ID: 948604043

View in Genome Browser
Species Human (GRCh38)
Location 2:239123516-239123538
Sequence CAGGCTCAGGATTGAGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 320}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948604043_948604046 -9 Left 948604043 2:239123516-239123538 CCATCTCCTCAATCCTGAGCCTG 0: 1
1: 0
2: 4
3: 33
4: 320
Right 948604046 2:239123530-239123552 CTGAGCCTGCAGCCCCATGATGG 0: 1
1: 0
2: 3
3: 26
4: 297
948604043_948604053 14 Left 948604043 2:239123516-239123538 CCATCTCCTCAATCCTGAGCCTG 0: 1
1: 0
2: 4
3: 33
4: 320
Right 948604053 2:239123553-239123575 CTCACACACTAGGATGGATTTGG 0: 1
1: 0
2: 0
3: 8
4: 101
948604043_948604055 25 Left 948604043 2:239123516-239123538 CCATCTCCTCAATCCTGAGCCTG 0: 1
1: 0
2: 4
3: 33
4: 320
Right 948604055 2:239123564-239123586 GGATGGATTTGGGCCACAGCCGG 0: 1
1: 0
2: 0
3: 19
4: 184
948604043_948604050 4 Left 948604043 2:239123516-239123538 CCATCTCCTCAATCCTGAGCCTG 0: 1
1: 0
2: 4
3: 33
4: 320
Right 948604050 2:239123543-239123565 CCCATGATGGCTCACACACTAGG 0: 1
1: 0
2: 4
3: 18
4: 147
948604043_948604054 15 Left 948604043 2:239123516-239123538 CCATCTCCTCAATCCTGAGCCTG 0: 1
1: 0
2: 4
3: 33
4: 320
Right 948604054 2:239123554-239123576 TCACACACTAGGATGGATTTGGG 0: 1
1: 0
2: 0
3: 10
4: 143
948604043_948604052 8 Left 948604043 2:239123516-239123538 CCATCTCCTCAATCCTGAGCCTG 0: 1
1: 0
2: 4
3: 33
4: 320
Right 948604052 2:239123547-239123569 TGATGGCTCACACACTAGGATGG 0: 1
1: 0
2: 1
3: 11
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948604043 Original CRISPR CAGGCTCAGGATTGAGGAGA TGG (reversed) Intronic
900462315 1:2807592-2807614 GAGGCTCAGGGTGCAGGAGAGGG - Intergenic
901093169 1:6657094-6657116 GAGGTTCAGGATCAAGGAGAGGG - Intronic
901138261 1:7011542-7011564 CTGGGTCTGGAATGAGGAGAGGG - Intronic
903459461 1:23510240-23510262 CAGGCTAAGGAGAGAGAAGAAGG - Intronic
903523934 1:23978146-23978168 AAGGATCAGGCTTGAAGAGAAGG - Intronic
903742517 1:25566565-25566587 CATGCCCAGGAAAGAGGAGAAGG - Intronic
904311618 1:29632863-29632885 CAGGAGGAGGACTGAGGAGATGG - Intergenic
904638881 1:31906660-31906682 CTGGTTCTGTATTGAGGAGAAGG - Exonic
905961360 1:42045124-42045146 CAGGCTCAAGATCATGGAGATGG + Intergenic
906076889 1:43058544-43058566 GAGGCTCAGGATTGCTGAGCTGG + Intergenic
906542352 1:46597074-46597096 GAGGTACAGGAATGAGGAGAGGG - Intronic
907384496 1:54117296-54117318 CATGCTCAGGTTTGAGGCCAAGG + Intergenic
907670702 1:56472710-56472732 CAGGCTCAGGGTAGGGGTGAGGG - Intergenic
907801463 1:57769866-57769888 CAGCCTCAGGACACAGGAGAAGG - Intronic
909992853 1:82244354-82244376 CAGACACAGGATAGAGGACACGG - Intergenic
910161457 1:84276737-84276759 CAGGCACAGGCAAGAGGAGATGG + Intergenic
911097496 1:94066673-94066695 CAGGCTCAGCACTGAAGACACGG - Intronic
913975206 1:143450257-143450279 CAGGTTCAGGATGGAGGCGGTGG + Intergenic
914069599 1:144275873-144275895 CAGGTTCAGGATGGAGGCGGTGG + Intergenic
914109556 1:144690481-144690503 CAGGTTCAGGATGGAGGCGGTGG - Intergenic
915632150 1:157160991-157161013 CAGGCTCAGGACTGGGGACAGGG - Intergenic
915737844 1:158095816-158095838 CTGGCCCAGCATGGAGGAGAAGG - Intronic
915981225 1:160421024-160421046 CAGGAACAGGATAGAGGAGATGG - Intronic
917238164 1:172917144-172917166 CAGGCAAAGGAGAGAGGAGAAGG - Intergenic
918048834 1:180956940-180956962 AAGGCTGAGGAGTGGGGAGAGGG - Intergenic
