ID: 948610920

View in Genome Browser
Species Human (GRCh38)
Location 2:239166417-239166439
Sequence CATCTTCAGCAGCATGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 234}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948610920_948610928 30 Left 948610920 2:239166417-239166439 CCCAGCTCATGCTGCTGAAGATG 0: 1
1: 0
2: 2
3: 16
4: 234
Right 948610928 2:239166470-239166492 CACTGCCCCAGGTAGGGTGGCGG 0: 1
1: 0
2: 1
3: 25
4: 247
948610920_948610926 24 Left 948610920 2:239166417-239166439 CCCAGCTCATGCTGCTGAAGATG 0: 1
1: 0
2: 2
3: 16
4: 234
Right 948610926 2:239166464-239166486 GGTGAGCACTGCCCCAGGTAGGG 0: 1
1: 0
2: 2
3: 18
4: 189
948610920_948610925 23 Left 948610920 2:239166417-239166439 CCCAGCTCATGCTGCTGAAGATG 0: 1
1: 0
2: 2
3: 16
4: 234
Right 948610925 2:239166463-239166485 CGGTGAGCACTGCCCCAGGTAGG 0: 1
1: 0
2: 2
3: 12
4: 115
948610920_948610922 3 Left 948610920 2:239166417-239166439 CCCAGCTCATGCTGCTGAAGATG 0: 1
1: 0
2: 2
3: 16
4: 234
Right 948610922 2:239166443-239166465 CATCACCTAAGTTGTGACTGCGG 0: 1
1: 0
2: 4
3: 75
4: 135
948610920_948610927 27 Left 948610920 2:239166417-239166439 CCCAGCTCATGCTGCTGAAGATG 0: 1
1: 0
2: 2
3: 16
4: 234
Right 948610927 2:239166467-239166489 GAGCACTGCCCCAGGTAGGGTGG 0: 1
1: 0
2: 1
3: 20
4: 221
948610920_948610924 19 Left 948610920 2:239166417-239166439 CCCAGCTCATGCTGCTGAAGATG 0: 1
1: 0
2: 2
3: 16
4: 234
Right 948610924 2:239166459-239166481 ACTGCGGTGAGCACTGCCCCAGG 0: 1
1: 0
2: 1
3: 15
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948610920 Original CRISPR CATCTTCAGCAGCATGAGCT GGG (reversed) Intronic
900160304 1:1220146-1220168 CTTCTTCACCAGCCTGAGGTTGG - Intronic
901759985 1:11464472-11464494 CATCAGCAGCAGCATCACCTCGG - Intergenic
902933980 1:19751123-19751145 CATCCTCAGCAGCTTGCCCTGGG + Intronic
903296484 1:22346589-22346611 CAGCTGCAGCAGCAGAAGCTGGG - Intergenic
903327409 1:22577357-22577379 CATCCCCAGCTGCATGACCTTGG - Intronic
903556091 1:24194445-24194467 CATCATCACCAGCATCACCTGGG - Intergenic
904093089 1:27958783-27958805 CATCAGCAGCAGCGGGAGCTGGG - Exonic
905900867 1:41581328-41581350 CATCTCGTGCAGCATGAGCCAGG - Exonic
906126889 1:43432378-43432400 CTTCTTCAGCGGCCTGGGCTTGG + Exonic
907280577 1:53344427-53344449 CAGCTTCAGCAGCCTCATCTAGG + Intergenic
911031093 1:93489120-93489142 TTTCTTCAGCAGCATGAGGAAGG + Intronic
913561458 1:120025031-120025053 CCTCTTCTGCTGCATGAACTGGG - Intronic
913636670 1:120768570-120768592 CCTCTTCTGCTGCATGAACTGGG + Intergenic
914282043 1:146184445-146184467 CCTCTTCTGCTGCATGAACTGGG - Intronic
914543072 1:148635152-148635174 CCTCTTCTGCTGCATGAACTGGG - Intronic
914623550 1:149435861-149435883 CCTCTTCTGCTGCATGAACTGGG + Intergenic
914733442 1:150393298-150393320 CATCTACAGAAACATTAGCTGGG + Intronic
915935695 1:160089095-160089117 CAGCAACAGCAGCATGACCTGGG - Exonic
916485630 1:165256015-165256037 CTTCCTCCGCAGCATGAGCGTGG + Intronic
920920898 1:210296472-210296494 CATCTTCAGCCTCTTGAACTTGG - Intergenic
