ID: 948607587

View in Genome Browser
Species Human (GRCh38)
Location 2:239146041-239146063
Sequence AGGCCTCTGTGCTGTGGCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3165
Summary {0: 1, 1: 0, 2: 4, 3: 187, 4: 2973}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948607579_948607587 28 Left 948607579 2:239145990-239146012 CCAGAGAGGCGCTGTGAGAAGGT 0: 1
1: 0
2: 1
3: 10
4: 112
Right 948607587 2:239146041-239146063 AGGCCTCTGTGCTGTGGCACGGG 0: 1
1: 0
2: 4
3: 187
4: 2973
948607584_948607587 -8 Left 948607584 2:239146026-239146048 CCTCTGCAGGGAGCGAGGCCTCT 0: 1
1: 0
2: 1
3: 18
4: 197
Right 948607587 2:239146041-239146063 AGGCCTCTGTGCTGTGGCACGGG 0: 1
1: 0
2: 4
3: 187
4: 2973
948607581_948607587 4 Left 948607581 2:239146014-239146036 CCAGACTCTAAGCCTCTGCAGGG 0: 1
1: 0
2: 3
3: 19
4: 192
Right 948607587 2:239146041-239146063 AGGCCTCTGTGCTGTGGCACGGG 0: 1
1: 0
2: 4
3: 187
4: 2973

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948607587 Original CRISPR AGGCCTCTGTGCTGTGGCAC GGG Intronic