918056145 1:181023237-181023259 CACCCTCAAGCTTGAGGAGAGGG - Intergenic
921650753 1:217674880-217674902 TAGGCACAGGATAGGGGAGAGGG + Intronic
921780483 1:219157179-219157201 GAGGCTCAGAATACAGGAGATGG - Intergenic
922533933 1:226365878-226365900 CAGGCCCAGGTTGGAGGAGTGGG + Intronic
923850067 1:237784727-237784749 CAGGATGAGGTTAGAGGAGATGG + Exonic
1063121209 10:3106655-3106677 CAGGGGCAGGGGTGAGGAGAGGG - Intronic
1063121230 10:3106709-3106731 CAGGGGCAGGGGTGAGGAGAGGG - Intronic
1063309503 10:4938927-4938949 CAGGGTCAGAATTCAAGAGAGGG - Intronic
1063812168 10:9723680-9723702 AAAGCTCAGGATTGAAGATATGG - Intergenic
1065451972 10:25868750-25868772 CAGGCTCTGGAGTTAGGACATGG + Intergenic
1066358738 10:34710484-34710506 GTGGCACAGGATTGAAGAGATGG - Intronic
1067328575 10:45293068-45293090 CAGGCTCAGAGTTGCAGAGATGG + Intergenic
1067785318 10:49241578-49241600 CAGGCTCAGGACTGAGAGCAAGG + Intergenic
1068401751 10:56536721-56536743 CAGAATCAGGATTGAGTAGAGGG + Intergenic
1068569669 10:58615641-58615663 CAAGCTGAGGACTGAGGAGTGGG - Intronic
1068716890 10:60198686-60198708 AATGCTCAGAAATGAGGAGATGG + Intronic
1069768988 10:70885893-70885915 CAGGCTGAGCGCTGAGGAGAGGG - Exonic
1070530723 10:77335074-77335096 CAGGCACAGGAGTGTGGAGAAGG + Intronic
1072246530 10:93548590-93548612 TAGGGTCAGGGTTGGGGAGAGGG - Intergenic
1074133200 10:110602564-110602586 CAGTCTCAAGATGAAGGAGAAGG + Exonic
1074272569 10:111969524-111969546 TAGGCACTGAATTGAGGAGATGG - Intergenic
1074564159 10:114561906-114561928 CAGGCTCAGGAGGGAAAAGATGG + Intronic
1075119902 10:119657133-119657155 CTGGGTCTGGATTTAGGAGATGG + Intronic
1075253990 10:120909773-120909795 CAGGCTCAGGAGGGAAAAGATGG - Intergenic
1075966273 10:126614470-126614492 TAGCTTCAGGATTGAGCAGAAGG - Intronic
1076379573 10:130015794-130015816 CAGGCTGGGGATTGGGGAGCAGG + Intergenic
1076602385 10:131667207-131667229 CAGGCTGAGGCTTGTGGGGAGGG + Intergenic
1076834468 10:133014194-133014216 GAGGCTCAGGTGGGAGGAGAAGG + Intergenic
1077054956 11:586982-587004 CAGGCTCAGCTTAGAGGAGCTGG + Intronic
1077065090 11:637510-637532 CAGGCTCACGATGAAGGAGTTGG - Exonic
1077480780 11:2813471-2813493 CAGGCGCAGGGTTGAGGAAGGGG - Intronic
1077563457 11:3280932-3280954 AGGGCTCAGGAATGAGGAAAAGG - Intergenic
1077569349 11:3326747-3326769 AGGGCTCAGGAATGAGGAAAAGG - Intergenic
1078477225 11:11641275-11641297 CAAGCTCAGTATTGAGGAGTCGG + Intergenic
1083331664 11:61901296-61901318 CAAGCTGGGGATTGAGGACAGGG - Intronic
1083631362 11:64097163-64097185 CAGGCTCAGGATGCTGCAGAGGG - Intronic
1083744217 11:64726294-64726316 CAGGCTCAGGAGGGAAGAGCTGG + Intergenic
1083823994 11:65188128-65188150 TGGACTCAGGATTGAGCAGAGGG + Intronic
1087360521 11:97152753-97152775 CAAGTTCATGATTGAGGGGAAGG + Intergenic
1088781329 11:113136778-113136800 AAGGCTCAGGATTAAGGAATTGG - Intronic
1089111312 11:116059866-116059888 CCAGTTCAGGATTGAGGAGCAGG + Intergenic
1089712310 11:120324745-120324767 CATCCTCAGGATCGAGGAAAGGG + Intergenic
1090400839 11:126447347-126447369 AAGGCTGAGGCTGGAGGAGATGG - Intronic
1091027820 11:132157882-132157904 CGTGCTCAGGATTGAGGAAGAGG - Intronic
1091248564 11:134121737-134121759 CTGGTTCTGTATTGAGGAGAAGG - Intronic
1091535732 12:1407189-1407211 CTGGCTTAGGGTTGAGGAGAAGG + Intronic
1091743547 12:2976725-2976747 CAGGCTGAGAGCTGAGGAGATGG + Intronic
