ID: 948608645

View in Genome Browser
Species Human (GRCh38)
Location 2:239152757-239152779
Sequence CTGTAGGCATGGAGGCAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 315}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948608636_948608645 23 Left 948608636 2:239152711-239152733 CCTTCTCTAAGTGGAGGTGAGTG 0: 1
1: 0
2: 1
3: 8
4: 127
Right 948608645 2:239152757-239152779 CTGTAGGCATGGAGGCAAGGAGG 0: 1
1: 0
2: 2
3: 40
4: 315
948608639_948608645 -3 Left 948608639 2:239152737-239152759 CCTGCTGGTTTCTACCTGAACTG 0: 1
1: 0
2: 0
3: 10
4: 161
Right 948608645 2:239152757-239152779 CTGTAGGCATGGAGGCAAGGAGG 0: 1
1: 0
2: 2
3: 40
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948608645 Original CRISPR CTGTAGGCATGGAGGCAAGG AGG Intronic
900131844 1:1090580-1090602 CTGTGGGCCTGGGAGCAAGGAGG + Intronic
900536563 1:3180658-3180680 CTTGAGGGAGGGAGGCAAGGGGG + Intronic
900993178 1:6107155-6107177 ATGGAGGGATGGAGGGAAGGTGG + Intronic
900993620 1:6108906-6108928 ATGGAGGCATGGAGGGATGGAGG + Intronic
902098708 1:13967468-13967490 GTGTAGGCATGGAGACAGTGTGG + Intergenic
902278564 1:15357697-15357719 CTGGAGCCCTGGAGGAAAGGGGG + Intronic
902503725 1:16926419-16926441 CTGTGGCCATGGGGACAAGGGGG - Intronic
902580391 1:17404208-17404230 CAGTAGGCAGGGATGCAGGGAGG - Intergenic
902592573 1:17485551-17485573 ATGTTGGCAGGAAGGCAAGGTGG + Intergenic
902701015 1:18172051-18172073 CTGTAAGCATGGCTGCAAGGTGG - Intronic
903670257 1:25031201-25031223 CTGGAGGGATGGAGGGATGGAGG + Intergenic
904499586 1:30906544-30906566 CTTTAGACTTGGAGGCCAGGTGG - Intronic
904599879 1:31667443-31667465 CTGCAGGCTTGGGGGCAGGGGGG + Intronic
904676545 1:32202150-32202172 CTGTAGAGAGGAAGGCAAGGGGG + Intronic
905295012 1:36948776-36948798 CTGGAGGGCTGGAGACAAGGAGG - Intronic
906637818 1:47421381-47421403 CTGTAGGGAAGCAGGGAAGGTGG + Intergenic
906671327 1:47657108-47657130 CTGGAGCCATGGAAGTAAGGAGG + Intergenic
907046644 1:51303645-51303667 CTGCAGGCAGGGAAACAAGGTGG - Intronic
910549179 1:88456533-88456555 CTGGAGGGATGGACGCAGGGTGG - Intergenic
910781889 1:90947017-90947039 CTGTGTGGATGAAGGCAAGGAGG + Intronic
914959230 1:152191454-152191476 GTGTAGGCATGAAGGGAAAGGGG - Intergenic
915534199 1:156524948-156524970 CTGAAAGCAAGGAGGAAAGGAGG + Intergenic
916499812 1:165376812-165376834 CTGAAGGCAGGGAGGTAGGGAGG - Intergenic
916827453 1:168456170-168456192 CTGAAGACATGGAGGGCAGGGGG + Intergenic
917109366 1:171529401-171529423 CTGTGGGTATGCAGGAAAGGTGG - Intronic
917927862 1:179803959-179803981 CTGGAGGCAAGCAGGCCAGGGGG - Intronic
920021194 1:202958018-202958040 CTGGATGCCTGGAGGCCAGGCGG + Intronic
920586927 1:207173528-207173550 CTGTTGGCATGGCTTCAAGGAGG - Intergenic
920604115 1:207363347-207363369 GTGTAGGGAAGGAGGCAAGGAGG - Intergenic
922560348 1:226565080-226565102 TGGTAGGCATGGAGGAAAGGAGG + Intronic
922691212 1:227693102-227693124 CTGGAGGCAAGAGGGCAAGGAGG - Intergenic
922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923861353 1:237894955-237894977 CTGAAGGCTTGGAGGTTAGGGGG + Intergenic
1063015582 10:2073749-2073771 ATGTGGGTATGGAGTCAAGGTGG - Intergenic
1064289517 10:14020859-14020881 CTGTAGAGGTGGAGGAAAGGGGG + Intronic
1064327768 10:14366656-14366678 CTGCAGGCATGGATGCCAGGAGG - Intronic
