ID: 948606643

View in Genome Browser
Species Human (GRCh38)
Location 2:239139919-239139941
Sequence ATGGCCATGTTCTTTTTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 416
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 377}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948606643 Original CRISPR ATGGCCATGTTCTTTTTGTT GGG (reversed) Intronic
901620287 1:10579776-10579798 ATGGCCATTTTGGTTTTGGTGGG + Intronic
902044837 1:13516454-13516476 ATGGCTCTGTTTTATTTGTTGGG - Intergenic
902863452 1:19262015-19262037 ATGGCCCAGTTCTTTTGGGTGGG - Intergenic
903147825 1:21386935-21386957 ATGGCCATCTTGGTTTTGGTCGG - Intergenic
903206413 1:21785626-21785648 ATGGCCATCTTGGTTTTGGTGGG + Intergenic
904176280 1:28631526-28631548 CTGCCCATTTTCTTTTTTTTTGG - Intronic
904503217 1:30929684-30929706 ATGGCCATCTTCTCTTTTTGAGG - Intergenic
904583179 1:31563025-31563047 ATTGCCATGTTGGTTTTGGTGGG + Intergenic
905115119 1:35632160-35632182 ATGGAAATGTTCTTTTTCTGTGG - Intronic
908738303 1:67299723-67299745 ATGGCCATGCTCATATTGATGGG - Intergenic
909519884 1:76555509-76555531 ATGACCAGGTTCACTTTGTTTGG - Intronic
909759623 1:79271400-79271422 AGGGCCAACTTCTTTGTGTTTGG + Intergenic
910786580 1:91005025-91005047 CTGCCTATGTGCTTTTTGTTTGG - Intronic
911744880 1:101430427-101430449 ATGCCCATATTTTTTTTATTTGG + Intergenic
912014825 1:105019504-105019526 CTAGCTTTGTTCTTTTTGTTAGG + Intergenic
912303622 1:108542316-108542338 ATGGCTATATTTTGTTTGTTAGG - Intergenic
913134088 1:115871024-115871046 ATGGCTATGTCCTTGTTCTTAGG - Intergenic
913349243 1:117839830-117839852 GTGGACATGTTCATTTTTTTTGG - Intergenic
913420593 1:118663713-118663735 TTGACTATGTTGTTTTTGTTAGG - Intergenic
915091916 1:153432402-153432424 ATGGCAGTTTTGTTTTTGTTGGG + Intergenic
916259924 1:162831581-162831603 ATGGCCATTTTGGTTTTGGTGGG - Intronic
916664940 1:166958050-166958072 ATGGCCACCTTCTTCTTGTCGGG + Exonic
917215781 1:172676686-172676708 ATGGCCATCTTGGTTTTGCTAGG - Intergenic
917447545 1:175119371-175119393 ATTGCCATCTTCGTTTTGGTGGG + Intronic
917552869 1:176053791-176053813 CTGGCCATGTAATTTATGTTGGG - Intronic
917616792 1:176754074-176754096 ATGGACATGGTCTTTTGGGTGGG + Intronic
917794482 1:178522639-178522661 TTGGCCAAGTTCTTTTTTTTTGG + Exonic
917834465 1:178930391-178930413 ATGGCCATCTTGCTTTTGGTGGG - Intergenic
918100789 1:181372037-181372059 ATGCCTTTGTTCTTTTTGCTTGG + Intergenic
918753083 1:188298299-188298321 TTTGCCATTTTCTTTTGGTTAGG + Intergenic
920134966 1:203762339-203762361 ATGGCCATGTTGGTTTTGGTGGG - Intergenic
920757900 1:208752543-208752565 GGGTCCATGTTCTTTTTGGTAGG + Intergenic
922422064 1:225466819-225466841 ATGGCCATCTTGGTTTTGGTGGG + Intergenic
922600788 1:226851128-226851150 ATGGCCATCTTGTTTTTGGTGGG - Intergenic
922998386 1:229984966-229984988 ATTTCCGTGTTCTTTTTCTTAGG - Intergenic
1063007791 10:1990496-1990518 GTGGACATGTTCTTCCTGTTGGG - Intergenic
1065300014 10:24312622-24312644 ATGCCCACCTTTTTTTTGTTTGG - Intronic
1066258460 10:33704791-33704813 ATGTCAATGTTCATTTTGCTGGG - Intergenic
1066440257 10:35431688-35431710 AAAGCCATGCTCGTTTTGTTGGG + Intronic
1067779750 10:49191172-49191194 ATGGCTATTTTCTAATTGTTGGG - Intergenic
1068098355 10:52520582-52520604 ATGGCCATCTTGGTTTTGGTGGG - Intergenic
1068977172 10:63022565-63022587 ATGGCCATCTTGGTTTTGGTGGG - Intergenic
1069079441 10:64072343-64072365 CTGGCTTTGTTCTTTTTGCTTGG + Intergenic
1069484320 10:68811646-68811668 ATGGCCATCTTGGTTTTGGTAGG + Intergenic
1070718388 10:78739195-78739217 GTGGCCATGTTCTCTTTGTCTGG + Intergenic
1071027472 10:81132581-81132603 ATGGCCAAGTTGTTTTTGTTTGG + Intergenic
1071675409 10:87651210-87651232 ATGGCCATCTTGGTTTTGGTGGG - Intergenic
