ID: 948606010

View in Genome Browser
Species Human (GRCh38)
Location 2:239135635-239135657
Sequence GATGCTGGAGCTCCACTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948606006_948606010 0 Left 948606006 2:239135612-239135634 CCTTCAAAATCTGTCTAACCTTT 0: 1
1: 0
2: 2
3: 28
4: 297
Right 948606010 2:239135635-239135657 GATGCTGGAGCTCCACTCTTGGG 0: 1
1: 0
2: 0
3: 14
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948606010 Original CRISPR GATGCTGGAGCTCCACTCTT GGG Intronic
903281659 1:22253610-22253632 GAGGCTGCAGCTCCAGCCTTGGG + Intergenic
905491439 1:38346978-38347000 GAGGCTGGGGCTCTACTTTTAGG - Intergenic
906316523 1:44789812-44789834 GAGGCAGGACCACCACTCTTGGG - Intergenic
913522367 1:119657198-119657220 GACACTGGAGCTACACTGTTTGG - Intergenic
913525581 1:119689377-119689399 GATGGTGGAGTTGCACTCTCAGG + Intronic
915346791 1:155201569-155201591 GATGCTGCCTCTCCACTCTTAGG - Exonic
922718935 1:227890588-227890610 GATGCTGCAGCTGCACTCTCGGG - Intergenic
924616634 1:245617482-245617504 GACTCTGGAGATCCATTCTTTGG + Intronic
1064862967 10:19847476-19847498 AATGCTGAATCTCCACACTTGGG - Intronic
1065081795 10:22136484-22136506 GATGCTGGAGCTCTAGCTTTGGG - Intergenic
1068941243 10:62683373-62683395 GATTCTGGGGCTCCAGTTTTGGG - Intergenic
1069993253 10:72327934-72327956 GAGGCTGGAACTCCGATCTTTGG + Intergenic
1070647623 10:78212583-78212605 CATGCTGGATCTCCACTGCTGGG - Intergenic
1071148471 10:82603243-82603265 GCTGCTAGAGCCCCACTCTCGGG + Intronic
1072056845 10:91766692-91766714 CAAGCTGGAGCTTCGCTCTTTGG - Intergenic
1072291015 10:93964703-93964725 AATGCTGGAGCTTCTCTTTTGGG + Intergenic
1074267760 10:111921628-111921650 GAAGCAGGAGCTCCACTATTAGG + Intergenic
1076449936 10:130550234-130550256 GATGCAGCAGCTCCACTTTTGGG + Intergenic
1076833217 10:133007307-133007329 GCTCCTGGGCCTCCACTCTTGGG + Intergenic
1080415700 11:32068075-32068097 GCTTCTGGAGCTACATTCTTTGG - Intronic
1081722778 11:45302283-45302305 GAAGCTGGGGCTCCACTTTCGGG + Intergenic
1083279389 11:61617203-61617225 GATCCAGCAGTTCCACTCTTAGG - Intergenic
1083587738 11:63872763-63872785 GTTGCAGGAGCTCCAATCTCTGG - Intronic
1084901977 11:72316414-72316436 GACTCTGGAGCACCACTCCTTGG - Intronic
1086982310 11:93211996-93212018 GATGCCGCAGCCCCACTGTTGGG + Intergenic
1089183557 11:116599229-116599251 GATGCTGGAGCTCCCCACTGAGG - Intergenic
1089503489 11:118947190-118947212 GATGTTGGAGCTCCTCTGTGGGG - Intronic
1090972782 11:131657190-131657212 GATGCTGGGCCTCCACTCAAGGG - Intronic
1091187773 11:133661997-133662019 GATGCTGGAACCCCAGTCTTTGG - Intergenic
1091364375 11:135005321-135005343 GCTGCTGGAGCCCAGCTCTTGGG + Intergenic
