ID: 948607590

View in Genome Browser
Species Human (GRCh38)
Location 2:239146044-239146066
Sequence TCCCCCGTGCCACAGCACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 188}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948607590_948607594 16 Left 948607590 2:239146044-239146066 CCTCTGTGCTGTGGCACGGGGGA 0: 1
1: 0
2: 1
3: 13
4: 188
Right 948607594 2:239146083-239146105 TGACGGATTCAGCCACAAGCCGG 0: 1
1: 0
2: 0
3: 3
4: 52
948607590_948607592 -1 Left 948607590 2:239146044-239146066 CCTCTGTGCTGTGGCACGGGGGA 0: 1
1: 0
2: 1
3: 13
4: 188
Right 948607592 2:239146066-239146088 ACCTGGATGACGACAGATGACGG 0: 1
1: 0
2: 0
3: 4
4: 94
948607590_948607595 27 Left 948607590 2:239146044-239146066 CCTCTGTGCTGTGGCACGGGGGA 0: 1
1: 0
2: 1
3: 13
4: 188
Right 948607595 2:239146094-239146116 GCCACAAGCCGGCCTCTCCACGG 0: 1
1: 0
2: 0
3: 13
4: 126
948607590_948607597 28 Left 948607590 2:239146044-239146066 CCTCTGTGCTGTGGCACGGGGGA 0: 1
1: 0
2: 1
3: 13
4: 188
Right 948607597 2:239146095-239146117 CCACAAGCCGGCCTCTCCACGGG 0: 1
1: 0
2: 1
3: 5
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948607590 Original CRISPR TCCCCCGTGCCACAGCACAG AGG (reversed) Intronic