1073130187 10:101183444-101183466 ATGGCCATCTTGGTTTTGGTGGG - Intergenic
1074614247 10:115050720-115050742 ATGGCCATCTTGGTTTTGGTGGG - Intergenic
1074617512 10:115084212-115084234 ATGGCCATGTTCTTTATTACTGG - Intergenic
1075501521 10:122979510-122979532 CTGGCCAAGTTTTTTTTGTCTGG - Intronic
1080076243 11:28153078-28153100 ATGGCCATCTTGGTTTTGGTGGG + Intronic
1080610204 11:33897580-33897602 ATGTGCATGTCCTTTTTGCTGGG + Intergenic
1084699015 11:70774183-70774205 ATGACCAGCTTCTTTTAGTTAGG - Intronic
1085068720 11:73522202-73522224 ATGTCCATTTTTTTTTTTTTTGG - Intronic
1085804867 11:79626275-79626297 ATGGCCAAGTGCTCTTTGTCTGG - Intergenic
1085949137 11:81308260-81308282 ATGGCCATGTACTTGTTCATGGG + Intergenic
1086381538 11:86260034-86260056 ATGGACATGTTATTTCTGTTGGG - Intronic
1086453240 11:86937556-86937578 ATGGCCATCTTGGTTTTGGTGGG - Intronic
1087304707 11:96474696-96474718 ATGGCCATCTTGATTTTGATGGG - Intronic
1087548070 11:99609862-99609884 AGTGCCATTTTCTTTTTCTTAGG + Intronic
1088253510 11:107881723-107881745 ATGGCCATCTTGGTTTTGGTGGG + Intronic
1090037400 11:123260815-123260837 ATGGCCATCTTGGTTTTGGTGGG + Intergenic
1091935379 12:4430682-4430704 AAGAAAATGTTCTTTTTGTTAGG + Intronic
1094221723 12:28001116-28001138 GTGGCCATGTTGGTTTTGGTAGG + Intergenic
1095568011 12:43649068-43649090 ATGGCCATCTTGGTTTTGGTGGG - Intergenic
1095921481 12:47535794-47535816 ATGACCATGTTGTCTTTTTTTGG - Intergenic
1095978864 12:47958904-47958926 ATGGCCATTTTGGTTTTGGTAGG - Intergenic
1096070595 12:48773553-48773575 TTGGCCATGATCTTTGTCTTGGG - Exonic
1096389987 12:51221115-51221137 ATGGGCATTTGCTTGTTGTTTGG + Intergenic
1096877017 12:54637284-54637306 TTTGCCATCTTCTATTTGTTAGG - Intergenic
1096915372 12:55026653-55026675 TTGGTCATCTTCTTTTTCTTGGG - Exonic
1098436965 12:70477910-70477932 GTGGCTTTGTTCTTTTTGTTAGG + Intergenic
1103051106 12:117780565-117780587 ATGGCCATGGAGTTTCTGTTTGG + Intronic
1103132498 12:118481382-118481404 AAAGCCTTGTTCTTTTTGTGTGG - Intergenic
1105356500 13:19664230-19664252 ATGGAAATGTTCATTTTGTTTGG + Intronic
1106215541 13:27694927-27694949 CTGGCTTTGTTCTTTTTGCTCGG + Intergenic
1106331807 13:28746248-28746270 ATGGCCATCTTGGTTTTGGTGGG + Intergenic
1108363540 13:49688869-49688891 ATGCCCATGTTGTCTTTGCTTGG - Intronic
1108789383 13:53949299-53949321 ATGGACATGTTTTTATTTTTTGG + Intergenic
1109401330 13:61832825-61832847 ATGGGCATCTTTTTTTAGTTGGG + Intergenic
1109934537 13:69264477-69264499 GTGCCCATGTTTCTTTTGTTTGG + Intergenic
1110406704 13:75159132-75159154 ATGACCTTGTTCTTTTTTTATGG - Intergenic
1110471218 13:75862286-75862308 CTGGCCAAGTTCTTTGTTTTGGG + Intergenic
1110785538 13:79520689-79520711 AATGCCATTTTCTTTGTGTTTGG + Intronic
1111065967 13:83091713-83091735 CTGGCTTTGTTCTTTTTGCTTGG - Intergenic
1111315308 13:86549122-86549144 ATGGACATGATCTTCTTGGTTGG + Intergenic
1111881129 13:93958636-93958658 CTGGCTTTGTTCTTTTTGCTTGG + Intronic
1112585929 13:100718654-100718676 ATGGCCATCTTGGTTTTGGTGGG + Intergenic
1114846565 14:26330047-26330069 ATGGACATGTTATTTCTCTTGGG + Intergenic
1114946686 14:27690441-27690463 GTGGCCATCTTCATTTTGGTGGG + Intergenic
1115161621 14:30402899-30402921 ATGGCCATCTTCCTTTTCATGGG + Intergenic
1115392103 14:32865812-32865834 GTGCCCATGTTTCTTTTGTTGGG + Intergenic
1115523310 14:34254609-34254631 ATGGCGGTGTGCTTTATGTTAGG - Intronic
1116250512 14:42475855-42475877 AAGACCCTGTTTTTTTTGTTTGG + Intergenic
1116593407 14:46808985-46809007 ATGGCCATCTTACTTTTGGTGGG + Intergenic
1117281375 14:54244574-54244596 AGGGCCATTTTATCTTTGTTTGG + Intergenic
1118046298 14:61974995-61975017 GTGGCCAGATTCTTTTTGCTTGG + Intergenic
1118265123 14:64287485-64287507 AAGGCTAGGTGCTTTTTGTTTGG + Intronic