1093525503 12:20100414-20100436 GCTACTGGAACTCCACTTTTTGG + Intergenic
1094289011 12:28825125-28825147 GATGTTGTAACTCCAGTCTTAGG + Intergenic
1094345821 12:29467760-29467782 GATGGTGGTGTTCCACACTTAGG - Intronic
1095647852 12:44570279-44570301 GATGCTGGTGCTCCACAATTAGG + Intronic
1095989256 12:48023035-48023057 GGGGCTGGAGCTGCACTATTTGG + Intronic
1100999684 12:100345032-100345054 GCAGCTGGAGCTCCTCTGTTTGG - Intergenic
1101748742 12:107565185-107565207 TATGCAGGAGCTCCCCTGTTAGG + Intronic
1102473965 12:113176663-113176685 GGTGCTGGAGCTCATCTCTGGGG - Intronic
1103988271 12:124781283-124781305 GAGGCAGCAGCCCCACTCTTTGG - Intronic
1110251986 13:73390602-73390624 GCTCCTGGAGCTCCTCTCTTAGG + Intergenic
1113287054 13:108861530-108861552 GATGCTGGCATTCCACTCCTAGG - Intronic
1114648812 14:24270347-24270369 GCTGCTGGAGCACCTCTCGTCGG + Exonic
1114672171 14:24417137-24417159 GCTGCTGGAGCTCCACTGGAGGG + Exonic
1115358733 14:32477524-32477546 CAGGTTGGAGCTCAACTCTTAGG + Intronic
1116664457 14:47757411-47757433 GATGCTGCAGCTTTACTCTCAGG + Intergenic
1116805353 14:49489077-49489099 TCCCCTGGAGCTCCACTCTTCGG - Intergenic
1118602177 14:67478569-67478591 GATGTTGAAGATCCACTCATGGG - Intronic
1120622808 14:86786614-86786636 GATTCTGGAGTTCAAATCTTCGG - Intergenic
1122140893 14:99662371-99662393 GATGTTGGAGCTCCAGTGCTTGG + Intronic
1123795353 15:23765387-23765409 GATTCTGGAGCACCAGTCTTAGG + Intergenic
1124115121 15:26834313-26834335 GATACGGCAACTCCACTCTTAGG - Intronic
1124173981 15:27404676-27404698 GATGTTGGATCTCCCCACTTGGG + Intronic
1126230899 15:46322900-46322922 GATGCTGGCCCTCCCCTTTTTGG - Intergenic
1126511942 15:49487506-49487528 GATGCTGGAGGTAAATTCTTAGG + Exonic
1135951015 16:26914138-26914160 GAAGCTGGAGCTACACTCTGTGG + Intergenic
1137019364 16:35408336-35408358 TATGGTGGAGCTCCACGTTTGGG + Intergenic
1137814774 16:51388345-51388367 GAAGCTGGAGCTGCATTGTTGGG - Intergenic
1141609486 16:85173061-85173083 GATGCTGAAGCTCTCCTCTTCGG + Intronic
1143266850 17:5644400-5644422 GAGGCTCCAGCTCCACTTTTTGG + Intergenic
1143992867 17:10981484-10981506 GAAGATGAAGCTCCTCTCTTGGG - Intergenic
1144071027 17:11671370-11671392 GACGCTGGAGCTCCCCACTGTGG - Intronic
1144479776 17:15619369-15619391 GATCCTGCAGAACCACTCTTTGG + Exonic
1144720288 17:17464433-17464455 GATGCTGGTCCTCCTGTCTTTGG + Intergenic
1144767362 17:17740007-17740029 GATGCTGCAGCCCCACCCTGAGG + Intronic
1144783882 17:17821387-17821409 GATCCAGCAGCTCCAGTCTTTGG + Intronic
1144918527 17:18744366-18744388 GATCCTGCAGAACCACTCTTTGG - Exonic
1145078199 17:19872810-19872832 AATGCTGGAGTTACAGTCTTGGG - Intergenic