923463140 1:234224605-234224627 GATGTTCAGCACCATGACCTTGG + Intronic
924138450 1:240997059-240997081 CCTCTTCAGGAGGCTGAGCTGGG - Intronic
924624259 1:245686673-245686695 CATCATCAGCAGCATCAGCGAGG + Exonic
1063016564 10:2083867-2083889 CATCTACTGCAGCATGTGGTTGG - Intergenic
1064442728 10:15369149-15369171 GATTTTTAGCAGCAAGAGCTGGG + Intronic
1065626515 10:27635034-27635056 CATTTTTAGCAGCCTGAACTTGG + Intergenic
1067769134 10:49110936-49110958 CACCTTCAGCACCAGGAGGTGGG + Intronic
1067949909 10:50724430-50724452 CCAGTTCAGCAGCATGATCTTGG - Intergenic
1068862771 10:61864818-61864840 CATCTTCAGCATCCTGATCCAGG - Intergenic
1069553687 10:69382660-69382682 CACCTCCAGCAGCATGTCCTTGG - Exonic
1071141591 10:82515835-82515857 CACCTTCTGCAGAATGAGATGGG + Intronic
1071629374 10:87205663-87205685 GATCTTCAGGAGCCTGTGCTTGG - Intergenic
1072075997 10:91974528-91974550 CATCTTGAGGAGCATGAAGTAGG + Intronic
1072649473 10:97283308-97283330 CATCTTCAGGAGGCTGAGGTGGG + Intronic
1072746881 10:97946531-97946553 CATCTCCAGAGGCAAGAGCTGGG + Intronic
1073119181 10:101111210-101111232 CATCAGAAGCAGCAAGAGCTGGG - Intronic
1073165234 10:101442148-101442170 CATCTTCAGGAACTGGAGCTAGG - Intronic
1073646977 10:105315119-105315141 CATCTGCAGCACGATGAGATGGG + Intergenic
1074908021 10:117882107-117882129 CATCATCAGCATCATCACCTGGG - Intergenic
1075004136 10:118818432-118818454 CATCTGCAGCAGGATGACCATGG + Intergenic
1075259409 10:120949677-120949699 CGTCTGCAGCCGCGTGAGCTCGG + Intergenic
1076611829 10:131730876-131730898 CGCCTTCAGCAGCATGAGGCAGG + Intergenic
1078253679 11:9639216-9639238 CAGGCTCTGCAGCATGAGCTGGG + Intergenic
1082686930 11:56250053-56250075 CATGTTTAGCAGCATAAGCTTGG - Intergenic
1084010825 11:66347474-66347496 CATCGCCACCAGCATGAGCGCGG + Exonic
1084090504 11:66876515-66876537 CCTCTTGAGCAGCAGGTGCTGGG - Intronic
1085595911 11:77809647-77809669 CATCTACAGCAGCACTAACTTGG - Intronic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1088434131 11:109792020-109792042 TATTTTCATCAGCATGACCTTGG - Intergenic
1088841154 11:113628713-113628735 CATCCTAAGGAACATGAGCTGGG + Intergenic
1089762492 11:120738577-120738599 TATCTTCAGCATCATGCACTGGG - Intronic
1090446087 11:126765974-126765996 CATCATCAGCTACCTGAGCTTGG + Intronic
1091327613 11:134703008-134703030 CTTCCTCAGCAGCCTGAGCCTGG - Intergenic
1091495938 12:972850-972872 CAACTGGAGCAGAATGAGCTAGG + Intronic
1092405461 12:8219076-8219098 CATCTGCAGCTGCACGAGTTAGG + Intergenic
1095490898 12:42732785-42732807 TATCTTTAGCAGCATGAGAATGG + Intergenic
1095689020 12:45067031-45067053 CCTCTGCAGCAGGATGAGCTTGG + Intergenic
1095821695 12:46485766-46485788 CATCTTCATCAGCCTCAGCCAGG + Intergenic
1099261983 12:80394824-80394846 CATATTCAGCAGCTTGATTTTGG + Intergenic
1100278880 12:93098651-93098673 CAACTTCATAAGCATGTGCTTGG + Intergenic
1100476348 12:94939150-94939172 CATAATGACCAGCATGAGCTGGG - Intronic
1102177095 12:110884093-110884115 CAGCTTCAGCAGCCGGAGGTGGG - Exonic