1118789632 14:69078234-69078256 ATGGCCATGTTCTACTTCTTTGG - Intronic
1118997904 14:70853963-70853985 ATGGCCATCTTGGTTTTGGTGGG - Intergenic
1120783865 14:88512280-88512302 ATGAAGATGTTCATTTTGTTGGG - Intronic
1121191671 14:92036232-92036254 AAGGCCAAGTTTTTCTTGTTGGG - Intronic
1121342258 14:93112416-93112438 ATGGCCCTGCTCTTAATGTTTGG - Intronic
1121415396 14:93775791-93775813 GTAGCCATGTTCTTATTTTTGGG + Intronic
1125949290 15:43737792-43737814 ATGGTTCTGTTCTTTTTGTCTGG - Intergenic
1126250333 15:46560163-46560185 ATAGTTTTGTTCTTTTTGTTTGG + Intergenic
1127170682 15:56298018-56298040 ATTGCAATGTTCTTGTTATTTGG - Intronic
1127381161 15:58431576-58431598 AGGGCCCTTTTCTTTTTCTTTGG + Intronic
1127580458 15:60334406-60334428 CCGGCTTTGTTCTTTTTGTTTGG - Intergenic
1128230150 15:66029148-66029170 ATTGCCTTGTTTTTTTTTTTGGG + Intronic
1130124420 15:81081030-81081052 ATGGCCATTTTCTATTCCTTGGG - Intronic
1130774156 15:86960628-86960650 ATGGTCATTTTCTTTCTTTTTGG - Intronic
1132922337 16:2404006-2404028 ATGGCAAAGTTCATTTTGTTTGG - Intergenic
1133694270 16:8245987-8246009 ATTGTCATTTTCTTTTTTTTAGG - Intergenic
1133882398 16:9795265-9795287 ATGGCCATCTTGGTTTTGTTGGG - Intronic
1134000199 16:10776918-10776940 ATGGCCATCTTGGTTTTGGTGGG + Intronic
1134328765 16:13230939-13230961 ATGGCCATTTTGGTTTTGGTGGG + Intronic
1134381007 16:13725800-13725822 ATCGCCATCTTGGTTTTGTTGGG - Intergenic
1135688285 16:24515803-24515825 ATGGCCTTTTTTTTTTTTTTTGG - Intergenic
1135903296 16:26486872-26486894 ATGGCCATCTTGGTTTTGGTGGG - Intergenic
1137276476 16:46937531-46937553 ATGGCCATGTTGGTTTTGGTGGG - Intergenic
1138014886 16:53419387-53419409 ATAGCCATCTTGGTTTTGTTGGG - Intergenic
1139736842 16:68997576-68997598 ATTACCATTTTCTTTTTGGTGGG + Intronic
1140888843 16:79268103-79268125 GGGGCCATGTTGTTTTTCTTGGG - Intergenic
1141335617 16:83152560-83152582 ATGGCCATGTTTTATTTTTAGGG + Intronic
1142519100 17:492640-492662 ATGGCCATCTTGGTTTTGGTGGG + Intergenic
1144121639 17:12160037-12160059 CTGGCCATTTTTTTTTTTTTAGG + Intergenic
1144402595 17:14920598-14920620 ATGGCCATGGTCTGTATGTAAGG + Intergenic
1144406525 17:14957635-14957657 ATTTCCATGTTGTTGTTGTTTGG - Intergenic
1146415869 17:32632295-32632317 ATAGACATGTTTTTTTTATTTGG + Intronic
1147757473 17:42778558-42778580 CTGGCTATATTCTTTGTGTTAGG + Intronic
1147803785 17:43114485-43114507 ATGGCCATGTACATTTTTCTGGG - Intronic
1148359142 17:46997361-46997383 ATGGTGATATTCTTTTTTTTTGG - Intronic
1148935082 17:51158610-51158632 ATGGCCATGTAATTTTACTTTGG + Intronic
1149033899 17:52113684-52113706 ATGGCCATTTTCTTGTGTTTTGG - Intronic
1149215068 17:54345078-54345100 ATTGCCATCTTGGTTTTGTTGGG - Intergenic
1150046256 17:61916045-61916067 CTGGCTTTGTTCTTTTTGTTAGG - Intronic
1152196709 17:78922799-78922821 ATTTCCCTGTTCTTTTTTTTTGG - Intronic
1153113221 18:1619549-1619571 ATGACCATATTCATTTTGGTGGG + Intergenic
1155515000 18:26615693-26615715 ATGGGCATGTTTTTATTGGTTGG + Intronic
1156192807 18:34739246-34739268 ATTATCATTTTCTTTTTGTTTGG + Intronic
1156320015 18:36011088-36011110 ATCTCCAAGTTTTTTTTGTTGGG + Intronic
1156620458 18:38845583-38845605 CTGGCCATGTCTATTTTGTTAGG + Intergenic
1157664078 18:49470406-49470428 ATGGCCATCTTCTTGCTGCTTGG + Intergenic
1158670265 18:59468087-59468109 AGCCCCCTGTTCTTTTTGTTTGG - Intronic
1158802633 18:60930670-60930692 ATGGCCATGAACTGTTTTTTGGG + Intergenic
1159048063 18:63389002-63389024 ATGGGCATGTTCTATTTCTCTGG - Intergenic
1159062295 18:63528676-63528698 ATGCCTAAGTTATTTTTGTTTGG - Intergenic
1161091978 19:2365311-2365333 TTGTCTATGGTCTTTTTGTTAGG - Intergenic
1162489446 19:10983754-10983776 ATAGTCCTGTTCTTTCTGTTAGG + Intronic
1162541300 19:11297948-11297970 CTGGCTATTTTTTTTTTGTTGGG + Intronic