1093267907 12:17024585-17024607 CAGGCTTTGGATTGGGAAGAAGG + Intergenic
1093671879 12:21886270-21886292 GAGGCTGAGAAATGAGGAGATGG - Intronic
1093717095 12:22395308-22395330 CAGGCTGAGCCTTGAGGATAAGG - Intronic
1096002592 12:48141874-48141896 CAAGGGCAGGATTGGGGAGAGGG - Intronic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1096578541 12:52569797-52569819 CAGGCTCTGGGATGAGGAAATGG - Intronic
1096761465 12:53845426-53845448 CAGGATCAGGATTAAAGATAAGG - Intergenic
1097831782 12:64232610-64232632 CAGGGGCAGGATTGGGCAGAGGG - Intergenic
1099365033 12:81758452-81758474 CAGTCTCCGGCTTGAGGAGAAGG + Exonic
1100263408 12:92953741-92953763 CAGGACCAGCATTGAGGAAATGG + Intergenic
1100401191 12:94231601-94231623 CAGGGTCAGGATACAGGAGTAGG - Intronic
1101793896 12:107955376-107955398 CAGTCTCAGGAGGGAGGAAAGGG + Intergenic
1101881828 12:108630901-108630923 CAGGCCCAGGATTCAGCCGATGG + Intronic
1102574581 12:113848230-113848252 CAGGCTAAAGAGTGGGGAGAAGG + Intronic
1102601926 12:114037751-114037773 CAGGCTCATGAGTGATGAGGGGG - Intergenic
1102760093 12:115377356-115377378 AAGGCTCAGGCTTGGGGAAAAGG - Intergenic
1102807780 12:115797030-115797052 CTGGCTAAGAATTGAGGACAGGG + Intergenic
1105014433 12:132777494-132777516 GAGGCTCAGGATTCTGGAGACGG + Intronic
1105255394 13:18741052-18741074 CAGACCCAGGGTTGAGGACAGGG + Intergenic
1105418716 13:20234137-20234159 CAGGTGCAGGATTGAGAACAGGG - Intergenic
1105699927 13:22927843-22927865 CAGGCTCAGGCTGGGAGAGAGGG + Intergenic
1105821854 13:24087197-24087219 CAGGGTCTGGAGTGAAGAGAGGG + Intronic
1105852734 13:24350027-24350049 CAGGCTCAGGCTAGGAGAGAGGG + Intergenic
1106286301 13:28320862-28320884 TAGGCTGAGGGTTAAGGAGAAGG + Intronic
1107043639 13:35973770-35973792 CAGGTTAAGGATGGAGAAGATGG + Intronic
1107979507 13:45720992-45721014 CAGGGTCAGGCTTCTGGAGATGG + Intergenic
1108041617 13:46344482-46344504 CAGGGTTTGGATAGAGGAGATGG - Intronic
1108206375 13:48094654-48094676 GGGGCTCAGCATTGGGGAGACGG - Intronic
1108601369 13:51998028-51998050 CAGGGTCAGGTGTGAGGAAAGGG - Intronic
1108908692 13:55514527-55514549 CAGGCTTAGGAGTAAGCAGAGGG + Intergenic
1110015974 13:70404412-70404434 CAGGCTCATGATTGCTGAAATGG + Intergenic
1110285936 13:73750464-73750486 GGGCCTCAGGCTTGAGGAGAAGG + Intronic
1111764802 13:92514635-92514657 CAGGCTCTGGATTGGGCAAATGG - Intronic
1113342526 13:109440901-109440923 GAGCCTCAGGATAGAGGGGATGG + Intergenic
1116624945 14:47252728-47252750 CTGGCAAAGGAGTGAGGAGAAGG + Intronic
1117046900 14:51822030-51822052 CAGGGTCAGGATTGAGGTCTGGG - Intergenic
1120064182 14:80020342-80020364 CAGGCTCAGGATTAGGGATTGGG - Intergenic
1122089080 14:99326265-99326287 CAGGCAGAGGAGAGAGGAGAGGG - Intergenic
1122660784 14:103293630-103293652 CAGACACAGGATGGAGGGGAGGG - Intergenic
1124196206 15:27632097-27632119 AAGGCACAAGATTGGGGAGAAGG - Intergenic
1124689280 15:31808431-31808453 CAGGCTCTGGAAAGAGGAGAAGG + Intronic
1124720672 15:32108597-32108619 CGGGCTCAGGATTGTGGACCTGG + Intronic
1125200220 15:37096135-37096157 CAGGCTCAGGGATGGGGAGGAGG + Intronic
1125605757 15:40938836-40938858 CAGGCTCGAGGTTGTGGAGATGG - Exonic
1127629989 15:60819442-60819464 CAGGCCCAGGAATGAAGAAAAGG - Intronic
1128467419 15:67924598-67924620 GAGGCCCAGGGTTGAGGAGGAGG - Intergenic
1129652089 15:77498206-77498228 CAGGCTCAGGGCTGAGGATCCGG - Intergenic