1102399663 12:112617376-112617398 CAGCCTCAGTAGGATGAGCTTGG + Intronic
1103336527 12:120194435-120194457 CGACTTCAGCAGCTGGAGCTCGG - Intronic
1106504513 13:30359574-30359596 CATCTTCAGCAGCAGGGCCATGG + Intergenic
1106584489 13:31045218-31045240 GATCTTCAACTGCATGATCTAGG - Intergenic
1106707339 13:32295348-32295370 CATGTTCAGCTCCATCAGCTTGG - Exonic
1106863118 13:33933203-33933225 CATATTCTGCATCATCAGCTCGG - Intronic
1107412750 13:40172703-40172725 CATCTGCAGCGGCCTGGGCTGGG - Intergenic
1109315591 13:60745251-60745273 CTTCATCAGCAGCATGAAATGGG + Intergenic
1110624373 13:77635830-77635852 CAGCATCATCAGCATGACCTGGG + Intronic
1112345221 13:98583647-98583669 CATCTTCACCAACAGGAGGTGGG - Intergenic
1112501181 13:99944598-99944620 CATCTACAGCACCATGAGAAAGG + Intergenic
1113709514 13:112454309-112454331 CCTCTCCCACAGCATGAGCTGGG + Intergenic
1114493631 14:23118490-23118512 CAGGCTCAGCAGCATGAGCCGGG + Intronic
1115888579 14:38001817-38001839 CAGCAACAGCAGCATTAGCTGGG - Intronic
1117437904 14:55734864-55734886 AAGCTTCAGCAGCAGGAGCCAGG + Intergenic
1119363556 14:74071911-74071933 CATCTCCTTCAGCATCAGCTAGG + Exonic
1120176928 14:81304411-81304433 CATCTCTAACAGCGTGAGCTTGG - Intronic
1122791061 14:104184352-104184374 CAGCTTCAGTAGCAGGCGCTGGG + Intergenic
1123436174 15:20256235-20256257 CAACTTCTCCAGCATGAGGTGGG - Intergenic
1125477241 15:40055532-40055554 CACCTTCAGGAGCATTAGCCTGG + Intergenic
1129014148 15:72450985-72451007 CATCTTCACCAGCATGGGAGAGG + Intergenic
1129205336 15:74034115-74034137 CATTCTCAGCTCCATGAGCTGGG - Intronic
1130109838 15:80954999-80955021 CAGCATCATCAGCATCAGCTGGG + Intronic
1132674920 16:1117565-1117587 CGTCTTCACCAGCCTGAGCCAGG + Intergenic
1134310772 16:13073474-13073496 CATCAGCAGCAGCATCACCTGGG + Intronic
1134438339 16:14282123-14282145 CAGCTGCAGCAGCATTAACTGGG + Intergenic
1135172989 16:20202979-20203001 CATTCCCAGCAGCATGACCTTGG - Intergenic
1136848428 16:33594749-33594771 CAGCTTCTCCAGCATGAGGTGGG + Intergenic
1137966052 16:52935131-52935153 CATCTTCACCAGCATCAGAGAGG + Intergenic
1139871195 16:70110011-70110033 CTTCTTCAGCCTCCTGAGCTGGG - Intergenic
1140200362 16:72889940-72889962 CACCTGCAGCAGCATGAGAGTGG - Exonic
1140265103 16:73413634-73413656 CATCATCAGCACCAAGATCTGGG - Intergenic
1140375671 16:74443879-74443901 CTTCTTCAGCCTCCTGAGCTGGG + Intergenic
1140460829 16:75138435-75138457 CACCTTCAGCAGGATGATCAAGG + Intergenic
1140917691 16:79508567-79508589 CATATTCAGCCGGAAGAGCTGGG - Intergenic
1141699417 16:85635619-85635641 CAACTGCAGCAGCAGGAGCTGGG - Intronic
1203110135 16_KI270728v1_random:1443398-1443420 CAGCTTCTCCAGCATGAGGTGGG + Intergenic
1144490971 17:15708828-15708850 CATCTTCAGAAGAATAAACTGGG - Intronic
1144720548 17:17466618-17466640 GATCTCCAGCAGCAGCAGCTAGG + Intergenic
1146078314 17:29754160-29754182 CATCATCATCAGCATCATCTAGG + Intronic
1146264769 17:31445118-31445140 CACCATCTGCAGCAGGAGCTTGG - Intronic
1148395426 17:47304332-47304354 CATCTGCAAGAGCATGAGTTGGG - Intronic