1145931156 17:28686792-28686814 AATGCTGGAGCCTCACCCTTAGG + Intronic
1148239508 17:45990894-45990916 GATGCTGGTGCTCGCCTCCTCGG + Intronic
1148320284 17:46745114-46745136 GAAGGTGGAGGTCCCCTCTTGGG + Intronic
1152930022 17:83104666-83104688 GAGGCAGGAGCTCCTCTCTCAGG - Intergenic
1153941863 18:9985680-9985702 GAAGCTGGAGCTGCCCTCTATGG + Intergenic
1154105929 18:11523035-11523057 GGAACTGGAGCTCCACACTTAGG - Intergenic
1154487512 18:14885693-14885715 GATGCTGGAGGTAAATTCTTAGG - Intergenic
1156041616 18:32829324-32829346 GATGCTGCAGCTTCCATCTTGGG - Intergenic
1157291539 18:46413055-46413077 GATGGGGGAGCTCAACTCTGTGG + Intronic
1160590552 18:79942293-79942315 GACGCTGGAGCTCATCTCTGTGG + Intronic
1161308182 19:3578593-3578615 GAGGCTGGGGGTCCACCCTTTGG + Exonic
1162645512 19:12047049-12047071 GGTGCTGCAGATCCACACTTCGG - Intronic
1163476446 19:17528786-17528808 GCTGCTGGAGCTCCAGCCATTGG + Intronic
1163476538 19:17529430-17529452 GCTGCTGGAGCTCCAGCCATTGG + Intronic
1164617292 19:29674730-29674752 GCTTCTGGAGCTGCCCTCTTGGG - Exonic
925203217 2:1985782-1985804 AATGATGGAGCTCCCCTCTAGGG - Intronic
925313511 2:2904937-2904959 TGTACTGGAGCTCCACTCTCGGG + Intergenic
928100348 2:28433655-28433677 GATCCTGGGGCCCCACTCCTTGG + Intergenic
929010812 2:37442283-37442305 GATGCTGTAGCTGCACATTTGGG - Intergenic
929638759 2:43553631-43553653 GACCCTGCAGTTCCACTCTTAGG - Intronic
931503658 2:62899635-62899657 TATGCTGGAGTTCCACACTGAGG + Intronic
931810885 2:65853953-65853975 GATGGTGGAGCTCCCATCTGTGG + Intergenic
931979104 2:67675609-67675631 GATGCTGAAGCATTACTCTTTGG + Intergenic
932093845 2:68829572-68829594 GCAGCTGGAGCTCCACCCTCAGG - Intergenic
933816739 2:86074661-86074683 GATGTTTGAGAGCCACTCTTAGG - Intronic
935177453 2:100662232-100662254 GTTGCAGGAGCTCTACTCTAGGG - Intergenic
936522441 2:113219751-113219773 GAGGCAGGAGGTCCTCTCTTAGG + Intronic
937088256 2:119186345-119186367 GAAGCTGCTCCTCCACTCTTAGG - Intergenic
941707338 2:168673651-168673673 GACACTGGAGCCCCACTCTCAGG - Intronic
944562800 2:200958072-200958094 GATGCTGGAGGTTCACTTTGTGG - Exonic
944997227 2:205307558-205307580 GGAGCTGGAGCTTCACCCTTTGG - Intronic
947491296 2:230596771-230596793 AATGCTGGTGCTCCAGTGTTGGG - Intergenic
948443357 2:238012560-238012582 GAATCTGGAGCTCCAAGCTTTGG - Intronic
948606010 2:239135635-239135657 GATGCTGGAGCTCCACTCTTGGG + Intronic
948795934 2:240402124-240402146 GCTGCTGGGGCTCCACCCTGAGG + Intergenic
1169284415 20:4295910-4295932 GATGCAGCAACTCCACTCCTGGG + Intergenic
1175292983 20:57890680-57890702 GATGCTGGAGGTGCACCCTGAGG + Intergenic
1175399213 20:58691471-58691493 GATGCTGAAGCTCTAGTCTGTGG + Exonic