1130048033 15:80461274-80461296 CAGACTCAGGGTTGAGGATTAGG + Intronic
1132085771 15:98907275-98907297 CAGGCTGAGGATTGACCAGCTGG + Intronic
1132659528 16:1055192-1055214 CAGGCTCAGGCCCGAGGACAGGG - Intergenic
1132709168 16:1258868-1258890 GAGGCTCAGGATGGAGGAGGGGG - Exonic
1132890620 16:2202622-2202644 CAGGCCCAGGAGTCTGGAGAGGG + Intergenic
1133414535 16:5596080-5596102 CAGGCTCAGGGATGTGGAGAGGG + Intergenic
1134168742 16:11951553-11951575 CTGGTTCTGTATTGAGGAGAAGG - Intronic
1134598002 16:15511225-15511247 CAGGCTGTGGCTTGGGGAGAGGG - Intronic
1136548317 16:30967594-30967616 CAGGGTCAGGCATAAGGAGAAGG + Intronic
1137019982 16:35415078-35415100 CGGGGTCAGTATGGAGGAGAGGG - Intergenic
1137830513 16:51539213-51539235 CAGGCACAGGATGGGGGAGAGGG + Intergenic
1138210432 16:55158539-55158561 CAGGCTCAGGGATTAGGATATGG + Intergenic
1140124958 16:72111151-72111173 CAGGGTCAGGATTTATGGGAAGG + Intronic
1141429139 16:83961888-83961910 CAGGCTCAGAATAGAGGAAAGGG - Intronic
1141706055 16:85665320-85665342 CGGGCTCAGAGTTGAGGGGAGGG + Intronic
1141783478 16:86181587-86181609 CAGGCTGAGGGTTGGGGAGCTGG - Intergenic
1142675659 17:1511726-1511748 CAGGGTCAGGATTGAAGCAAGGG + Intronic
1142867553 17:2799880-2799902 CAGGCTGGGGATGGAGGAGCTGG + Intronic
1144338719 17:14296029-14296051 ATGGCTCAGGGATGAGGAGATGG + Intergenic
1144617393 17:16789014-16789036 CAGGGTCAGAAATGTGGAGAGGG - Intronic
1145001539 17:19308548-19308570 CAGCATCAGGATGGAGGGGAAGG + Intronic
1145136912 17:20417563-20417585 CAGGGTCAGAAATGTGGAGAGGG - Intergenic
1146728023 17:35171295-35171317 AAGGCACAGGGTTGGGGAGAGGG - Intronic
1147134645 17:38428132-38428154 CAGGCCCAGGAAAGAGGACAAGG - Intergenic
1147311696 17:39599449-39599471 CCGGCTCAGGCTTGAGGGGTTGG + Intergenic
1147510982 17:41068698-41068720 CAGGCTGATGCTGGAGGAGAAGG + Intergenic
1148071959 17:44913874-44913896 AAGGCTGAGGAATGGGGAGAAGG - Intronic
1148997645 17:51725227-51725249 CAGGCCAAGGATTGATGAGTGGG + Intronic
1149536635 17:57438420-57438442 CTGGCTCAGGAAGGAGGGGATGG - Intronic
1149536962 17:57440736-57440758 CAGGGTAAGGACTGAGGAGGTGG + Intronic
1152028080 17:77824635-77824657 CAGGGCCAGGAATGAGGAGAAGG + Intergenic
1152247370 17:79192083-79192105 CAGGATCAAGAGGGAGGAGACGG - Intronic
1152446227 17:80345970-80345992 CAGGGTTAGTATGGAGGAGACGG + Exonic
1152804663 17:82349601-82349623 GAGGCTCAGGAATGAGGGGGAGG - Intergenic
1153112417 18:1607967-1607989 CTGACTCAAGATTGAGCAGAAGG + Intergenic
1157675105 18:49562733-49562755 CAGGTTCAGGCATGAGGACAAGG - Intronic
1158855525 18:61540089-61540111 CAGGAGCAGAATGGAGGAGATGG - Intronic
1160385944 18:78496313-78496335 CAGGCTCAGGTTTGCCAAGATGG - Intergenic
1160698749 19:496633-496655 GGGGCTCAGGAGAGAGGAGAGGG + Intronic
1160749521 19:727345-727367 CAGGGTCAGGATTGAGGTTGGGG - Intronic
1161927651 19:7313068-7313090 CAGGCCCAGGATAGAGGGGAAGG - Intergenic
1161952828 19:7477250-7477272 CATGCTGAGGATTGAGGAGATGG + Exonic
1162389328 19:10379959-10379981 CAGGCCCTGGATTGGGGGGATGG - Intronic
1163102929 19:15108558-15108580 CGTGCTCAGGAGTGAGGAGCTGG - Intronic
1164467314 19:28498695-28498717 CAGGGTCAGGATAGGGGAGCAGG + Intergenic
1164588380 19:29491930-29491952 GAGGCAGAGGATTGAGGAAAGGG - Intergenic
1165246512 19:34501007-34501029 CACGCTCAGGAGCGATGAGAGGG + Exonic
1165376743 19:35448422-35448444 CAGGATCAGGTTTGAGGGGAAGG + Intronic
