ID: 948607581

View in Genome Browser
Species Human (GRCh38)
Location 2:239146014-239146036
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 192}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948607581_948607591 12 Left 948607581 2:239146014-239146036 CCAGACTCTAAGCCTCTGCAGGG 0: 1
1: 0
2: 3
3: 19
4: 192
Right 948607591 2:239146049-239146071 GTGCTGTGGCACGGGGGACCTGG 0: 1
1: 0
2: 0
3: 12
4: 193
948607581_948607589 6 Left 948607581 2:239146014-239146036 CCAGACTCTAAGCCTCTGCAGGG 0: 1
1: 0
2: 3
3: 19
4: 192
Right 948607589 2:239146043-239146065 GCCTCTGTGCTGTGGCACGGGGG 0: 1
1: 0
2: 1
3: 16
4: 192
948607581_948607586 3 Left 948607581 2:239146014-239146036 CCAGACTCTAAGCCTCTGCAGGG 0: 1
1: 0
2: 3
3: 19
4: 192
Right 948607586 2:239146040-239146062 GAGGCCTCTGTGCTGTGGCACGG 0: 1
1: 0
2: 2
3: 44
4: 398
948607581_948607587 4 Left 948607581 2:239146014-239146036 CCAGACTCTAAGCCTCTGCAGGG 0: 1
1: 0
2: 3
3: 19
4: 192
Right 948607587 2:239146041-239146063 AGGCCTCTGTGCTGTGGCACGGG 0: 1
1: 0
2: 4
3: 187
4: 2973
948607581_948607588 5 Left 948607581 2:239146014-239146036 CCAGACTCTAAGCCTCTGCAGGG 0: 1
1: 0
2: 3
3: 19
4: 192
Right 948607588 2:239146042-239146064 GGCCTCTGTGCTGTGGCACGGGG 0: 1
1: 1
2: 3
3: 25
4: 233
948607581_948607592 29 Left 948607581 2:239146014-239146036 CCAGACTCTAAGCCTCTGCAGGG 0: 1
1: 0
2: 3
3: 19
4: 192
Right 948607592 2:239146066-239146088 ACCTGGATGACGACAGATGACGG 0: 1
1: 0
2: 0
3: 4
4: 94
948607581_948607585 -2 Left 948607581 2:239146014-239146036 CCAGACTCTAAGCCTCTGCAGGG 0: 1
1: 0
2: 3
3: 19
4: 192
Right 948607585 2:239146035-239146057 GGAGCGAGGCCTCTGTGCTGTGG 0: 1
1: 0
2: 0
3: 31
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948607581 Original CRISPR CCCTGCAGAGGCTTAGAGTC TGG (reversed) Intronic