCCTGCCCTCCTGGAGAATGG - Intronic
1174338460 20:49881317-49881339 AAGCACGCCCAGCTGCATCCCGG - Intronic
1175489346 20:59368933-59368955 AAGCATTGCCAGCTGAAGACGGG - Intergenic
1176112962 20:63418832-63418854 AAGCATGCACGGATGCAGATAGG + Intronic
1179509856 21:41865266-41865288 AAGCATGCCACGCTGTGGACAGG - Intronic
1180835866 22:18929100-18929122 AAGCAGGCCATGCTGCAGTGTGG + Intronic
1184244337 22:43228332-43228354 GAGCATGCACTGCTGGAGCCGGG - Intronic
1184384378 22:44166006-44166028 AAGCACCCCATGCTGCAGATAGG - Intronic
1203285957 22_KI270734v1_random:154399-154421 AAGCAGGCCATGCTGCAGTGTGG + Intergenic
952167378 3:30765591-30765613 AAGCATGCCCTTCTGAGGGCAGG - Intronic
955101683 3:55855949-55855971 AAGAATGGACTGCTGCAGCCTGG - Intronic
956848023 3:73201909-73201931 AAGCCTTCCCAGCTGCAGAATGG + Intergenic
957027454 3:75198925-75198947 AGGCATGCGCCGCTGCAGCCGGG + Intergenic
959020064 3:101179111-101179133 AGGCATGCCCTGCTACTCACTGG - Intergenic
960139594 3:114139421-114139443 AATCATGCACTGCTGGACACAGG + Intronic
960299382 3:115983453-115983475 AATCATGGCTTGCTGCAGCCTGG - Intronic
960950840 3:122997525-122997547 CAACATGCCCTGGTGGAGACGGG - Intronic
961184853 3:124905840-124905862 AATCATGCCCTCCCGAAGACTGG - Exonic
962391835 3:134978644-134978666 AAGCAAGGCCTACTACAGACAGG - Intronic
964191262 3:154003792-154003814 AAGTCTGCACTGCTGCAGCCAGG + Intergenic
965495114 3:169388656-169388678 TAGCATGTCCTGCTCCAGAGGGG + Intronic
968359596 3:198137876-198137898 AGCCATGCCCTGCTGAAGCCTGG + Intergenic
970265075 4:14273573-14273595 AAGCATGCTCTGCTGGACAGTGG - Intergenic
970674484 4:18433035-18433057 GAGCTTCTCCTGCTGCAGACAGG + Intergenic
974813617 4:66977706-66977728 AAGCATGCCCTGCTTTCCACTGG - Intergenic
976764879 4:88589721-88589743 AAGCATGTCCTGCTTCAAAATGG - Intronic
977593080 4:98848609-98848631 AAGCATTGCCTGCAGCAGAGTGG + Intergenic
985627210 5:995274-995296 AACAATGCCCTCCTGCAGGCAGG - Intergenic
987963257 5:24837975-24837997 AAGCATTACCTGCTTAAGACAGG - Intergenic
989719646 5:44509515-44509537 AGGCATGCCCTGCAGAGGACAGG + Intergenic
990503608 5:56422922-56422944 CAGCTTGCCCTGGGGCAGACAGG - Intergenic
990871701 5:60438976-60438998 AAGCATGCACTGTTGGAGATAGG + Intronic
992389737 5:76319273-76319295 AAGCTTGCACTGCCGCACACGGG - Intronic
992614061 5:78532968-78532990 AACCCTGTCGTGCTGCAGACTGG + Intronic
992621062 5:78593530-78593552 AACCATGACCTTCTGGAGACAGG - Intronic
993260159 5:85647506-85647528 AAGCAGGCACTGCGGCAAACAGG - Intergenic
995183855 5:109252165-109252187 AAGCATGCCCTGGAGAAGATAGG + Intergenic
995895384 5:117005262-117005284 AAGCATGGCCTACAGCAGAGTGG + Intergenic
997260841 5:132464549-132464571 CTCCATGCCCTGCTGCAGACAGG - Exonic
999664212 5:153895814-153895836 CAGCATGTCATGTTGCAGACTGG + Intergenic
1001721527 5:173860770-173860792 AGCCAGGCCCTGCTGCAGCCAGG + Intergenic
1001913430 5:175540162-175540184 AAGGCTGCCCTCCTGCAGAGAGG - Intergenic
1003467725 6:6397392-6397414 AAGCATGGCCAGCTACAGATGGG + Intergenic
1003487178 6:6589831-6589853 CATCATGCCCTGCTGGAGATAGG - Intronic