1065067805 10:21989453-21989475 TTGTAGTCATGGAGCCCAGGAGG - Intronic
1068219104 10:54020617-54020639 ATGGAGGCAGGGAGGAAAGGAGG + Intronic
1070363950 10:75717583-75717605 CTGTGGGCCAGGAGGCAAGGAGG + Intronic
1070609153 10:77921668-77921690 CTGAATGCATGGAGCCATGGAGG - Intronic
1070814453 10:79313996-79314018 CTGCAGGCATGGGGGGGAGGGGG + Exonic
1071343755 10:84671966-84671988 CTGGAGGCAGGGAGGCAAACAGG - Intergenic
1071463621 10:85920753-85920775 CTGTGGGCGGGGAGGGAAGGGGG + Intronic
1071856104 10:89626047-89626069 CTGTAGGCATGAAGGGGAGAAGG - Intronic
1072035575 10:91560460-91560482 CTGGAGGCAGGGAGGCCAGCTGG - Intergenic
1073499130 10:103919961-103919983 CAGTAAGCATGGAGTCCAGGAGG - Intergenic
1075686318 10:124367568-124367590 AGGTGGGCATGGAGGCATGGAGG - Intergenic
1076048003 10:127310266-127310288 CTGTAGGGGTGGGGGTAAGGGGG - Intronic
1076097393 10:127742983-127743005 CTTTAGGTATGGAGGGTAGGGGG - Intergenic
1076399933 10:130175857-130175879 CTGTGGGCATGGTGGCATCGAGG + Intronic
1078170627 11:8926490-8926512 CTGTAGTCCAGGAGGCAGGGAGG - Intronic
1078456992 11:11483170-11483192 CAGCAGGCATAGAGGCAAGGAGG - Intronic
1079188681 11:18259638-18259660 GTTAAGGGATGGAGGCAAGGAGG + Intergenic
1079656447 11:22991856-22991878 CTGCATACATGGAGGCAAAGTGG + Intergenic
1080252059 11:30244524-30244546 CTGTTGCTAAGGAGGCAAGGTGG - Intergenic
1081963372 11:47154524-47154546 CTGTGAACATGGATGCAAGGAGG + Intronic
1082893505 11:58165141-58165163 CTTTAGGCATGGGGGCACAGGGG - Intronic
1083299175 11:61731266-61731288 CTGTAGGCAGGAAGGGCAGGAGG + Intronic
1083308919 11:61774796-61774818 AGGGAGGCAGGGAGGCAAGGAGG - Intronic
1083721354 11:64605140-64605162 CTGCAGGCATGGAGGCAGCCAGG + Intergenic
1084142953 11:67245851-67245873 CTGGAAGCATGGAGGCAGGGTGG - Intronic
1084708845 11:70831497-70831519 CTGCAGGGAGGGAGGCAAGGGGG - Intronic
1085021491 11:73213008-73213030 CTGTGGGCATGGAGGAAAGCTGG + Intergenic
1086759468 11:90609539-90609561 GTGAAAGCAGGGAGGCAAGGTGG + Intergenic
1086937257 11:92758689-92758711 CTGAAGGCAGGGAGGCCAGGAGG + Intronic
1088815956 11:113421090-113421112 CTGGAGGTATGGAGGAGAGGTGG - Intronic
1089291409 11:117439700-117439722 CTGCAGGCCTGGAGGCAACCGGG + Intronic
1089350045 11:117816995-117817017 CTGTGGGCATGGGGGCAGGAGGG - Intronic
1090192038 11:124778512-124778534 CTGTAGGGATAGAGGTCAGGAGG + Intronic
1090492506 11:127177152-127177174 CTGTGGTCCTGGAGGCAATGTGG + Intergenic
1091635802 12:2195623-2195645 GGGTAGGGATGAAGGCAAGGAGG + Intronic
1091714923 12:2770231-2770253 CTGCAGGCATGGAGGGCAGTGGG - Intergenic
1091754315 12:3041676-3041698 AGGGAGGCAGGGAGGCAAGGAGG - Intergenic
1093196905 12:16140355-16140377 CTGTACTCATGGACCCAAGGTGG + Intergenic
1095159069 12:38894414-38894436 TTGTAGGCATTGGGGAAAGGAGG - Intronic
1095203322 12:39410899-39410921 CTGGAGGAATGGAGGGAGGGAGG + Intronic
1096467647 12:51856182-51856204 CTGTAGGCATGGAGGCTAGCTGG - Intergenic
1097892440 12:64791738-64791760 TTGTAGAGATGGAGGCATGGAGG + Intronic
1099092460 12:78330373-78330395 CTCTAGGCATGCAGGCCTGGTGG + Intergenic
1100188998 12:92170625-92170647 CTGTAGCCATGGATGGAAGTGGG - Intergenic
1100718394 12:97329455-97329477 CTGTGGGATTGGAGGAAAGGTGG + Intergenic
