ID: 948607580

View in Genome Browser
Species Human (GRCh38)
Location 2:239146013-239146035
Sequence ACCAGACTCTAAGCCTCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 181}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948607572_948607580 25 Left 948607572 2:239145965-239145987 CCCTAAAACAGCCTTCCCAGAGA 0: 1
1: 0
2: 3
3: 20
4: 270
Right 948607580 2:239146013-239146035 ACCAGACTCTAAGCCTCTGCAGG 0: 1
1: 0
2: 0
3: 16
4: 181
948607574_948607580 14 Left 948607574 2:239145976-239145998 CCTTCCCAGAGAAACCAGAGAGG 0: 1
1: 0
2: 1
3: 35
4: 284
Right 948607580 2:239146013-239146035 ACCAGACTCTAAGCCTCTGCAGG 0: 1
1: 0
2: 0
3: 16
4: 181
948607573_948607580 24 Left 948607573 2:239145966-239145988 CCTAAAACAGCCTTCCCAGAGAA 0: 1
1: 0
2: 0
3: 24
4: 267
Right 948607580 2:239146013-239146035 ACCAGACTCTAAGCCTCTGCAGG 0: 1
1: 0
2: 0
3: 16
4: 181
948607579_948607580 0 Left 948607579 2:239145990-239146012 CCAGAGAGGCGCTGTGAGAAGGT 0: 1
1: 0
2: 1
3: 10
4: 112
Right 948607580 2:239146013-239146035 ACCAGACTCTAAGCCTCTGCAGG 0: 1
1: 0
2: 0
3: 16
4: 181
948607577_948607580 9 Left 948607577 2:239145981-239146003 CCAGAGAAACCAGAGAGGCGCTG 0: 1
1: 0
2: 2
3: 19
4: 162
Right 948607580 2:239146013-239146035 ACCAGACTCTAAGCCTCTGCAGG 0: 1
1: 0
2: 0
3: 16
4: 181
948607576_948607580 10 Left 948607576 2:239145980-239146002 CCCAGAGAAACCAGAGAGGCGCT 0: 1
1: 0
2: 1
3: 17
4: 133
Right 948607580 2:239146013-239146035 ACCAGACTCTAAGCCTCTGCAGG 0: 1
1: 0
2: 0
3: 16
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948607580 Original CRISPR ACCAGACTCTAAGCCTCTGC AGG Intronic