1162941136 19:14010127-14010149 ATGGCCATCTTGGTTTTGGTGGG - Intergenic
1164006357 19:21153183-21153205 ATCGCCATGTTAATTTTGGTGGG + Intronic
1164027401 19:21365209-21365231 ATTGCCATCTTGGTTTTGTTGGG + Intronic
1164540852 19:29120520-29120542 AGGGCCATGTGTTCTTTGTTTGG + Intergenic
1164904466 19:31955742-31955764 TTGGCAGTTTTCTTTTTGTTGGG - Intergenic
1164915628 19:32050236-32050258 ATGGCCATCTTGGTTTTGGTGGG - Intergenic
1165318150 19:35069238-35069260 ATGGCCATCTTGGTTTTGGTGGG + Intergenic
1165482947 19:36076255-36076277 AAGACCATGTTTTTTTTTTTGGG + Intronic
1167234497 19:48305758-48305780 CCGGCCCTGTTCTTTTTCTTGGG - Intronic
1168622563 19:57891067-57891089 ATGGCCATCTTGGTTTTGGTGGG - Intronic
925356169 2:3242969-3242991 ATGTACAAGTTCTTTATGTTGGG + Intronic
925513094 2:4649267-4649289 TTAGCCATGTTCTTGTTCTTAGG - Intergenic
926406421 2:12557683-12557705 ATGGCCATTTTGGTTTTGGTGGG + Intergenic
926719354 2:15947938-15947960 AAGGCCTTTTTCTTTTTTTTCGG - Intergenic
926865423 2:17351986-17352008 ATGGCCATGTTCCTTTTCAAAGG + Intergenic
927060552 2:19415275-19415297 ATGGCCATTTTCCTTTTGGGTGG + Intergenic
928158720 2:28901266-28901288 AGGGTCATTGTCTTTTTGTTGGG + Intronic
930157374 2:48119294-48119316 ATGGCCATTTTGGTTTTGGTGGG - Intergenic
930252988 2:49056740-49056762 TTGGCCATATTGTTTCTGTTAGG + Intronic
931329213 2:61262509-61262531 ATGGTCTTGTTCTTTTTTTATGG + Intronic
931369436 2:61648729-61648751 ATGGCCATCTTGGTTTTGGTGGG - Intergenic
931557884 2:63525062-63525084 ATGACCTTTTTCTTTTTTTTGGG - Intronic
933181774 2:79235497-79235519 ATGCCCATATTTCTTTTGTTAGG + Intronic
933632265 2:84671732-84671754 ATAGCCATGTCCTTGTGGTTGGG - Intronic
933644611 2:84800071-84800093 GTAGCAATGTTATTTTTGTTTGG - Intronic
933845306 2:86321497-86321519 TTGGCTATGTTATTTTTGTATGG - Intronic
935099801 2:99982523-99982545 ATGTTTATGTTCTTTTGGTTTGG - Intronic
935115025 2:100127987-100128009 ATGGCCATCTTGGTTTTGGTGGG - Intronic
937075889 2:119106156-119106178 ATGCCCATGTTCTTTGAGGTGGG - Intergenic
938693500 2:133814365-133814387 ATGGCCATCTTAGTTTTGGTGGG + Intergenic
939702864 2:145416036-145416058 ATGTACATGTTCATTCTGTTAGG + Intergenic
939901959 2:147861289-147861311 ATGGCCATGCTGTTTTGTTTAGG + Intronic
939965226 2:148604045-148604067 ATGGACATGTTCTCTGTGTGAGG - Intergenic
940455717 2:153897136-153897158 AGGGCAATATTCTTTTTCTTAGG - Intronic
940858236 2:158746472-158746494 ATGGGCATGGAGTTTTTGTTTGG - Intergenic
941089363 2:161157187-161157209 ATGGACATGTACTTTTTTGTTGG - Intronic
941278433 2:163519821-163519843 TTGGCCATGTTCAGTTTGATAGG - Intergenic
941298151 2:163766532-163766554 ATCGCCATGTTCTATTTTTCCGG - Intergenic
943181266 2:184544798-184544820 TTAACCATGTTCTTTGTGTTAGG - Intergenic
943398200 2:187369178-187369200 ATAGCCATGTCCATTTTGTATGG + Intronic
944552047 2:200853177-200853199 ATTGCCATGTTTATTTTGTTTGG - Exonic
946461898 2:219876296-219876318 ATGGCCATCTTGGTTTTGGTGGG - Intergenic
948569723 2:238910061-238910083 ATGGTCATCTTGTTTCTGTTTGG + Exonic
948606643 2:239139919-239139941 ATGGCCATGTTCTTTTTGTTGGG - Intronic
1168847781 20:957162-957184 CTGGCCATGTTCTTTCTTCTTGG - Intergenic
1169476719 20:5938422-5938444 ATAGACATGTTCTTATTCTTGGG + Exonic
1170520599 20:17180562-17180584 GTGCCCATGTTTCTTTTGTTGGG - Intergenic
1170634889 20:18095545-18095567 ATGGCCATTTCTTTTTTGTTGGG + Intergenic
1170868814 20:20185617-20185639 ATGGCCATGTCTTTTTCATTTGG + Intronic
1171546489 20:26005931-26005953 TTGGCGATTTTGTTTTTGTTTGG - Intergenic
1172035255 20:32006046-32006068 ATGGCCATCTTGGTTTTGGTGGG + Intergenic
1172664211 20:36587910-36587932 ATGCCCAGGTACTTTTTTTTTGG - Intronic
1173470277 20:43318360-43318382 ATGGCCATCAGATTTTTGTTGGG - Intergenic