1166361806 19:42255629-42255651 CAGGCTCAGGGTTGGGGGGTTGG - Intergenic
1167234094 19:48303439-48303461 CAGGCCCAGGAGTTAGGAGGGGG + Intronic
1167720019 19:51172877-51172899 CAGGGTCAGGATGGAGAAAAGGG - Intergenic
1168219830 19:54952652-54952674 AGGGCTGAGGAATGAGGAGATGG - Intronic
1168227883 19:55009674-55009696 GAGGCTTTGGGTTGAGGAGAAGG + Intergenic
1168254829 19:55159579-55159601 CAAGCTCAGGGATGAGAAGATGG + Exonic
1168482864 19:56736250-56736272 CAGGCTCAGGATTGACTACCTGG - Intergenic
925092236 2:1164792-1164814 CAGGCTCTGTGTAGAGGAGAGGG + Intronic
926796146 2:16620768-16620790 CAGTCTCAGGAGGGAGGTGAAGG + Intronic
928353194 2:30582189-30582211 CAGGGGCAGGGGTGAGGAGAGGG - Intronic
929269366 2:39956740-39956762 TAGGCTCAGAATTGTGGAGGCGG + Intergenic
929424380 2:41829142-41829164 CATGCTCAGGACTGAGCTGAAGG - Intergenic
929785549 2:44988264-44988286 CAGGATCAGGAGTGAGGGGTGGG + Intergenic
929964220 2:46521525-46521547 CAGACTGAGGAAGGAGGAGAAGG + Intronic
930989149 2:57629689-57629711 AAGGCTCAGCACTGAGGATATGG + Intergenic
931114985 2:59155697-59155719 CAATCACAGGATTTAGGAGATGG - Intergenic
931651509 2:64473006-64473028 CAGGCACTGGTTTGAAGAGATGG + Intergenic
931929170 2:67109765-67109787 CAGGCTCAAGACAGAAGAGAAGG - Intergenic
932090093 2:68798829-68798851 CAGGCTCTGGAGTGAGGGGAGGG + Intronic
934179906 2:89611230-89611252 CAGGTTCAGGATGGAGGCGGTGG + Intergenic
934290202 2:91685491-91685513 CAGGTTCAGGATGGAGGCGGTGG + Intergenic
934774149 2:96926637-96926659 CAGTCTCATCATTGAGCAGAGGG + Intronic
935008162 2:99102294-99102316 CAGTCTCAAGATGAAGGAGAAGG + Intronic
936684639 2:114813494-114813516 TAGGCACAGGATTGTTGAGAAGG - Intronic
938228623 2:129638831-129638853 CAGGCCCATGATTGAGGAAGAGG - Intergenic
938228938 2:129641095-129641117 CAGGTCCACGATTGAGGAAAAGG + Intergenic
938308188 2:130268532-130268554 CAGGCTCGGGAAGGAGCAGAGGG - Intergenic
943339645 2:186664546-186664568 AAGGCTCAGAATCAAGGAGAAGG + Exonic
944191635 2:197010037-197010059 CAGGAGCAGGATGGAGGAGGAGG + Intronic
944571710 2:201051883-201051905 TAGGCTCATGATTGAGGATTGGG - Intronic
944894379 2:204149472-204149494 AAAGTTCAGGATGGAGGAGAAGG + Intergenic
947745778 2:232506648-232506670 GAGGCTCAGGATCAAGTAGAGGG - Intergenic
947795484 2:232891397-232891419 CAGGATGAGGAAGGAGGAGAAGG + Exonic
947830232 2:233134374-233134396 CAGGCTCAAGATTTAGAGGAGGG + Intronic
948183062 2:235998375-235998397 CAGGAACAGGAGTGAGAAGATGG + Intronic
948604043 2:239123516-239123538 CAGGCTCAGGATTGAGGAGATGG - Intronic
1168779592 20:477526-477548 CAGGGGCAGGATTGAGGTGGTGG - Intronic
1169470588 20:5881818-5881840 CAGTCTCAGAAATGTGGAGAGGG - Intergenic
1171077471 20:22143141-22143163 AATGCTCAGGTATGAGGAGAAGG - Intergenic
1172842720 20:37911711-37911733 CAGGCACAGGGTGGGGGAGAGGG - Intronic
1173433263 20:43010200-43010222 CAGGCTGATGATTGGGGGGATGG - Intronic
1174175917 20:48644843-48644865 CAGGCTGGGGGCTGAGGAGACGG - Intronic
1174704886 20:52645004-52645026 CACTCTCAGGATTCAGGTGAGGG + Intergenic
1175004582 20:55668651-55668673 CAGGTTCAGGAATGAGGCTAAGG + Intergenic
1175273839 20:57754023-57754045 CGGGCTCAGGAATGAAGAGGAGG + Intergenic
1175785376 20:61708607-61708629 CAGGCACAGGAGGGTGGAGAGGG - Intronic
1176239119 20:64067818-64067840 CAGCCTCAGGACTGCAGAGATGG + Intronic
1178631216 21:34263148-34263170 GAGGGTCAGGTTTGAGGGGAAGG - Intergenic