1101359955 12:104016947-104016969 CTGGAGGCTTGGAGGCATTGAGG - Intronic
1102043778 12:109817169-109817191 CTGCAGGAATGGGGGCCAGGGGG + Intronic
1102438151 12:112941434-112941456 CTGTAGGCATTGAAGCCACGCGG - Intronic
1102884517 12:116511475-116511497 CTGGAGGCAAGGAGGCAGGGAGG - Intergenic
1103618925 12:122174039-122174061 CTGCAGGGATGGAGCCAGGGTGG - Intronic
1104647373 12:130506778-130506800 CGGAAGGGATGGAGACAAGGAGG + Intronic
1104742519 12:131188812-131188834 CTGGAAGCATGGGGGCCAGGTGG + Intergenic
1104830499 12:131747606-131747628 CTGTACACATGGAGGGCAGGAGG + Intronic
1105779561 13:23695129-23695151 CTGTAGGCATGGAGGCCCAGGGG - Intergenic
1106149040 13:27080140-27080162 AGGTAGGCATGCAGGCAGGGAGG + Intronic
1106149345 13:27083440-27083462 CTGCTGGCATGGGGGCAAGGGGG - Intronic
1106386162 13:29288225-29288247 CTCTGGGAATGGAGGCAATGGGG + Intronic
1106923544 13:34589702-34589724 CAGAAGGGAGGGAGGCAAGGAGG + Intergenic
1106949900 13:34871806-34871828 CTGTAAGTCTGGAGCCAAGGGGG - Intergenic
1108822245 13:54367846-54367868 CTATAGGGATGGAGGCTGGGTGG + Intergenic
1110136210 13:72070639-72070661 CTGTAGGCAAGCAGGCAGGAAGG + Intergenic
1110622807 13:77618121-77618143 AGGGAGGCAGGGAGGCAAGGAGG - Intronic
1111930512 13:94508468-94508490 GAGTAGGCATGGAGGGAAAGAGG + Intergenic
1112158540 13:96844750-96844772 CTGTAGGGATGGAGACAAGCAGG - Intergenic
1112214898 13:97420021-97420043 CTTGAGGAATGGAGGCAAGTTGG + Intergenic
1113874009 13:113583448-113583470 CTGTATGCACGGAGGAGAGGGGG - Intergenic
1113910740 13:113840088-113840110 CAGCAGGCCTGGACGCAAGGTGG + Intronic
1114189413 14:20429485-20429507 CTGGAGGTAAGCAGGCAAGGGGG - Exonic
1116257159 14:42571124-42571146 CTGCAGGGATGGAAGCAGGGAGG - Intergenic
1116972041 14:51076351-51076373 ATGGAGGAATGGAGGAAAGGAGG - Intronic
1118713187 14:68539383-68539405 CTGGCGACTTGGAGGCAAGGAGG - Intronic
1121230665 14:92355253-92355275 CTGTAGACGTGGGGACAAGGAGG + Intronic
1121689382 14:95865237-95865259 TTGGAGGCAAGGAGGCCAGGTGG + Intergenic
1122126438 14:99581070-99581092 CTGGAGGCAGGGAGGCCAGCTGG + Intronic
1122809315 14:104280246-104280268 CTGCAGGCCGGGAGGCAAGGAGG + Intergenic
1124951312 15:34323661-34323683 CTGTTGGCATCCAGGCATGGTGG + Intronic
1126430314 15:48576549-48576571 CTGGAGGAATGAAGGGAAGGTGG + Intronic
1128869905 15:71146746-71146768 TGGTAGGCATAGAGGCTAGGAGG + Intronic
1129257584 15:74342831-74342853 CTTTGGAAATGGAGGCAAGGAGG + Intronic
1129738416 15:77978241-77978263 CTGGAGGCCAGGAGGCAGGGAGG - Intergenic
1129847657 15:78775368-78775390 CTGGAGGCCAGGAGGCAGGGAGG + Intronic
1130254246 15:82318541-82318563 CTGGAGGCCAGGAGGCAGGGAGG - Intergenic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1130600723 15:85271429-85271451 CTGGAGGCCAGGAGGCAGGGAGG + Intergenic
1130902770 15:88219466-88219488 CAATAGGCATTGAGGCCAGGAGG - Intronic
1130956271 15:88629463-88629485 CAGGTGGCATGGAGGCCAGGCGG - Intronic
1132877272 16:2145623-2145645 CTGTAGGCCTGGAGGCAGGGAGG - Intronic
1134375069 16:13664548-13664570 CTGAAGGTATTAAGGCAAGGTGG - Intergenic
1134840449 16:17397549-17397571 CTGTAGACATAGAGTAAAGGGGG - Intronic
1135730673 16:24892542-24892564 CTGTGGGCAGGGAGGCAGGGCGG + Intronic
1137379712 16:47986138-47986160 CTGATGGGATGGAGCCAAGGGGG + Intergenic