1173700508 20:45066626-45066648 GTGGTCAAGTTCTCTTTGTTTGG + Intronic
1174122586 20:48277299-48277321 ATGGCCATCTTGGTTTTGGTGGG + Intergenic
1174322623 20:49754000-49754022 ATGCCCAGGTTTTTTTTTTTTGG + Intergenic
1174547971 20:51340594-51340616 ATGGCCATGTGCCTTTGGTTTGG - Intergenic
1174899152 20:54480342-54480364 ATGGCCATCTTGGTTTTGGTGGG - Intronic
1175481657 20:59315482-59315504 ATGAACATGTTCTATTTGTTGGG + Intronic
1176259599 20:64172540-64172562 ATGGCCATTTCCTTTCTTTTTGG + Intronic
1177900540 21:26909511-26909533 ATGACCATGTTCTAGTTTTTAGG - Intergenic
1178405330 21:32318544-32318566 AAGGCCTTGTTCTTTTTATCAGG + Intronic
1178611983 21:34090973-34090995 ATGCCCATGTTTTTTGTTTTTGG + Intronic
1179447943 21:41446419-41446441 ATTGCAATATTCTTTTTGTCTGG - Intronic
1182834959 22:33334438-33334460 ATGCCCTGTTTCTTTTTGTTTGG - Intronic
1183729054 22:39606987-39607009 ATGGCCATTTTGTTTCTGGTTGG - Intronic
1184161289 22:42698850-42698872 ATGGCCATTTTGGTTTTGGTGGG - Intronic
1184311697 22:43649634-43649656 TTAGCCATTCTCTTTTTGTTGGG - Intronic
1184544043 22:45153541-45153563 ATGGCTATTTTTTTTTTTTTTGG + Intergenic
949101641 3:152338-152360 ATTGACAAGTTCTTTTTTTTGGG - Intergenic
949176657 3:1071587-1071609 ATGACCAATTTCTTTTAGTTAGG - Intergenic
950764124 3:15260707-15260729 ATGCTCATGTTCCTTTTGCTGGG - Intronic
951684090 3:25325312-25325334 ATGGCCATCTTGGTTTTGGTGGG + Intronic
952219589 3:31311940-31311962 ATGGCCATCTTGGTTTTGGTGGG + Intergenic
952232170 3:31443661-31443683 ATGCCTATGATCTTTTTGCTGGG - Intergenic
952294439 3:32048878-32048900 ATTGCCATGTTGTTTTTGGTGGG - Intronic
955454592 3:59105812-59105834 GTGGCCATTTTGGTTTTGTTTGG - Intergenic
956414869 3:69014959-69014981 ATGGCCATCTTGGTTTTGGTGGG - Intergenic
957465498 3:80584820-80584842 AGGGTCATTTTCTTTTTTTTAGG + Intergenic
957539579 3:81550667-81550689 ATTGCCATGTTGGTTTTGGTGGG - Intronic
958037981 3:88192306-88192328 ATGGCCATTTTGGTTTTGGTGGG + Intergenic
958692436 3:97484937-97484959 ATGTCCATGTTATTGTTATTTGG - Intronic
960118960 3:113927323-113927345 GTGCCCATGTTTCTTTTGTTGGG + Intronic
960627881 3:119699250-119699272 ATGGCCATCTTGGTTTTGGTGGG - Intergenic
962225108 3:133599456-133599478 AGGCCCATGTGGTTTTTGTTTGG + Intronic
963475381 3:145797287-145797309 CTGGCTTTGTTCTTTTTGTTAGG + Intergenic
963589385 3:147237372-147237394 ATGGTCAGATTATTTTTGTTTGG + Intergenic
963744334 3:149110645-149110667 TTAGCCTTGTTCTTTTTTTTTGG - Intergenic
964281903 3:155076929-155076951 ATGGCCATCTTGGTTTTGGTAGG + Intronic
964566191 3:158055674-158055696 ATGGCCCTTTTTTTTTTTTTTGG - Intergenic
965164778 3:165182863-165182885 ATGGCCATCTTCTTTTATTTTGG - Intergenic
965562009 3:170071119-170071141 ATTGCTAGGCTCTTTTTGTTCGG + Intronic
966110869 3:176399787-176399809 ATTTTCCTGTTCTTTTTGTTGGG - Intergenic
966531033 3:180980373-180980395 ATTGGGATGTTCTTTTTTTTTGG + Exonic
966622103 3:181976574-181976596 ATGGCCATGTCCTTTGTGTCTGG - Intergenic
966817471 3:183900905-183900927 TTTGCCATATTCTATTTGTTGGG - Intergenic
967929120 3:194677886-194677908 AAGCCTATGTTCTTTGTGTTTGG + Intergenic
967960804 3:194922405-194922427 ATGGCCATCTTGGTTTTGGTGGG - Intergenic
968081390 3:195848988-195849010 ATGGCCATCTTGGTTTTGGTGGG + Intergenic
968295883 3:197576264-197576286 ATGGCCATTTTGATTTTGGTGGG + Intergenic
969420475 4:7091446-7091468 ATGGCCATTTTGGTTTTGGTGGG + Intergenic
969424750 4:7117645-7117667 ATGCCCATTTTCTTTTGTTTGGG + Intergenic
969635007 4:8363769-8363791 ATGGCCATCTTGGTTTTGGTGGG - Intergenic
969696056 4:8735500-8735522 ATGGCCATGTACTTTATTTGGGG + Intergenic
970532334 4:16997405-16997427 ATTGCCATCTTGCTTTTGTTGGG - Intergenic
971585776 4:28403950-28403972 TTGGCAATATTCTTTTTGTTTGG + Intergenic
