ID: 948607588

View in Genome Browser
Species Human (GRCh38)
Location 2:239146042-239146064
Sequence GGCCTCTGTGCTGTGGCACG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 1, 2: 3, 3: 25, 4: 233}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948607584_948607588 -7 Left 948607584 2:239146026-239146048 CCTCTGCAGGGAGCGAGGCCTCT 0: 1
1: 0
2: 1
3: 18
4: 197
Right 948607588 2:239146042-239146064 GGCCTCTGTGCTGTGGCACGGGG 0: 1
1: 1
2: 3
3: 25
4: 233
948607579_948607588 29 Left 948607579 2:239145990-239146012 CCAGAGAGGCGCTGTGAGAAGGT 0: 1
1: 0
2: 1
3: 10
4: 112
Right 948607588 2:239146042-239146064 GGCCTCTGTGCTGTGGCACGGGG 0: 1
1: 1
2: 3
3: 25
4: 233
948607581_948607588 5 Left 948607581 2:239146014-239146036 CCAGACTCTAAGCCTCTGCAGGG 0: 1
1: 0
2: 3
3: 19
4: 192
Right 948607588 2:239146042-239146064 GGCCTCTGTGCTGTGGCACGGGG 0: 1
1: 1
2: 3
3: 25
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948607588 Original CRISPR GGCCTCTGTGCTGTGGCACG GGG Intronic