ID: 948607584

View in Genome Browser
Species Human (GRCh38)
Location 2:239146026-239146048
Sequence AGAGGCCTCGCTCCCTGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 197}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948607584_948607586 -9 Left 948607584 2:239146026-239146048 CCTCTGCAGGGAGCGAGGCCTCT 0: 1
1: 0
2: 1
3: 18
4: 197
Right 948607586 2:239146040-239146062 GAGGCCTCTGTGCTGTGGCACGG 0: 1
1: 0
2: 2
3: 44
4: 398
948607584_948607591 0 Left 948607584 2:239146026-239146048 CCTCTGCAGGGAGCGAGGCCTCT 0: 1
1: 0
2: 1
3: 18
4: 197
Right 948607591 2:239146049-239146071 GTGCTGTGGCACGGGGGACCTGG 0: 1
1: 0
2: 0
3: 12
4: 193
948607584_948607592 17 Left 948607584 2:239146026-239146048 CCTCTGCAGGGAGCGAGGCCTCT 0: 1
1: 0
2: 1
3: 18
4: 197
Right 948607592 2:239146066-239146088 ACCTGGATGACGACAGATGACGG 0: 1
1: 0
2: 0
3: 4
4: 94
948607584_948607588 -7 Left 948607584 2:239146026-239146048 CCTCTGCAGGGAGCGAGGCCTCT 0: 1
1: 0
2: 1
3: 18
4: 197
Right 948607588 2:239146042-239146064 GGCCTCTGTGCTGTGGCACGGGG 0: 1
1: 1
2: 3
3: 25
4: 233
948607584_948607589 -6 Left 948607584 2:239146026-239146048 CCTCTGCAGGGAGCGAGGCCTCT 0: 1
1: 0
2: 1
3: 18
4: 197
Right 948607589 2:239146043-239146065 GCCTCTGTGCTGTGGCACGGGGG 0: 1
1: 0
2: 1
3: 16
4: 192
948607584_948607587 -8 Left 948607584 2:239146026-239146048 CCTCTGCAGGGAGCGAGGCCTCT 0: 1
1: 0
2: 1
3: 18
4: 197
Right 948607587 2:239146041-239146063 AGGCCTCTGTGCTGTGGCACGGG 0: 1
1: 0
2: 4
3: 187
4: 2973

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948607584 Original CRISPR AGAGGCCTCGCTCCCTGCAG AGG (reversed) Intronic