ID: 948607592

View in Genome Browser
Species Human (GRCh38)
Location 2:239146066-239146088
Sequence ACCTGGATGACGACAGATGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 94}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948607584_948607592 17 Left 948607584 2:239146026-239146048 CCTCTGCAGGGAGCGAGGCCTCT 0: 1
1: 0
2: 1
3: 18
4: 197
Right 948607592 2:239146066-239146088 ACCTGGATGACGACAGATGACGG 0: 1
1: 0
2: 0
3: 4
4: 94
948607581_948607592 29 Left 948607581 2:239146014-239146036 CCAGACTCTAAGCCTCTGCAGGG 0: 1
1: 0
2: 3
3: 19
4: 192
Right 948607592 2:239146066-239146088 ACCTGGATGACGACAGATGACGG 0: 1
1: 0
2: 0
3: 4
4: 94
948607590_948607592 -1 Left 948607590 2:239146044-239146066 CCTCTGTGCTGTGGCACGGGGGA 0: 1
1: 0
2: 1
3: 13
4: 188
Right 948607592 2:239146066-239146088 ACCTGGATGACGACAGATGACGG 0: 1
1: 0
2: 0
3: 4
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948607592 Original CRISPR ACCTGGATGACGACAGATGA CGG Intronic