ID: 948607583

View in Genome Browser
Species Human (GRCh38)
Location 2:239146021-239146043
Sequence CTAAGCCTCTGCAGGGAGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 183}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948607576_948607583 18 Left 948607576 2:239145980-239146002 CCCAGAGAAACCAGAGAGGCGCT 0: 1
1: 0
2: 1
3: 17
4: 133
Right 948607583 2:239146021-239146043 CTAAGCCTCTGCAGGGAGCGAGG 0: 1
1: 0
2: 2
3: 21
4: 183
948607574_948607583 22 Left 948607574 2:239145976-239145998 CCTTCCCAGAGAAACCAGAGAGG 0: 1
1: 0
2: 1
3: 35
4: 284
Right 948607583 2:239146021-239146043 CTAAGCCTCTGCAGGGAGCGAGG 0: 1
1: 0
2: 2
3: 21
4: 183
948607577_948607583 17 Left 948607577 2:239145981-239146003 CCAGAGAAACCAGAGAGGCGCTG 0: 1
1: 0
2: 2
3: 19
4: 162
Right 948607583 2:239146021-239146043 CTAAGCCTCTGCAGGGAGCGAGG 0: 1
1: 0
2: 2
3: 21
4: 183
948607579_948607583 8 Left 948607579 2:239145990-239146012 CCAGAGAGGCGCTGTGAGAAGGT 0: 1
1: 0
2: 1
3: 10
4: 112
Right 948607583 2:239146021-239146043 CTAAGCCTCTGCAGGGAGCGAGG 0: 1
1: 0
2: 2
3: 21
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948607583 Original CRISPR CTAAGCCTCTGCAGGGAGCG AGG Intronic