1148698024 17:49572816-49572838 CACCTTCATCAGCATCACCTGGG + Intergenic
1151476020 17:74344756-74344778 CATCAGCAGCTGCATGATCTGGG - Exonic
1151624253 17:75266815-75266837 GATCTCCAGCAGCAGCAGCTGGG + Exonic
1152851099 17:82636507-82636529 CCTCTTCAGCTGCAGGAGGTGGG - Intronic
1153637396 18:7124738-7124760 CATCTTCATCACCATGGGTTAGG + Intergenic
1155157596 18:23170487-23170509 CATCTCCAGCAGCGTGTGCATGG + Intronic
1157690914 18:49681098-49681120 CATCTTCAGAAGCAGCAGTTAGG + Intergenic
1158210822 18:55047816-55047838 CATGTTAGGCAGCAGGAGCTGGG + Intergenic
1158613092 18:58961217-58961239 CATCAGCATCAGCATCAGCTAGG - Intronic
1158944388 18:62436200-62436222 CTTCTTCCCCAGCAAGAGCTGGG - Intergenic
1159068371 18:63594400-63594422 CATGTTCACCAGCACCAGCTTGG - Exonic
1160084536 18:75763507-75763529 GGTCTCCAGCAGCATGAGCCAGG - Intergenic
1161507514 19:4651875-4651897 CACCTTCAGCACCAAGAGCCTGG + Exonic
1164686649 19:30170625-30170647 CATCTGCAGCACCACGGGCTTGG + Intergenic
1165032324 19:33007151-33007173 CAACTTCTCCAGCATGAGGTGGG - Intronic
1165438783 19:35812161-35812183 CACCTTCAGCTGCATGAGGCTGG + Exonic
1168649736 19:58085554-58085576 CATCTGCAGCAGCAGGCGCGGGG - Intronic
925627299 2:5853959-5853981 CAGCTTCAGCAAGAAGAGCTAGG + Intergenic
928683677 2:33727473-33727495 CACCTTCAGCAGCCCCAGCTCGG + Intergenic
929231100 2:39560976-39560998 CATCCTCACCAGCATAAGTTTGG + Intergenic
930900761 2:56505149-56505171 CATCTTCAAATGCATAAGCTTGG - Intergenic
931545597 2:63381990-63382012 CATCCTGAGCAGCATGAACTGGG - Exonic
932361232 2:71107876-71107898 CATCCTGAGCTGCATGAACTTGG - Intergenic
932835609 2:75033319-75033341 CAGCTCCAGCAGCATCACCTGGG + Intergenic
934169412 2:89327195-89327217 CATCCTCAGCAGCATGAGGTGGG - Intergenic
934197882 2:89855390-89855412 CATCCTCAGCAGCATGAGGTGGG + Intergenic
934542133 2:95184410-95184432 CATTTTCAGCAAGATGAGATTGG + Intergenic
935587683 2:104816484-104816506 CATCTGCAGAGCCATGAGCTGGG - Intergenic
935845332 2:107159957-107159979 CACCTTCAGCATCATCACCTGGG - Intergenic
936521045 2:113212420-113212442 CGTGTTCAGGAGCAGGAGCTCGG + Intergenic
943869466 2:192975507-192975529 CACCTTCAAAAGCATGTGCTAGG + Intergenic
944596949 2:201269513-201269535 CCACTTCTGCCGCATGAGCTGGG + Intronic
945298301 2:208192628-208192650 CAGCTGCAGCAGCCTCAGCTGGG - Intergenic
945556919 2:211288284-211288306 CTTCTTCAGCAGGTTGACCTGGG + Intergenic
946754873 2:222933752-222933774 CCTCTTCATCATCATGAGGTGGG - Intronic
948610920 2:239166417-239166439 CATCTTCAGCAGCATGAGCTGGG - Intronic
1168861341 20:1048159-1048181 GATCTCCAGCTCCATGAGCTAGG - Intergenic
1169916131 20:10685733-10685755 CAACTGCAGCAGCATGTGATGGG + Intergenic
1170790504 20:19505232-19505254 CAACTTCAGCATCATGAACAAGG + Intronic
1170930132 20:20762238-20762260 CATCTTCATGAGGATGGGCTAGG - Intergenic
1171090963 20:22285470-22285492 TCTGTTCAGCAACATGAGCTTGG - Intergenic
1173169765 20:40714491-40714513 CATATTCAGCTGCATAAACTAGG + Intergenic