971939979 4:33201460-33201482 AAGGCCTTTTTCTCTTTGTTAGG - Intergenic
972428502 4:38958022-38958044 TTGGCTATGATCTTTTTCTTAGG - Intergenic
973255884 4:48112848-48112870 ATGGCCTTTTTCTTTTTATGTGG + Intronic
975170239 4:71224461-71224483 ATAGCCATGTGGTTTTTTTTGGG + Intronic
975460346 4:74645347-74645369 CTGGCTTTGTTCTTTTTGCTTGG - Intergenic
975781903 4:77848869-77848891 ATTGCCATCTTCGTTTTGGTGGG + Intergenic
975884359 4:78946596-78946618 CTGAATATGTTCTTTTTGTTAGG + Intergenic
976446336 4:85134114-85134136 TTGGCCATATTATTTTTATTTGG - Intergenic
977374528 4:96184909-96184931 CTGGCCATGGTCATTGTGTTGGG + Intergenic
978228757 4:106371518-106371540 ATGTTCATGATGTTTTTGTTTGG + Intergenic
978800786 4:112753639-112753661 ATGGCCATCTTGGTTTTGGTGGG - Intergenic
978942571 4:114454364-114454386 ATGGCCATCTTGGTTTTGGTGGG + Intergenic
979361985 4:119775592-119775614 ATGGCCATCTTGGTTTTGGTGGG + Intergenic
979809300 4:125015282-125015304 ATGGCCTTTTTTTTTTTTTTTGG + Intergenic
979951020 4:126893791-126893813 CTGGCTTTTTTCTTTTTGTTGGG + Intergenic
980717148 4:136640727-136640749 GTGGCCATCTTGCTTTTGTTGGG + Intergenic
980837176 4:138209943-138209965 CTGGGTTTGTTCTTTTTGTTTGG - Intronic
981679785 4:147383722-147383744 ATGACCTTGTTCTTTTTTTATGG - Intergenic
981817069 4:148842896-148842918 ATGGCCATGATCTGTTGCTTTGG + Intergenic
981841402 4:149116834-149116856 ATGGCAATTTTCTTTGTATTTGG - Intergenic
982332414 4:154195633-154195655 CTGGCTCTGTTCTTTTTGTTTGG + Intergenic
982956006 4:161767181-161767203 ATGGGCATATTCTTTTTGACAGG - Intronic
983401190 4:167268373-167268395 TTGGCCATGTTGGTTTTGGTGGG - Intergenic
983674688 4:170279025-170279047 CTGGCCATGTTCTATTTCTGTGG - Intergenic
983735944 4:171060355-171060377 CTGGATATGTTCTTTGTGTTAGG + Intergenic
983950942 4:173640677-173640699 ATGGTCATCTTTTATTTGTTTGG + Intergenic
984717718 4:182941185-182941207 ATGGAGATGTTCTTGTTCTTAGG + Intergenic
986984484 5:13484801-13484823 ATGGCCATCTTCTCATTGTATGG + Intergenic
987339306 5:16925173-16925195 ATGGCCAAATTATTTCTGTTTGG - Intronic
987583608 5:19825576-19825598 GTGTCCATGTTTCTTTTGTTAGG - Intronic
988182728 5:27817913-27817935 ATGGCCATTTTGGTTTTGGTGGG - Intergenic
988514103 5:31890214-31890236 ATGGCGGTGTTCTTTCTGTGAGG + Intronic
990273063 5:54166501-54166523 TTGCTCATGTTCCTTTTGTTTGG + Intronic
993771934 5:91939228-91939250 ATGGCCATTTTGGTTTTGGTGGG + Intergenic
995251879 5:110002782-110002804 TTGGCCATATTCTTGTTGTCTGG - Intergenic
996127467 5:119743164-119743186 ATGTCCATGTTCTAGTTATTTGG + Intergenic
996306395 5:122053039-122053061 ATGCCCATGTTTCTTTTGTTGGG + Intronic
996378742 5:122843266-122843288 TTTGCCATGTTCTTTTACTTTGG + Intergenic
996454552 5:123665512-123665534 TTTGCCATGTTCTTTTCTTTAGG + Intergenic
997249045 5:132374757-132374779 CTGGCCATTTTTTTTTTTTTTGG - Intronic
998201307 5:140125131-140125153 ATGGGCATTTTTTTTTTCTTGGG - Exonic
998978280 5:147672275-147672297 ACGACCATGTTCCTTATGTTTGG - Intronic
999912608 5:156220907-156220929 ATGGGCATGTTCATTTTGTGTGG + Intronic
1000296725 5:159918668-159918690 ATGTTCGTCTTCTTTTTGTTTGG + Intronic
1003118233 6:3297656-3297678 CTGGCCATGACCTATTTGTTGGG - Intronic
1005194627 6:23268759-23268781 ATAACGATGTGCTTTTTGTTTGG - Intergenic
1005448575 6:25951600-25951622 GTGGCCATGTTGGTTTTGGTGGG + Intergenic
1005448983 6:25954797-25954819 GTGGCCATGTTGGTTTTGATGGG + Intergenic
1005776952 6:29144191-29144213 ATCGCCATCTTGTTTTTGGTGGG - Intergenic
1006213393 6:32416449-32416471 GTGGCCATGTTGGTTTTGGTGGG + Intergenic
1007939237 6:45761885-45761907 ATGACCAGTATCTTTTTGTTTGG - Intergenic
1009831596 6:68943891-68943913 ATGACCTTGTTCTTGTTCTTTGG - Exonic
1010446001 6:75949315-75949337 ATGGCCATCTTGGTTTTGGTAGG - Intronic
