ID: 948607586

View in Genome Browser
Species Human (GRCh38)
Location 2:239146040-239146062
Sequence GAGGCCTCTGTGCTGTGGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 445
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 398}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948607579_948607586 27 Left 948607579 2:239145990-239146012 CCAGAGAGGCGCTGTGAGAAGGT 0: 1
1: 0
2: 1
3: 10
4: 112
Right 948607586 2:239146040-239146062 GAGGCCTCTGTGCTGTGGCACGG 0: 1
1: 0
2: 2
3: 44
4: 398
948607584_948607586 -9 Left 948607584 2:239146026-239146048 CCTCTGCAGGGAGCGAGGCCTCT 0: 1
1: 0
2: 1
3: 18
4: 197
Right 948607586 2:239146040-239146062 GAGGCCTCTGTGCTGTGGCACGG 0: 1
1: 0
2: 2
3: 44
4: 398
948607581_948607586 3 Left 948607581 2:239146014-239146036 CCAGACTCTAAGCCTCTGCAGGG 0: 1
1: 0
2: 3
3: 19
4: 192
Right 948607586 2:239146040-239146062 GAGGCCTCTGTGCTGTGGCACGG 0: 1
1: 0
2: 2
3: 44
4: 398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948607586 Original CRISPR GAGGCCTCTGTGCTGTGGCA CGG Intronic