1137614026 16:49836367-49836389 GGGTTGGCATGGAGGGAAGGGGG + Intronic
1138430531 16:56965777-56965799 CTGCAGGCAGGGAGGCCAGTGGG - Intronic
1140600658 16:76471477-76471499 CTGGAGGCAAGGAAGCCAGGAGG - Intronic
1140738907 16:77924083-77924105 ATGTACACATGGAGACAAGGAGG - Intronic
1141475741 16:84271986-84272008 GTGTATGCCTGGAGGCTAGGGGG + Intergenic
1141797352 16:86284205-86284227 ATGCAGGCATGCAGGCCAGGAGG + Intergenic
1141961223 16:87410752-87410774 CAGCAGGCCTGCAGGCAAGGTGG - Intronic
1142062596 16:88040462-88040484 CTGTAGGCATGGGGACGGGGAGG - Intronic
1142278670 16:89136720-89136742 CTGTAGGCACAGAGGCAGGTGGG - Intronic
1142720910 17:1775203-1775225 CTGTAGGGATAGGGGCAGGGTGG + Intronic
1142864222 17:2780492-2780514 CTGTTGCCATGGTGGCATGGTGG + Intronic
1143032259 17:3974297-3974319 CTGTAGAGATGGAGGCAAGAGGG - Intergenic
1143345379 17:6245241-6245263 CTGGAAGCATGGAGCCCAGGAGG + Intergenic
1145974676 17:28977338-28977360 CTGAAGTCATGGAGGGGAGGCGG - Intronic
1146299097 17:31674263-31674285 CAGTAGGCAAGGAGGGAAGAAGG + Intergenic
1146374896 17:32287427-32287449 TTGTAGGCATGGAGAGAATGGGG + Intronic
1147324562 17:39664012-39664034 CTGCATGCAGGCAGGCAAGGGGG - Intergenic
1147496055 17:40916799-40916821 CTGGAGGCATGGATGCATTGGGG + Intergenic
1147763906 17:42820072-42820094 CTTTAAGCAAGGAGGCAAAGGGG - Intronic
1149734655 17:58981317-58981339 CTGAAGGGATGGTGGGAAGGGGG - Exonic
1151855087 17:76715306-76715328 CTGTGGGCGTGGGGGTAAGGAGG + Exonic
1153519385 18:5937699-5937721 CTGGAGGCAGGGAGGCTATGTGG + Intergenic
1156020144 18:32590213-32590235 CTGAAACCATGGAGGCCAGGAGG + Intergenic
1156458297 18:37307002-37307024 CTTTAGGCATGGGGGCAGGTGGG + Intronic
1158872524 18:61702045-61702067 CTTCAGGCATGAAGGCAAAGAGG - Intergenic
1159395029 18:67845948-67845970 CTGGAGAGATGGAGGCAAGATGG + Intergenic
1159970600 18:74647751-74647773 GTGTGGGCATGGTGACAAGGTGG + Intronic
1160574833 18:79847341-79847363 CTCCTGGCATGGAGGCATGGAGG - Intergenic
1161114683 19:2489922-2489944 CAGTAGGCATTGCGGCCAGGTGG - Intergenic
1161323624 19:3652576-3652598 TTCGAGGCATGGAGCCAAGGAGG - Intronic
1161329232 19:3678477-3678499 GAGGAGGGATGGAGGCAAGGAGG + Intronic
1161665551 19:5574056-5574078 CTGTAGGCAAATAGGGAAGGAGG - Intergenic
1161956723 19:7500214-7500236 CTCTAGGCCTGGAGGCCAGCAGG - Intronic
1163360087 19:16840435-16840457 CTGGAGGCCTGGAGGCCAGGAGG - Intronic
1165743235 19:38216056-38216078 CTGGAGGGAGGGAGGCAAGGCGG - Intronic
925017698 2:543952-543974 CTGGAGGCAGGGAGGCAGGGAGG + Intergenic
925291765 2:2752593-2752615 CTGTGGGCAGGGAGGGAGGGAGG + Intergenic
925768472 2:7259802-7259824 CTGAGGACTTGGAGGCAAGGTGG + Intergenic
925909239 2:8562223-8562245 CTGTAGGCAGGAAGGCAAATTGG + Intergenic
927072835 2:19548270-19548292 CTGCAGGGATGGGGGCAGGGAGG - Intergenic
929537025 2:42790154-42790176 TGGGAGGCATGGAGGCAAGACGG + Intronic
930516380 2:52412530-52412552 CTGTAAGATTGGAGGCAATGAGG - Intergenic
931685029 2:64785348-64785370 AGGGAGGGATGGAGGCAAGGGGG + Intergenic
933103676 2:78293480-78293502 ATGTAGGTAGGGAGGCAGGGAGG - Intergenic
933286507 2:80390105-80390127 ATGTAGACAAGAAGGCAAGGTGG - Intronic
933708650 2:85309333-85309355 CTGTGGGCATGGACCCAAGGGGG - Exonic
