ID: 948607579

View in Genome Browser
Species Human (GRCh38)
Location 2:239145990-239146012
Sequence ACCTTCTCACAGCGCCTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 112}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948607579_948607588 29 Left 948607579 2:239145990-239146012 CCAGAGAGGCGCTGTGAGAAGGT 0: 1
1: 0
2: 1
3: 10
4: 112
Right 948607588 2:239146042-239146064 GGCCTCTGTGCTGTGGCACGGGG 0: 1
1: 1
2: 3
3: 25
4: 233
948607579_948607586 27 Left 948607579 2:239145990-239146012 CCAGAGAGGCGCTGTGAGAAGGT 0: 1
1: 0
2: 1
3: 10
4: 112
Right 948607586 2:239146040-239146062 GAGGCCTCTGTGCTGTGGCACGG 0: 1
1: 0
2: 2
3: 44
4: 398
948607579_948607583 8 Left 948607579 2:239145990-239146012 CCAGAGAGGCGCTGTGAGAAGGT 0: 1
1: 0
2: 1
3: 10
4: 112
Right 948607583 2:239146021-239146043 CTAAGCCTCTGCAGGGAGCGAGG 0: 1
1: 0
2: 2
3: 21
4: 183
948607579_948607589 30 Left 948607579 2:239145990-239146012 CCAGAGAGGCGCTGTGAGAAGGT 0: 1
1: 0
2: 1
3: 10
4: 112
Right 948607589 2:239146043-239146065 GCCTCTGTGCTGTGGCACGGGGG 0: 1
1: 0
2: 1
3: 16
4: 192
948607579_948607580 0 Left 948607579 2:239145990-239146012 CCAGAGAGGCGCTGTGAGAAGGT 0: 1
1: 0
2: 1
3: 10
4: 112
Right 948607580 2:239146013-239146035 ACCAGACTCTAAGCCTCTGCAGG 0: 1
1: 0
2: 0
3: 16
4: 181
948607579_948607582 1 Left 948607579 2:239145990-239146012 CCAGAGAGGCGCTGTGAGAAGGT 0: 1
1: 0
2: 1
3: 10
4: 112
Right 948607582 2:239146014-239146036 CCAGACTCTAAGCCTCTGCAGGG 0: 1
1: 0
2: 1
3: 27
4: 206
948607579_948607585 22 Left 948607579 2:239145990-239146012 CCAGAGAGGCGCTGTGAGAAGGT 0: 1
1: 0
2: 1
3: 10
4: 112
Right 948607585 2:239146035-239146057 GGAGCGAGGCCTCTGTGCTGTGG 0: 1
1: 0
2: 0
3: 31
4: 308
948607579_948607587 28 Left 948607579 2:239145990-239146012 CCAGAGAGGCGCTGTGAGAAGGT 0: 1
1: 0
2: 1
3: 10
4: 112
Right 948607587 2:239146041-239146063 AGGCCTCTGTGCTGTGGCACGGG 0: 1
1: 0
2: 4
3: 187
4: 2973

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948607579 Original CRISPR ACCTTCTCACAGCGCCTCTC TGG (reversed) Intronic