1178820772 21:35973118-35973140 CAGGCTAAGGATTCAGCACAGGG + Intronic
1179405545 21:41122398-41122420 CAGACCCAGGGTTGGGGAGATGG + Intergenic
1180706743 22:17814994-17815016 ACGGCTGAGGATCGAGGAGACGG - Intronic
1180782367 22:18528456-18528478 CAGGCTCATGATTGAGGACTGGG - Intronic
1181125920 22:20702483-20702505 CAGGCTCATGATTGAGGACTGGG - Intergenic
1181239256 22:21467791-21467813 CAGGCTCATGATTGAGGACTGGG - Intergenic
1181938046 22:26452949-26452971 CAGGCTCAGTATGGCAGAGAGGG + Exonic
1182097093 22:27633329-27633351 CAGTCTCTGGGTTGAGGAGGTGG + Intergenic
1183104530 22:35606635-35606657 GAGCCTCAGGAAAGAGGAGAAGG - Intergenic
1184158200 22:42682748-42682770 CAGCCTCAGGATCTTGGAGAAGG - Intergenic
949988176 3:9555605-9555627 CAGGCTAAGCACTGGGGAGAAGG + Intergenic
951563395 3:23989508-23989530 GAGGCACAGGGTTGGGGAGAGGG - Intergenic
951887505 3:27538729-27538751 CAGGCCCAGGATGGAGAAGGGGG - Intergenic
953033578 3:39193028-39193050 CAGGCTCAGAACAGAGGAGGAGG - Intergenic
953136424 3:40186009-40186031 CATGATCAGGATTGAGGGGTAGG + Intronic
953644591 3:44742334-44742356 CAGGCCCAGGAGTGGGGAAAGGG + Intronic
954071456 3:48145994-48146016 CAGTCTCATGCTTGAGGGGATGG - Intergenic
956142661 3:66161392-66161414 CAGGGTCAAGATTGGTGAGAGGG - Intronic
957615408 3:82519877-82519899 CAGGCTAAGTATAGTGGAGAAGG - Intergenic
957626295 3:82656799-82656821 CTGGCTCAGTATTGTAGAGAAGG + Intergenic
960432738 3:117589716-117589738 CAGTCTCAGGAGAGAGGACAGGG + Intergenic
962030773 3:131598092-131598114 TAGGCACAGGATCGAAGAGATGG + Intronic
962652992 3:137514933-137514955 CAGGATCAGGGTTAAGGAGAGGG + Intergenic
963633728 3:147767211-147767233 TAGGCACAGGACAGAGGAGAAGG + Intergenic
964504252 3:157381251-157381273 AGGGCCCAAGATTGAGGAGAAGG + Exonic
965006639 3:163034827-163034849 CAGGCGTAGAGTTGAGGAGAGGG + Intergenic
965068489 3:163884254-163884276 GAGGCACAATATTGAGGAGAGGG - Intergenic
965162969 3:165158674-165158696 CGGTCTCAGTATTGAGAAGAAGG - Intergenic
966130148 3:176628216-176628238 CAGGCTGAGGGTGGAAGAGAGGG + Intergenic
967216908 3:187218872-187218894 GAGGCTCAGGGGTGAGGAGTCGG + Intronic
968041320 3:195591632-195591654 CAGGTGCAGGAATAAGGAGATGG + Intergenic
968513513 4:1005427-1005449 CAGGTCCAGGAGTGAGGGGAGGG - Intergenic
968964043 4:3760506-3760528 CAGGCCCAGGATGGTGGAGCAGG + Intergenic
969207089 4:5655241-5655263 AAGGATCAGGTTTGAGGACAGGG + Intronic
969297416 4:6278136-6278158 CCGCCTCAGGATGGAGGTGAAGG - Intronic
970207123 4:13666182-13666204 CAGGCTCATGACTCATGAGAGGG - Intergenic
970774858 4:19661693-19661715 CAGGGCCAGGATTCAGGAAAAGG + Intergenic
971455564 4:26840863-26840885 CAGGCTGAGAAGTGAGAAGAAGG - Intergenic
974819541 4:67048286-67048308 CAAGCTCAGCATTGAGTAAAAGG - Intergenic
976479165 4:85519418-85519440 TAGACTCAGGACTCAGGAGAAGG - Intronic
976608794 4:87007539-87007561 CAGCCTCGGGAATGATGAGAAGG - Intronic
978390041 4:108215763-108215785 CAAGCTCAGAATTCAGGAGCTGG - Intergenic
978875341 4:113634179-113634201 CAGGATCAGAATAGGGGAGAAGG - Intronic
980110944 4:128636319-128636341 CAGCCTCAGGGGTGAGGGGAAGG - Intergenic
982263065 4:153512556-153512578 AAGGCTCAGGGATGAGGAGAGGG - Intronic
983938380 4:173518614-173518636 CAGGTTCTGGAATGGGGAGAAGG - Intergenic
985923478 5:2997455-2997477 CAGGCTCAGAGTTGAGGGGAAGG - Intergenic
986054599 5:4123763-4123785 CAGTCTCAGGACTGAGCAGGAGG + Intergenic