934167370 2:89306563-89306585 CTGCAGGCATGTGGCCAAGGTGG - Intergenic
934199905 2:89875881-89875903 CTGCAGGCATGTGGCCAAGGTGG + Intergenic
935114219 2:100120767-100120789 ATGGTGGCATGGAGGCATGGAGG - Intronic
935980887 2:108625686-108625708 CTGCAGGAAAGGAGGAAAGGAGG - Intronic
936370162 2:111897123-111897145 CTGTATGCTTGGAGGGAAGCGGG - Intergenic
937880372 2:126859863-126859885 CTGTATGCATGGAGGGGAGGTGG + Intergenic
938057782 2:128230121-128230143 CTGAAACCATGGAGGCAAGGAGG - Intergenic
942558763 2:177198692-177198714 CTGGAGGCATGGGGCAAAGGGGG - Intergenic
942628533 2:177930307-177930329 CTGTAGCCAAGCAGGCAAGCAGG + Intronic
943306022 2:186263879-186263901 TTGTAGGCCTAGAGGCAAAGAGG - Intergenic
944317697 2:198300977-198300999 CTGTATGCATGGAGCCTGGGAGG + Intronic
945079844 2:206077906-206077928 ATATTGGCATGGAAGCAAGGGGG - Intronic
948267376 2:236644887-236644909 CTGTGGTCATGGGGGCAAGATGG - Intergenic
948608645 2:239152757-239152779 CTGTAGGCATGGAGGCAAGGAGG + Intronic
948802794 2:240440537-240440559 CCGGAGGCAGGGAGGCCAGGAGG - Intronic
948802806 2:240440572-240440594 CCGGAGGCAGGGAGGCCAGGAGG - Intronic
948802818 2:240440607-240440629 CCGGAGGCAGGGAGGCCAGGAGG - Intronic
948802830 2:240440642-240440664 CCGGAGGCAGGGAGGCCAGGAGG - Intronic
948802842 2:240440677-240440699 CCGGAGGCAGGGAGGCCAGGAGG - Intronic
948802854 2:240440712-240440734 CCGGAGGCAGGGAGGCCAGGAGG - Intronic
948802866 2:240440747-240440769 CCGGAGGCAGGGAGGCCAGGAGG - Intronic
948802878 2:240440782-240440804 CCGGAGGCAGGGAGGCCAGGAGG - Intronic
948829875 2:240593447-240593469 CTGGAGGCATGGAGGCCCAGGGG - Intronic
1169498061 20:6133583-6133605 CTGTAGGCATGAGGGAATGGGGG - Intergenic
1170047710 20:12103366-12103388 TTATAGGCATGGAGGAAGGGAGG + Intergenic
1170896268 20:20417438-20417460 ATGTAGCCATGGAAGCAAAGAGG - Intronic
1171385082 20:24764438-24764460 CTGTGGGCTTGGAGGTCAGGCGG + Intergenic
1172300016 20:33842824-33842846 ATTCAGGCATGGAGGGAAGGAGG - Intronic
1172481435 20:35274166-35274188 CTGTGGCAAGGGAGGCAAGGTGG - Intronic
1172936252 20:38622680-38622702 CTGCAGGCATGGAGGGATGTGGG - Intronic
1174075987 20:47937408-47937430 CTGGAGGGAAGGAGGCCAGGAGG - Intergenic
1174852309 20:54007048-54007070 AAGTTGGCGTGGAGGCAAGGAGG + Intronic
1175258571 20:57661461-57661483 CGGCTGGCATGGGGGCAAGGAGG + Intronic
1175281104 20:57804734-57804756 CTGAAGGCTTGCAGGAAAGGAGG - Intergenic
1175590938 20:60191474-60191496 CTTTAGCCATGGAGGCAATCTGG + Intergenic
1176032725 20:63021504-63021526 CTGTAGGACAGGAGGGAAGGAGG - Intergenic
1179168968 21:38957975-38957997 CTGTGGGCATGGAGTAAATGGGG + Intergenic
1182654637 22:31880266-31880288 CTGCAGGAATGGTGGAAAGGAGG - Intronic
1182713043 22:32334507-32334529 CAGCAGGAATGGAGGCAGGGAGG - Intergenic
1183010435 22:34941982-34942004 GTGTAGGCATAGAGGCCAGCTGG - Intergenic
1183115175 22:35686246-35686268 TTGTAGGCAGGGGGGCAAGGAGG + Intergenic
1183241606 22:36661740-36661762 CTCTAGGATTGGAGGCAAGGTGG + Intronic
1183334329 22:37237948-37237970 CTGTAGACAGGGGGTCAAGGAGG + Intronic
1183359582 22:37376527-37376549 CTTTGGGCATGGAGGAAAGGAGG - Intronic
1183729962 22:39612845-39612867 GTGGAGGGATGGAGGGAAGGAGG - Intronic
1184289916 22:43493127-43493149 CTGTAGGCTTGAAGGCAGGGTGG + Intronic