1010810046 6:80290362-80290384 GTGCCCATGTTTCTTTTGTTAGG - Intronic
1010981909 6:82378090-82378112 AGGGCCTTGTACTTTTTGTTGGG + Intergenic
1011772930 6:90694936-90694958 ATAACCATGTTCTGTGTGTTTGG - Intergenic
1011897383 6:92246818-92246840 AGCGGCAGGTTCTTTTTGTTGGG + Intergenic
1012349150 6:98229956-98229978 ATGGCCTTGTTCTCTTTGTAGGG + Intergenic
1012640157 6:101600341-101600363 CTGGCTTTGTTCTTTTTCTTAGG + Intronic
1013208313 6:107964605-107964627 ATTGCCATCTTGGTTTTGTTGGG + Intergenic
1013701409 6:112774412-112774434 ATGACCATCTTGTTTTTGGTGGG - Intergenic
1015084959 6:129279446-129279468 ATGGCAAGGTTGCTTTTGTTTGG + Intronic
1017808702 6:157968294-157968316 AGGGACATATTCTTTTTTTTGGG + Intergenic
1018614059 6:165669334-165669356 GTGGCCATATTCATTTTATTTGG + Intronic
1018680974 6:166264671-166264693 TTGACCATGTTCTTTGTTTTTGG + Intergenic
1019140638 6:169940240-169940262 GTGGACATGTTTGTTTTGTTTGG - Intergenic
1019450464 7:1095139-1095161 ATGGCCATGTCCTTTTAGCTGGG - Intronic
1020021572 7:4872468-4872490 AGGGCCATGTGGTTTTTGTCAGG - Intronic
1023514919 7:40992353-40992375 ATGGCCATCTTGATTTTGGTGGG + Intergenic
1023580252 7:41674380-41674402 ATGGCCATTTTTTTTTTGTTTGG + Intergenic
1024484782 7:49905848-49905870 ATGGCCATCTTGGTTTTGGTGGG - Intronic
1024789995 7:52955214-52955236 ATAGCTTTGTTCTTTTTGTAAGG + Intergenic
1025997617 7:66537922-66537944 ATGCCCAGGTTTTTTTTTTTTGG + Intergenic
1026306699 7:69148616-69148638 ATTGCCATCTTGGTTTTGTTGGG + Intergenic
1026559741 7:71438758-71438780 ATAGCCCTTTTCTTTTTATTTGG + Intronic
1027365032 7:77448323-77448345 ATGGCCATCTTGGTTTTGGTGGG + Intergenic
1027728062 7:81832364-81832386 CTCTCCATGTTCTTTTTCTTTGG - Intergenic
1028801638 7:94972221-94972243 ATGGTCTTGTTATTTTTATTAGG + Intronic
1029807372 7:103010885-103010907 ATGCCCATGTTTCTTTTGTTGGG - Intronic
1030469970 7:109951609-109951631 ATGGCCATTTTGTTTTTGGTGGG - Intergenic
1031815643 7:126431536-126431558 TTGGCCCTGATCTTTCTGTTTGG + Intergenic
1031906600 7:127466738-127466760 CTGGGAATATTCTTTTTGTTGGG - Intergenic
1032671900 7:134091419-134091441 ATGGCCATCTTGGTTTTGGTAGG + Intergenic
1032959539 7:137015592-137015614 CTGGGCATGTTGTTATTGTTTGG - Exonic
1033578345 7:142708615-142708637 ATGGCCATATTGGTTTTGGTGGG - Intergenic
1033727453 7:144134038-144134060 AGGGCCATGTTATTTTGGGTGGG + Intergenic
1033729612 7:144163134-144163156 AGGGCCTTGTACTTTTTGTTCGG + Intergenic
1033859172 7:145604076-145604098 ACTGCCATGTTCTGTTGGTTAGG + Intergenic
1039287517 8:36058465-36058487 ATGGCCATCTTAGTTTTGGTGGG + Intergenic
1039609102 8:38904841-38904863 ATGACCATGTACTCCTTGTTAGG + Intronic
1042455895 8:69002226-69002248 ATTGCCATGTTGGTTTTGGTGGG - Intergenic
1042461850 8:69079123-69079145 ATTGTTATGTTCTTTCTGTTTGG + Intergenic
1043301675 8:78742486-78742508 TTGGCTAAGTTCTTTTTTTTAGG + Intronic
1044413324 8:91909531-91909553 ATGGCCATCTTCTTGCTGCTTGG - Intergenic
1044414713 8:91924599-91924621 ATTGCCATCTTGTTTTTGGTGGG - Intergenic
1044498258 8:92917708-92917730 ATTTACATGTTCTTTGTGTTGGG + Intronic
1045688517 8:104736596-104736618 ATGGCCATTTTGGTTTTGGTAGG - Intronic
1045730743 8:105237826-105237848 TTGTCCTTGTACTTTTTGTTCGG + Intronic
1046107078 8:109679053-109679075 ATGGCCATCTTGGTTTTGGTGGG - Intronic
1046389182 8:113545868-113545890 ATGGCCATTTTGTTTTATTTGGG - Intergenic
1046583991 8:116128875-116128897 ATGGCAATGTTCTTTGTCTAAGG + Intergenic
1047786739 8:128160734-128160756 TTGTCCATTTTTTTTTTGTTAGG + Intergenic
1048073545 8:131043737-131043759 ATTCCGATGTTCTTCTTGTTGGG + Intergenic
1048324366 8:133427795-133427817 ATTGCCATCTTGGTTTTGTTGGG - Intergenic
1048875248 8:138832034-138832056 ATGGCCATTTTGGTTTTGGTGGG - Intronic