1003796902 6:9614950-9614972 ACGCATGTGCTGCTGCAGAATGG + Intronic
1006134678 6:31888315-31888337 TAGCATGCCCTGTGGCAGAGGGG - Intronic
1006361408 6:33589349-33589371 AGGGCTGCCCTGCTGCAGAGTGG + Intergenic
1006752364 6:36386828-36386850 AAGCTTGCCTTGCTGGAGAAGGG + Intronic
1006798600 6:36745672-36745694 AAGCATGCACTGCTTCAGGATGG - Intronic
1007263030 6:40577003-40577025 AAGCATTCCCTCCTCCAGTCTGG + Intronic
1012052248 6:94361191-94361213 CAGGATGACCAGCTGCAGACAGG - Intergenic
1017759988 6:157561229-157561251 AAGCATGCCTTGCTGGGGTCAGG + Intronic
1019157929 6:170051495-170051517 AAGCCTGCGCTGATGCAGGCCGG + Intergenic
1019713386 7:2527446-2527468 AAGCAGGCCCTGCAGCCCACTGG - Exonic
1023586983 7:41741294-41741316 CAGCTGGCCCTGCTGCAGACTGG - Intergenic
1028373683 7:90121855-90121877 TATCAAGCCCTGCTGCAGAGAGG + Intergenic
1029832657 7:103277828-103277850 TATCAAGCCCTGCTGCAGAGAGG - Intergenic
1030232696 7:107224727-107224749 AATAATGCCATGCTGCAGAGAGG + Intronic
1032201873 7:129827854-129827876 AAACATGCCCTCCTCCAGAGAGG - Intergenic
1032517905 7:132520573-132520595 AAATATTCCCTTCTGCAGACTGG + Intronic
1032863788 7:135905785-135905807 AAACCTGCCCTTCTGCAGAAAGG + Intergenic
1035624029 8:1058364-1058386 GAGCATGGCCTGCAGCAGTCAGG - Intergenic
1036208758 8:6825227-6825249 TTGGAGGCCCTGCTGCAGACTGG - Exonic
1045242739 8:100416679-100416701 AAGCACACTCTGCTGCAGAGGGG - Intergenic
1046462697 8:114562888-114562910 AAGAATGCCATGCCCCAGACAGG + Intergenic
1046666426 8:117008734-117008756 AAGCATGACCTGAAGCAGAAGGG - Intronic
1047770184 8:128024559-128024581 AATCATGGCTTGCTGCAGCCTGG - Intergenic
1049246038 8:141563134-141563156 AGGCATGCCCGGCTGCAGGCAGG + Intergenic
1049696134 8:143985160-143985182 AAGCATGCTCTCCTGAGGACCGG - Exonic
1053160109 9:35808240-35808262 GTCCATGTCCTGCTGCAGACAGG + Exonic
1056090336 9:83199386-83199408 TAGCAATCCCTGCTACAGACAGG - Intergenic
1056914052 9:90729721-90729743 AAGCATGGCTGGCTGCAGTCCGG - Intergenic
1057168948 9:92949402-92949424 ACGGACGCCCCGCTGCAGACTGG - Intronic
1058812561 9:108655349-108655371 AGGGGAGCCCTGCTGCAGACAGG + Intergenic
1061589531 9:131589592-131589614 GAGCACGGCCTGCTGGAGACTGG + Intronic
1061637158 9:131919409-131919431 AAGCATGACATGCTGCAGGCTGG + Intronic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1062088490 9:134661376-134661398 ACACACGCCCTGCTGCAAACTGG - Intronic
1062107354 9:134763237-134763259 AGGCATTCCCTTCTGCAGCCAGG + Intronic
1062154682 9:135040154-135040176 AAGCATCCCCTGCTGGATTCTGG - Intergenic
1062521061 9:136958128-136958150 AGCCATCCCCTGCTGCAGCCAGG - Intergenic
1062616349 9:137398246-137398268 AGGCGTGCAGTGCTGCAGACGGG - Intronic
1189568465 X:42269821-42269843 AATGATGACCTTCTGCAGACTGG + Intergenic
1191057886 X:56262146-56262168 ATTGAAGCCCTGCTGCAGACAGG + Intronic
1201406207 Y:13652721-13652743 ATGCATGCTCTGGTGGAGACTGG - Intergenic
1202336780 Y:23820342-23820364 AAGCAAGCTATGCTGCAGATTGG + Intergenic
1202533985 Y:25849729-25849751 AAGCAAGCTATGCTGCAGATTGG - Intergenic