1184400304 22:44270072-44270094 CAGCAGGAATGGAGGCAGGGAGG - Intronic
1184654610 22:45934821-45934843 CTCTCGTCATGGAGACAAGGGGG + Intronic
1185208391 22:49553210-49553232 CTGTGGGCAGGGAGGGGAGGAGG + Intronic
950447738 3:13047933-13047955 CTGCCGGCATGGAGGCTGGGTGG - Intronic
954330166 3:49885589-49885611 CTGAAGGGATGGAGGCTATGGGG + Intergenic
955364744 3:58301284-58301306 TTCTAGGCTTTGAGGCAAGGGGG - Intergenic
956338469 3:68192357-68192379 ATGGAGACATGGAGGCCAGGTGG - Intronic
959244141 3:103841921-103841943 CTGAAGGCATATAGGCAGGGAGG - Intergenic
960519939 3:118643101-118643123 CTGTAGGCATGGAGGTCTGAGGG - Intergenic
960653685 3:119979439-119979461 CTGAAGGCTTGGAGGCAGGTAGG - Intronic
960659815 3:120045320-120045342 CTAGAGGCAAGGAGGCATGGAGG - Intronic
960926596 3:122800615-122800637 CTGTAGCCATGTAGGCAAGATGG + Intronic
961427715 3:126861211-126861233 CTGTGGACAGGGATGCAAGGAGG - Intronic
961434331 3:126906277-126906299 CTGGAGGCCTGGAGGCCTGGAGG - Intronic
961455647 3:127022640-127022662 CTGTAGGAAGGGGGGCAGGGTGG + Intronic
962828352 3:139119143-139119165 CTGTGGCCATGGAGGTCAGGTGG + Intronic
963931913 3:151012463-151012485 CTGGAGGCCAGAAGGCAAGGGGG - Intergenic
964529131 3:157648173-157648195 CTGTAGGCAAGAAGACAAGGTGG - Intronic
965382272 3:168004708-168004730 GAGTAGGAATGGAGGGAAGGAGG - Intergenic
966904888 3:184514882-184514904 TTGTAGGGAGGAAGGCAAGGGGG - Intronic
968148562 3:196319622-196319644 CTGAAAGAATGGAGGCAAGAAGG + Intronic
968581893 4:1399112-1399134 CTGGAGGCTGGGAGGAAAGGGGG + Intergenic
968754424 4:2408106-2408128 CTTGAGGCCTGGAGGCCAGGGGG - Intronic
969622265 4:8284529-8284551 GTGTGGGCATGGAGGCCAGTGGG + Intronic
971233472 4:24819639-24819661 CTCTAGGCATGGTGGCAGAGAGG - Intronic
971319360 4:25592826-25592848 CTGTAGCCAAGGAGACAAGGAGG - Intergenic
973605074 4:52578646-52578668 CTGGAGGAATGAAGGAAAGGAGG + Intergenic
974022976 4:56707978-56708000 TTGTAGGAATGAAGGAAAGGAGG + Intergenic
975149432 4:71004946-71004968 CTGAAGCCAGGGAGCCAAGGGGG - Intronic
975721527 4:77253183-77253205 CTGTAACTATGGAGGCCAGGTGG + Intronic
975721862 4:77255928-77255950 ATGTAAGCATGGAGGCCAGATGG + Intronic
975736778 4:77389011-77389033 ATGTAAGCATGGAGGCCAGATGG + Intronic
977720083 4:100229877-100229899 CTGATGGCATGGGGCCAAGGTGG + Intergenic
979558092 4:122073775-122073797 CTTTAGGCATGGGGACAGGGAGG - Intergenic
979980576 4:127249505-127249527 TGGTAGCCATGGAGGGAAGGGGG + Intergenic
980076816 4:128302656-128302678 CTGGAGGCCTGGAGGCCACGAGG - Intergenic
981674621 4:147327451-147327473 CTTTAGGCAAGTAGGCAAGGAGG - Intergenic
982453750 4:155583436-155583458 TTCTAGGCATGAAAGCAAGGGGG + Intergenic
984965823 4:185138890-185138912 CTGGAGGCAGGGAGGCCTGGGGG - Intergenic
985110291 4:186541062-186541084 CTGAGGGAATGGAGGCAGGGTGG - Intronic
985894718 5:2741406-2741428 CTGTTAGAATGGAGGCAAGGAGG + Intergenic
987955204 5:24729819-24729841 ATGGAGGCAGGGAGGCATGGAGG - Intergenic
988148981 5:27350958-27350980 CTGTAGCCTGGGAGACAAGGGGG + Intergenic
988837137 5:35044647-35044669 ATGAAGGAATGGAGGGAAGGAGG - Intronic
991956290 5:71998613-71998635 CTGAAGTCATAGAGGCCAGGTGG + Intergenic
992530728 5:77649292-77649314 ATGAAGGCATGGAGGGAAGTAGG - Intergenic
