ID: 948607585

View in Genome Browser
Species Human (GRCh38)
Location 2:239146035-239146057
Sequence GGAGCGAGGCCTCTGTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 308}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948607579_948607585 22 Left 948607579 2:239145990-239146012 CCAGAGAGGCGCTGTGAGAAGGT 0: 1
1: 0
2: 1
3: 10
4: 112
Right 948607585 2:239146035-239146057 GGAGCGAGGCCTCTGTGCTGTGG 0: 1
1: 0
2: 0
3: 31
4: 308
948607581_948607585 -2 Left 948607581 2:239146014-239146036 CCAGACTCTAAGCCTCTGCAGGG 0: 1
1: 0
2: 3
3: 19
4: 192
Right 948607585 2:239146035-239146057 GGAGCGAGGCCTCTGTGCTGTGG 0: 1
1: 0
2: 0
3: 31
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948607585 Original CRISPR GGAGCGAGGCCTCTGTGCTG TGG Intronic