1050395001 9:5186226-5186248 ATGGCCATGTGCGTTTAGTCAGG + Intergenic
1050735025 9:8752271-8752293 ATGGCCATCTTGGTTTTGGTGGG - Intronic
1050761061 9:9071411-9071433 AAGGCCTAGTTCTTTTTGTAAGG - Intronic
1051118399 9:13724271-13724293 TTGGGCATTTTATTTTTGTTTGG - Intergenic
1051812727 9:21068470-21068492 ATGCCCATGGACTTTGTGTTAGG + Intergenic
1051859611 9:21609504-21609526 ATTGCCATCTTGTTTTTGGTGGG - Intergenic
1052100676 9:24442387-24442409 CTGGCCCTGTTCTTTTTACTTGG - Intergenic
1052516885 9:29493055-29493077 TTGGCCATGTTATTATTCTTTGG + Intergenic
1052782964 9:32799521-32799543 AAGACCATGTTCTTTTGGTCAGG - Intergenic
1054146880 9:61568739-61568761 TTGGCGATTTTGTTTTTGTTTGG - Intergenic
1054186731 9:61958265-61958287 TTGGCGATTTTGTTTTTGTTTGG + Intergenic
1054466618 9:65499794-65499816 TTGGCGATTTTGTTTTTGTTTGG - Intergenic
1054651774 9:67630255-67630277 TTGGCGATTTTGTTTTTGTTTGG - Intergenic
1055085275 9:72307497-72307519 ATGGCAATTTTCTTTTTGAAAGG + Intergenic
1056097534 9:83270837-83270859 ATGGTCATTTTTTTTTTTTTTGG + Intronic
1056528671 9:87467824-87467846 GTGGCCATGTTGGTTTTGGTGGG - Intergenic
1056892547 9:90509342-90509364 ATGGCCATCTTGGTTTTGGTGGG - Intergenic
1058217488 9:102253398-102253420 TGGGCCATGTTCTTTCTGTTAGG - Intergenic
1058327212 9:103713735-103713757 ATTGCCATATTCTACTTGTTAGG - Intergenic
1058474314 9:105316074-105316096 CTGGCCATCTTCTTTGAGTTAGG + Intronic
1058710614 9:107675805-107675827 ATGGCCATCTTGGTTTTGGTGGG + Intergenic
1059033406 9:110726662-110726684 ATGGCCATGGTGTTTTTATAGGG - Intronic
1060090006 9:120734288-120734310 AAGTCCATGTTCTTTTTTGTGGG + Intergenic
1060127998 9:121068678-121068700 CTAGCTTTGTTCTTTTTGTTCGG - Intergenic
1186057584 X:5666453-5666475 GTGGCCATCTTGTTTTTGGTGGG - Intergenic
1187404526 X:18991270-18991292 ATGGCAGTTTTTTTTTTGTTTGG + Intronic
1187451070 X:19396865-19396887 ATTGCAATGCTCATTTTGTTGGG + Intronic
1188213137 X:27446810-27446832 GTGGCCATCTTGTTTTTGTTGGG + Intergenic
1188252975 X:27922287-27922309 ATAGCCATTTTATTTTTGTGTGG - Intergenic
1188528365 X:31110640-31110662 ACAGCAATGTTCTTTTTGGTTGG + Intronic
1189393475 X:40598482-40598504 ATGGCCATCACCTTTTTGTTAGG + Intronic
1189872191 X:45395629-45395651 CTGGCTTTGTTCTTTTTGCTTGG + Intergenic
1190497870 X:51044080-51044102 ATGGCCATTTTCACTTTGATGGG + Intergenic
1190820027 X:53965134-53965156 ACGTGCATGTTCTTTTTTTTTGG - Intronic
1191815063 X:65235016-65235038 ATGGCCTTGTTCATTCTTTTTGG + Intergenic
1192849657 X:74941930-74941952 ATGCCCATGTTTCTTTTGTTGGG + Intergenic
1193479455 X:82010009-82010031 ATGCCTATGTTCCTTTTGTTGGG + Intergenic
1193773330 X:85613963-85613985 CTGGCTTTGTTCTTTTTGCTGGG + Intergenic
1194004996 X:88480230-88480252 ATGGCCATTTACATTTTGTATGG - Intergenic
1194552184 X:95314824-95314846 CTGGCTTTGTTCTTTTTGCTTGG + Intergenic
1195840373 X:109169826-109169848 ATGGCCATGTACATTTTGCATGG + Intergenic
1195930197 X:110066724-110066746 AGGACAAGGTTCTTTTTGTTTGG + Intronic
1196138530 X:112235420-112235442 ATAGCCATGTTCCTTTGGTTGGG + Intergenic
1196342628 X:114613412-114613434 ATGGCCATCTTGGTTTTGGTGGG + Intronic
1196526010 X:116727681-116727703 TTGGCCAAGTTTTTTTTATTTGG + Intergenic
1197127843 X:122968906-122968928 CTTGCCATGTTCTTTTCTTTTGG - Intergenic
1198036889 X:132809633-132809655 CTGTCCATGTTCTCTTTGCTTGG + Intronic
1198720917 X:139619170-139619192 ATGCCCTTGTTCTTATTGGTGGG + Intronic
1198844983 X:140900700-140900722 GTGGCCATCTTGGTTTTGTTGGG + Intergenic
1200780374 Y:7210191-7210213 AGGGCAATGTTCTTCTTCTTGGG - Intergenic
1200785996 Y:7260949-7260971 ATGGCCATCTTGGTTTTGGTGGG - Intergenic
1200910377 Y:8526546-8526568 TTGGTCATGGTCTCTTTGTTGGG + Intergenic
1202054527 Y:20815471-20815493 ATGCCTATGTTTCTTTTGTTGGG - Intergenic