992869661 5:80993677-80993699 CTGTAGGCCTGAAGGCAAGAGGG + Intronic
993762845 5:91818277-91818299 TTTTAGGTATGGAGGTAAGGAGG + Intergenic
993810543 5:92470713-92470735 GTGTAGGTATGGAGGTATGGAGG + Intergenic
999290650 5:150423580-150423602 CTTGAGCCAGGGAGGCAAGGAGG - Intergenic
1002877051 6:1220014-1220036 CTGTAGGTATGAAGGTAGGGAGG + Intergenic
1003146134 6:3512104-3512126 CTCTAGGAATGGAGGCAAAGTGG - Intergenic
1003480057 6:6522993-6523015 CTGAAGGCATGGAGAACAGGAGG + Intergenic
1004090335 6:12494366-12494388 CTGTAGGCAAGGTGGCATGAAGG - Intergenic
1004265544 6:14145611-14145633 ATTTAGGCAAGGAGGCAGGGAGG - Intergenic
1004494447 6:16150516-16150538 GTGTAGGCATAGAGGAGAGGAGG + Intergenic
1004620509 6:17326703-17326725 CTGAGGGCCTGGAGGCCAGGAGG + Intergenic
1006164076 6:32054245-32054267 CTGGAGGCAGGGAGGCCAGTAGG - Intronic
1007379442 6:41478175-41478197 CTGGAGCCATGGAGGAAATGTGG - Intergenic
1007410212 6:41657134-41657156 CTGGAGCCATGGAGGCCATGGGG - Intergenic
1007530904 6:42541369-42541391 CTGCAGGCAGGGTGACAAGGGGG - Intergenic
1007934680 6:45722427-45722449 CTGTATGCATGAAGGAAAAGTGG + Intergenic
1012268901 6:97183237-97183259 GGGAAGGCATGGAGACAAGGAGG - Intronic
1012906083 6:105067866-105067888 CTGGAGGCATGGGGGCAAAGGGG - Intronic
1014135118 6:117879976-117879998 CTGCAGGCATGAACGCAGGGAGG - Intergenic
1018185896 6:161265025-161265047 CTGTGGGGATGGATGCTAGGAGG + Intronic
1018565000 6:165142071-165142093 CTAGAGGCAGGGAGGCCAGGAGG + Intergenic
1018685289 6:166299269-166299291 TTGTAGGAGTGGACGCAAGGAGG - Intergenic
1018873860 6:167803429-167803451 CTGTGGGCCTGGAGGCAGAGGGG + Intergenic
1018997169 6:168718893-168718915 GTGTAACCATGGAGGCAGGGTGG + Intergenic
1019075869 6:169387757-169387779 CTGTAGGCAGAGAGGCAGGTAGG - Intergenic
1020034050 7:4953135-4953157 CTGTAGGGATGGAGGAAACAGGG - Intronic
1020865501 7:13556194-13556216 ATGAAGGCATTGAGGCAAAGAGG - Intergenic
1020883293 7:13791364-13791386 CTGTAGGCAGGCAGGAAAGAGGG - Intergenic
1020952185 7:14694118-14694140 CTGGAGGAATGGATTCAAGGAGG - Exonic
1021350639 7:19589829-19589851 CTGTAGGCATTCAGATAAGGGGG + Intergenic
1021819261 7:24480080-24480102 CTGTGGGATGGGAGGCAAGGTGG - Intergenic
1022822767 7:33977376-33977398 CTGGAGGCATGGAGTTTAGGAGG + Intronic
1023003552 7:35838372-35838394 CTGTAGGGAGGGAGGGAGGGAGG - Intronic
1024095758 7:45981190-45981212 CAGTAGGAATGCAGGCATGGAGG - Intergenic
1024250427 7:47502000-47502022 CTGTAGGCATACGAGCAAGGTGG + Intronic
1026223366 7:68419582-68419604 CTGTTGGCAAGGAAGAAAGGAGG - Intergenic
1026446198 7:70486988-70487010 CTGTAGGCATGGTGGTAAACTGG + Intronic
1027899513 7:84092739-84092761 AAGGAGGCATGGAGGGAAGGAGG - Intronic
1029489224 7:100861369-100861391 CTGCGGGCATGGAGGGGAGGAGG - Intronic
1030194530 7:106840635-106840657 CTGTAGGCCTGGAGATGAGGTGG - Intergenic
1030749696 7:113216291-113216313 CTGGAGGTAAGGAGGCAAGTTGG - Intergenic
1031015642 7:116573601-116573623 CTATAGGCATGGATTCAAAGGGG + Intergenic
1031047111 7:116903723-116903745 CTGTGGGCCCAGAGGCAAGGTGG + Intronic
1032121541 7:129160492-129160514 CTGGAGGCCTGGGGGCTAGGGGG + Intronic
1034699865 7:153086520-153086542 CTGCAGGTGTGGAGGAAAGGAGG - Intergenic
1034819394 7:154202771-154202793 CTCAAGGCATGGAAGGAAGGAGG - Intronic