986072423 5:4298651-4298673 CAGGCACAGGATTCAGGTGAAGG + Intergenic
986904210 5:12473675-12473697 CAGGATCAGGATGGAGGTGGAGG + Intergenic
987448407 5:18051105-18051127 CAGGCTCAGCCTAGAGCAGAAGG + Intergenic
991034073 5:62110146-62110168 CAGGCTCAGGGATGAAGAGATGG + Intergenic
992074363 5:73177178-73177200 CAGGCTGAGGATGGAGGAGAGGG - Intergenic
995177645 5:109197459-109197481 CAAGCTCAGGGATGAGGAGGGGG - Intergenic
996978080 5:129459505-129459527 GAGGCGCTGGATTGAGGAGTGGG + Intergenic
997991899 5:138551449-138551471 AATGCACAGGATTGAGGGGATGG + Intergenic
999510291 5:152243175-152243197 CATGCTCAGGGCTGAGTAGATGG + Intergenic
1001399255 5:171437107-171437129 CAGGCCCAGGTTCTAGGAGATGG + Intronic
1001406017 5:171478181-171478203 GAGGCTGGGGATTAAGGAGATGG - Intergenic
1001549927 5:172595401-172595423 CAGGCTTAGGATTGACTAGTTGG + Intergenic
1002104906 5:176875229-176875251 CAGGCTAAGGATGGGGGAGTGGG - Intronic
1003016026 6:2468190-2468212 CAGCTTCAGAGTTGAGGAGAGGG + Intergenic
1003578833 6:7321085-7321107 CAGGGTCAGAATAGGGGAGAGGG + Intronic
1004338049 6:14782653-14782675 CAGGCTGACCATTCAGGAGATGG + Intergenic
1006116956 6:31780626-31780648 GAGGCTCAGGGTGGAGAAGAGGG + Intronic
1006175249 6:32117465-32117487 CACCCACAGGAGTGAGGAGAGGG + Intronic
1006416977 6:33910497-33910519 CAGCCTCAGGCCTGTGGAGAGGG + Intergenic
1006452217 6:34111822-34111844 CAGGCTGGTGACTGAGGAGAGGG - Intronic
1006506221 6:34490512-34490534 CAGGCTCAGGAGTCATGAGATGG - Intronic
1006802164 6:36766152-36766174 CAGGGTCAGGTTTGGGGAGGTGG + Intronic
1010096110 6:72048388-72048410 TTGGCTCAGGACTCAGGAGAAGG - Intronic
1010556189 6:77282155-77282177 CAGGCACAGGATGGGGGAGCAGG + Intergenic
1015106479 6:129542587-129542609 CAGGGAAAGGATTGGGGAGATGG - Intergenic
1015655643 6:135515120-135515142 CAGGCTGAGGAATGAAGACATGG + Intergenic
1018842317 6:167526291-167526313 CAGGCTCAGGGGTGAGGTGTGGG - Intergenic
1019018813 6:168900657-168900679 CAGCCGCAGGAGTGAGAAGAGGG + Intergenic
1019100211 6:169623995-169624017 CAGACACAGGATTGGGGACATGG + Intronic
1019136518 6:169911934-169911956 CAGGCTCAGGATGGGGGTGTAGG - Intergenic
1019559463 7:1648745-1648767 CGGGCTGAGGATTCAGGAGAAGG - Intergenic
1020274694 7:6616987-6617009 GAGGCTCAGGACTGGGGAGTTGG - Intronic
1020625493 7:10573682-10573704 CAGGCTCAGGATTGAGGCTGTGG - Intergenic
1021809155 7:24386582-24386604 CTGGCTCACTCTTGAGGAGAAGG + Intergenic
1021894587 7:25222095-25222117 CACTCTCAGGAATGAGGGGATGG - Intergenic
1022181630 7:27926105-27926127 CAGGCTCAAGATGGAGAGGAAGG + Intronic
1022597901 7:31730355-31730377 CTGGTGCAGGAATGAGGAGACGG - Intergenic
1023980585 7:45067774-45067796 CAGCCTCAGGAGGGAGAAGAAGG - Intronic
1024894643 7:54243740-54243762 GAGTGTCAGGAGTGAGGAGAAGG + Intergenic
1026269926 7:68827555-68827577 CAGGATCAGAAATGTGGAGAAGG - Intergenic
1026397004 7:69965533-69965555 CAGACTTAGGGTTGAGGATAAGG + Intronic
1026640021 7:72116169-72116191 CAGGCTCAGACTTGAAAAGAAGG + Intronic
1027197386 7:76040051-76040073 CAGGCTTAGGTTTGGGGACATGG - Intronic
1028401039 7:90425710-90425732 CAGGCTAGGGATGGGGGAGAGGG + Intronic
1029272483 7:99385425-99385447 CAGGGACAGGGTGGAGGAGACGG - Intronic
1029440681 7:100585225-100585247 CAGGCTTAGGAAGGAGGAGGAGG + Intronic
1030715186 7:112801004-112801026 CAGGCTTATGATGGAGGAGAGGG + Intergenic
1031004771 7:116458333-116458355 GAGGCTTTGGATTGGGGAGAAGG - Intronic