1176218548 20:63959395-63959417 GGTGCTGGAGTTCCAGTGTTGGG + Exonic
1176793766 21:13353641-13353663 GATGCTGGAGGTAAATTCTTAGG + Intergenic
1181740433 22:24917210-24917232 GATGCAGCAATTCCACTCTTAGG - Intronic
1184348785 22:43929537-43929559 GAAGGTGGAGCTTTACTCTTAGG + Intronic
1185096303 22:48807900-48807922 GAAGCTGGTGCTGTACTCTTGGG + Intronic
950020440 3:9783824-9783846 GATGCCTGAGCCCCACTCTGTGG + Intronic
950215679 3:11156547-11156569 GATTCTGGAGCTCACCTGTTGGG + Intronic
953344749 3:42165875-42165897 GATGCTGGTACCCCACTATTAGG - Intronic
954281481 3:49582006-49582028 GATCCAGGAATTCCACTCTTAGG - Intronic
956737408 3:72248291-72248313 GATGCTGGAGGGCCAGGCTTGGG - Intergenic
958491236 3:94776556-94776578 GAAGCTGGAAGTCCAGTCTTGGG + Intergenic
962689739 3:137882175-137882197 GGTGGTGGAGCTCCTCGCTTTGG + Intergenic
962738590 3:138347079-138347101 GATCCAGGAATTCCACTCTTAGG + Intergenic
965048843 3:163617541-163617563 GATGTTTCAGCTCCACTGTTAGG + Intergenic
965371243 3:167864421-167864443 GAGCCCGGAGCGCCACTCTTGGG + Intergenic
967457041 3:189700531-189700553 GATGCTGGAGCTCTAATATGAGG + Intronic
969276882 4:6141763-6141785 GATGCTGACTGTCCACTCTTCGG + Intronic
971311646 4:25530306-25530328 GATACTGGAGCAGCACTTTTTGG + Intergenic
971567577 4:28165322-28165344 TATCTGGGAGCTCCACTCTTGGG + Intergenic
972205458 4:36766596-36766618 GATTCTGGAGCTAAACTGTTTGG - Intergenic
974907593 4:68077195-68077217 GATGTAGGAGCCCCACTCCTGGG + Intronic
981576811 4:146214053-146214075 GATGCTGGTGTTGCACTCTAGGG + Intergenic
982354985 4:154456446-154456468 GCATCTGGAGCTCCACTGTTGGG - Intronic
983078268 4:163352995-163353017 GATTCTGGAGCTGGACTCTGAGG - Intergenic
985400977 4:189593955-189593977 GGTGCTGAAGCACCACCCTTGGG + Intergenic
985764859 5:1771950-1771972 GATGCTGGGGCTCCACTGATTGG + Intergenic
987517737 5:18935232-18935254 GAGACTGGAGCTCAATTCTTTGG - Intergenic
988568469 5:32340823-32340845 GATGCTAGAGATCCAGTTTTTGG - Intergenic
989196758 5:38723951-38723973 GAGGCTGGAGGTCCACGATTAGG + Intergenic
998981357 5:147706289-147706311 GTTGCTGGTTCTCCAGTCTTGGG - Intronic
999371895 5:151060827-151060849 AATGCTGGATCTGCAGTCTTGGG - Intronic
1001951411 5:175819258-175819280 GATGCAGCAACTCCACTCCTTGG - Intronic
1002168005 5:177359915-177359937 GATGCTGACGCTCTACTCTCTGG - Intronic
1002433560 5:179218215-179218237 GCTGCTGGTGCTCCAGGCTTTGG - Intronic
1009292573 6:61902421-61902443 AATGATTCAGCTCCACTCTTGGG - Intronic
1010350705 6:74870908-74870930 GAGACTGGAGCTTCACACTTTGG + Intergenic
1013387475 6:109645952-109645974 TTTGCTGGAGGTCCACTCTATGG - Intronic
1013971333 6:116023265-116023287 GATGCAGCAATTCCACTCTTGGG + Intronic