1034972264 7:155426721-155426743 CTGTAGCCAGGGTGGAAAGGGGG - Intergenic
1036708185 8:11060308-11060330 GTGGAGGCATGGAGGCAGGGAGG - Intronic
1036708188 8:11060316-11060338 GTGGAGGCGTGGAGGCATGGAGG - Intronic
1036778269 8:11628456-11628478 CAGTAGGGATGCAGGGAAGGGGG + Intergenic
1036799240 8:11777530-11777552 CTGCAGGGAGGGAGGAAAGGGGG - Intronic
1037018621 8:13940454-13940476 TTAAAGGCATGGAGGGAAGGGGG + Intergenic
1037182561 8:16025066-16025088 CTGTATGCAATGAGGGAAGGTGG + Intergenic
1038452801 8:27650730-27650752 TTGTTGGCATGGAGGAAAGAGGG - Intronic
1043377954 8:79671115-79671137 CAGAAGGCATGAAGGCAAAGGGG + Intergenic
1043487724 8:80714897-80714919 TTGTATGCATGGAGGCAAAATGG - Intronic
1044399366 8:91752774-91752796 GTGGAGGGAAGGAGGCAAGGTGG - Intergenic
1046406706 8:113781954-113781976 CTGTAGTCATGGAAGCAAGTAGG + Intergenic
1049708657 8:144054042-144054064 CTGGAGGCTGGGGGGCAAGGTGG - Intronic
1052003394 9:23316294-23316316 CTGCAGACAGAGAGGCAAGGAGG + Intergenic
1052274388 9:26661068-26661090 ATGAAGGGATGGAGGAAAGGAGG + Intergenic
1053307658 9:36995548-36995570 CTGTGAGAATGGAGGAAAGGAGG + Intronic
1055300026 9:74873086-74873108 ATGTAGAGATGGAGGCAGGGAGG - Intronic
1055767624 9:79681732-79681754 CTGGAGGCAGGGAGGGAAGGAGG + Intronic
1056010176 9:82320953-82320975 ATGTAGGAATGGAGGCCAGAAGG - Intergenic
1056666383 9:88584025-88584047 GTGCAGGCATGGAGAGAAGGTGG - Intronic
1056770853 9:89477021-89477043 CTGGAGGCATGGAGGAGAGTGGG + Intronic
1057414244 9:94847213-94847235 CTGCAGGCATGGTGGGAGGGTGG - Intronic
1058777598 9:108300354-108300376 CGGTGGGCATGGAGGCATGATGG - Intergenic
1061014218 9:127972640-127972662 CTGCAGGCCTGGAGGCAGGGAGG + Intronic
1061014220 9:127972648-127972670 CTGGAGGCAGGGAGGCAACAAGG + Intronic
1061362286 9:130151281-130151303 CTGTAGGCAGGCAGGCAGGCAGG + Intergenic
1061681776 9:132246041-132246063 CTGGAGGCATGGAGGTGGGGGGG - Intergenic
1061862892 9:133476941-133476963 CAGAAGGCATGGAGGCTGGGAGG + Intronic
1062264062 9:135678799-135678821 CTGGAGGGATGGGGGCAGGGTGG - Intergenic
1062521814 9:136961094-136961116 CTGCAGACATGAAGGCAGGGAGG - Intergenic
1062607074 9:137353198-137353220 GTGGAGGCTTGGAGGCCAGGAGG - Intronic
1062607089 9:137353252-137353274 GTGGAGGCTTGGAGGCCAGGAGG - Intronic
1062653273 9:137589531-137589553 CTGTGGGCATTGAGGCTTGGCGG - Intronic
1185766764 X:2732096-2732118 CTGTAGGAAGGGAGGAACGGAGG - Intronic
1186753929 X:12650012-12650034 CAGTAGGCCTGGAGGCACGTGGG + Intronic
1187424502 X:19164760-19164782 CTGCAGGCTGGGAGGCCAGGTGG - Intergenic
1192224528 X:69219231-69219253 CTGTGGGAAAGGAGGCCAGGAGG - Intergenic
1192788049 X:74354063-74354085 CTGTGGCCATGGAGGCCAGCTGG - Intergenic
1193378466 X:80789666-80789688 ATTTAAGCATGGAGGCCAGGCGG - Intronic
1197175962 X:123486085-123486107 ATGGAGGCAGGGAGGCAGGGAGG + Intronic
1197870473 X:131058541-131058563 CAGCAGGAAGGGAGGCAAGGGGG - Intronic
1199399680 X:147383244-147383266 CTGAAGGAATGGTGGCAGGGTGG + Intergenic
1199864111 X:151827636-151827658 CTGTGGGCCTGGAAGGAAGGAGG - Intergenic
1200540854 Y:4453976-4453998 CAGAAGGCAAGGAGGCAAGGAGG - Intergenic
1200745485 Y:6900268-6900290 CTGTGGGCAGGCGGGCAAGGAGG + Intergenic
1201636571 Y:16129028-16129050 CTGAAGGCTTGGAGGCAGGAAGG - Intergenic