1031509231 7:122627580-122627602 CAGGTTCATGACTGAGAAGAAGG - Intronic
1031971963 7:128071682-128071704 CAGGCTGAGGTTTGTGGAGAAGG + Intronic
1032075213 7:128832793-128832815 CAGGCTGAGGCTGGAGGGGAGGG + Intronic
1032363336 7:131276176-131276198 CAGGCCCAGAATAAAGGAGAGGG - Intronic
1032469479 7:132168017-132168039 CAGGGTCAAGATTAAGTAGAAGG + Intronic
1032937944 7:136755588-136755610 CAGGCTCAAGAATAAGGAGAAGG - Intergenic
1033216220 7:139495541-139495563 CAGGCACAGGCTCTAGGAGAGGG - Intergenic
1033597184 7:142866411-142866433 CAGGATCAGCCTTGAGGGGAGGG - Intronic
1034282527 7:149864113-149864135 CAGGCTCAGGAAGGAGGAGATGG + Exonic
1034878704 7:154747760-154747782 CAGCCTCAGCAATGCGGAGACGG + Intronic
1036447828 8:8838285-8838307 CAACCCCAGGATTGAGGGGAAGG + Intronic
1037315382 8:17595265-17595287 CAGGCTAATGGTTGAGGGGATGG - Intronic
1037628129 8:20626455-20626477 CTGGCTTGGGATTAAGGAGATGG + Intergenic
1041300606 8:56407643-56407665 CAGGGTCAGGGTTGAGGTGGAGG - Intergenic
1041809106 8:61887540-61887562 TAGGGTCAGCATTAAGGAGATGG + Intergenic
1044556200 8:93564631-93564653 CTTGCTCAGGAATGTGGAGACGG - Intergenic
1044922093 8:97177907-97177929 GAGGCTTTGGATTGGGGAGAAGG - Intergenic
1045776065 8:105804131-105804153 CAGGTTCAGGATTAAGAAAATGG - Exonic
1047474384 8:125212529-125212551 CAGGCTGAGGTTTGAGTGGAGGG + Intronic
1048275421 8:133062340-133062362 CAGGCTCAGGAATGGAGACAAGG - Intronic
1049008184 8:139870758-139870780 GAGGATCAGGGTTAAGGAGAAGG + Intronic
1050058211 9:1677860-1677882 CAGGCCCAGTAGTAAGGAGAAGG - Intergenic
1051394189 9:16601598-16601620 CAGGCTCAGGAGTGTGTAGTAGG - Intronic
1052031044 9:23629330-23629352 AAAGCTCAGGAAGGAGGAGAAGG + Intergenic
1053037408 9:34836979-34837001 CTGGGGCAGGACTGAGGAGATGG - Intergenic
1054454757 9:65424132-65424154 TAGGCCCAGGATAGAGGAGACGG - Intergenic
1055766949 9:79673814-79673836 CAGGCTCAAAATAGAGTAGATGG + Intronic
1057799364 9:98180779-98180801 CAGGTTCAGGCTCGAGTAGAGGG + Intronic
1058100777 9:100915762-100915784 CAGGCCCATGGTAGAGGAGAAGG - Intergenic
1059369472 9:113815075-113815097 TAGGCTCAGGATAGAGGAAATGG + Intergenic
1061852958 9:133426476-133426498 CAGACTCAGGTGTGAGGACAGGG + Intronic
1061878099 9:133554836-133554858 CAGGCACAGGGTTGAGGACTTGG + Intronic
1061930485 9:133830280-133830302 CAGGCACAGGAGTGAGGAGAAGG - Intronic
1062439525 9:136563491-136563513 CTGGCTCTGGACTGAGGAGGTGG - Intergenic
1062634736 9:137484861-137484883 CAGCCTCAGGACTGGGGAGGCGG - Intronic
1062634748 9:137484894-137484916 CAGCCTCAGGACTGGGGAGGCGG - Intronic
1185858328 X:3556011-3556033 GAGGCTCTGGATTGGGAAGAAGG + Intergenic
1185991159 X:4894415-4894437 GAGGCTCTGGATTGGGAAGAAGG - Intergenic
1186786290 X:12959155-12959177 CAGGGGCAGCAGTGAGGAGAAGG - Intergenic
1188553231 X:31383643-31383665 CAGGCACAGGATGGAGGGCAGGG - Intronic
1188919727 X:35958038-35958060 GAGGCTGATGAATGAGGAGAAGG - Intronic
1189659949 X:43286214-43286236 CAGCCACAGTATGGAGGAGAGGG - Intergenic
1190059321 X:47200852-47200874 CAGGCCCAGCATTGGGGTGAAGG - Intronic
1195613756 X:106896522-106896544 CAGGCACAGTTTTGAGGAGGGGG + Intronic
1198686058 X:139229236-139229258 CAGGGGCAGGAATGAGGAGTGGG - Intergenic
1198871370 X:141179786-141179808 CAGTGTAAGGATTGAGGGGAGGG + Intergenic
1202076433 Y:21041964-21041986 GAGGCTTTGGATTGGGGAGAAGG + Intergenic