1014772432 6:125472401-125472423 GATCCAGAAACTCCACTCTTAGG + Intergenic
1020989632 7:15180867-15180889 GATGCTGGTGCCCTGCTCTTGGG - Intergenic
1022616834 7:31940481-31940503 TATTCTGGGGCTCCATTCTTTGG - Intronic
1024610198 7:51057778-51057800 GATGCTGGGGCTCCAGCCTTAGG + Intronic
1026557443 7:71420726-71420748 GATCCTGCAGCTTCACTCCTGGG - Intronic
1028607465 7:92670733-92670755 GAGGCTGGACCTCCACACATTGG - Intronic
1030084468 7:105804870-105804892 GCTGCTGGATCTTAACTCTTAGG + Intronic
1030084687 7:105806266-105806288 CATCATGGAGCTCCACTTTTAGG - Intronic
1030752964 7:113254155-113254177 GATCCTGCAGTTCCACTCCTAGG + Intergenic
1032452231 7:132042931-132042953 GATGCTTGCCCTCCACTATTGGG + Intergenic
1032678853 7:134160873-134160895 GAAGCTGGATGTCCACTTTTAGG + Intronic
1032694517 7:134322659-134322681 GATGCTGGAGCTTGACCCTGTGG - Intergenic
1034490777 7:151392146-151392168 GGTCCGGGAGGTCCACTCTTGGG - Intronic
1036029275 8:4948808-4948830 TATGCTGCAGCTCCATTCTAGGG - Intronic
1036742062 8:11372107-11372129 GGTGCTGCAGCTCCACTAATGGG - Intergenic
1043812361 8:84756628-84756650 GATCCTGGAGCCCCACTCTGAGG + Intronic
1043988051 8:86717189-86717211 AATGTAGGAGCTCCAGTCTTAGG - Intronic
1044632465 8:94292756-94292778 GAGGCTGCAGCACCACTGTTAGG + Intergenic
1051809249 9:21031479-21031501 GAGGCGGGAGCTCCCCTCTGCGG - Intronic
1055702081 9:78956048-78956070 TATGCTGGAGCTGAACTCATAGG + Intergenic
1055916127 9:81402055-81402077 GACTCTGGAGCTCCTCTCCTAGG + Intergenic
1059736165 9:117102007-117102029 GATGCAGGATTTCCACTCCTAGG + Intronic
1060414740 9:123422181-123422203 GATGCTAGTTCCCCACTCTTGGG - Intronic
1185964243 X:4582269-4582291 GATGCAGGAGTTCCAGTTTTAGG + Intergenic
1186504599 X:10081166-10081188 GAGGCTGGAGGTCCAATATTTGG + Intronic
1187044113 X:15629087-15629109 GATGTTGGAGCACCACTCCATGG + Intronic
1188046698 X:25433308-25433330 GACCCTGCAGCTCCACTCCTAGG - Intergenic
1189237048 X:39495159-39495181 CAGGCTGGAGCTCCCCTCTGTGG - Intergenic
1190158706 X:48014834-48014856 GATCCAGCAACTCCACTCTTAGG + Intronic
1190174404 X:48137122-48137144 GATCCAGCAACTCCACTCTTAGG + Intergenic
1191107890 X:56783479-56783501 GCTGGTGCAGCTCCACTCTGTGG + Intergenic
1191930810 X:66369568-66369590 GATGCTGCAATTCCACTCCTAGG - Intergenic
1192557455 X:72101725-72101747 AATGCTGGTGTTCCACTCCTCGG - Intergenic
1193323145 X:80148279-80148301 GATGCTGGAGCTTCCCTCACAGG + Intergenic
1193335601 X:80285142-80285164 GATGTAGGAGCTCCATCCTTGGG - Intergenic
1198805472 X:140490066-140490088 GGTCCTGGAGGACCACTCTTGGG - Intergenic
1200165466 X:154032320-154032342 GATGATGGAGCGCCGCTGTTTGG + Exonic