ID: 948607591

View in Genome Browser
Species Human (GRCh38)
Location 2:239146049-239146071
Sequence GTGCTGTGGCACGGGGGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 193}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948607581_948607591 12 Left 948607581 2:239146014-239146036 CCAGACTCTAAGCCTCTGCAGGG 0: 1
1: 0
2: 3
3: 19
4: 192
Right 948607591 2:239146049-239146071 GTGCTGTGGCACGGGGGACCTGG 0: 1
1: 0
2: 0
3: 12
4: 193
948607584_948607591 0 Left 948607584 2:239146026-239146048 CCTCTGCAGGGAGCGAGGCCTCT 0: 1
1: 0
2: 1
3: 18
4: 197
Right 948607591 2:239146049-239146071 GTGCTGTGGCACGGGGGACCTGG 0: 1
1: 0
2: 0
3: 12
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948607591 Original CRISPR GTGCTGTGGCACGGGGGACC TGG Intronic