1174640936 20:52043608-52043630 CATTTTCTGCAGCATGTACTGGG - Intergenic
1175315881 20:58046343-58046365 CAGCTTCTGCAGCACGTGCTGGG - Intergenic
1175579658 20:60088529-60088551 CACCTTCAGCAGGATGGCCTTGG + Intergenic
1175618767 20:60425287-60425309 CATCTTCAGCATCCTTAGCCAGG + Intergenic
1177479263 21:21665102-21665124 TATCTTCAGCAGAAAGTGCTGGG + Intergenic
1177690318 21:24498081-24498103 CATGTTCAGCAGGCTGAGTTGGG - Intergenic
1178818414 21:35952610-35952632 TAACTTCAGAAGCATGAGCCAGG - Intronic
1179081771 21:38178297-38178319 CATCTGCAGCAGCAAGAGCAGGG - Intronic
1181108695 22:20589350-20589372 CATCTTCTGCAGAGTGAGCGGGG - Intergenic
1182246245 22:28960137-28960159 CATCTTCATCAGAATCACCTGGG + Intronic
1182323169 22:29491537-29491559 TGTCTTCAGCAGCATCACCTGGG + Intergenic
1182371401 22:29813701-29813723 CATCTTCAGGAGCACGATCTGGG + Intronic
1183759666 22:39804742-39804764 CATCTTTAGGAGCCTGTGCTTGG - Intronic
1185260026 22:49856543-49856565 CGGCTTCAGCAGCAGGCGCTTGG - Intronic
949396505 3:3620045-3620067 CATCATCAGCAGCATCATCTAGG + Intergenic
949770913 3:7577232-7577254 AATCCTCAGCAGCATCACCTGGG + Intronic
950784142 3:15419050-15419072 GATCCTCAGCATCCTGAGCTGGG - Intronic
951182569 3:19676082-19676104 TTTCTGCAACAGCATGAGCTCGG - Intergenic
951443754 3:22752805-22752827 TATGTTCAGCAGCCAGAGCTAGG - Intergenic
955867447 3:63400029-63400051 CATCCTCTGCAGAATGGGCTGGG - Intronic
956450676 3:69371623-69371645 CATCTTCATCACCATGATCCTGG - Intronic
956738462 3:72256845-72256867 CATCTCCAGCAGCACCAGCAAGG - Intergenic
960151350 3:114251778-114251800 CAAGTTCAGCAGCATCAGGTTGG + Intergenic
963041803 3:141075635-141075657 CATCTTCATCAGCATCATCCAGG - Intronic
967382332 3:188872915-188872937 CTTATTCAACAGCATGTGCTCGG - Intronic
967456810 3:189696693-189696715 CATCTTCACCAGCAATTGCTTGG + Intronic
968262120 3:197333974-197333996 CAGCAGCAGCAGCAGGAGCTAGG + Intergenic
968967850 4:3778339-3778361 CAGCTGCAGCAGCAGCAGCTGGG + Intergenic
969920479 4:10534315-10534337 CATCTTCAGCAGACAGAACTTGG - Intronic
971304394 4:25467121-25467143 CATCTAAAGCACCAGGAGCTAGG + Intergenic
972695304 4:41439469-41439491 CAACTTCAGCTTCCTGAGCTGGG - Intronic
975065831 4:70062406-70062428 CATCTTCAGGAGCTTTAGCTGGG - Intergenic
981671094 4:147287773-147287795 CAGCAGCAGCAGCATGACCTGGG + Intergenic
983444105 4:167826721-167826743 CATTTTTAGCAGCAAAAGCTTGG - Intergenic
985011341 4:185585163-185585185 CAGCTTCAGCACCATTGGCTCGG - Intergenic
986288554 5:6378950-6378972 CATGGTTAGCAGCAAGAGCTAGG - Intergenic
986338237 5:6770299-6770321 CAGCTTCTGCGTCATGAGCTTGG + Intergenic
987822420 5:22982949-22982971 CATATTTAGCAGCATATGCTTGG + Intergenic
987933335 5:24430720-24430742 CTTCTTCAGCAGCATGAAAACGG - Intergenic
989346069 5:40430769-40430791 CATCTTCAGCAGATTGAGACAGG - Intergenic
989598002 5:43175001-43175023 CAGCCTCAGCAGCATCTGCTTGG - Exonic
990847717 5:60162590-60162612 CATCTACATCAGAATGACCTGGG + Intronic
991552615 5:67857599-67857621 CAACTTCAGAATCATGTGCTGGG - Intergenic
992275211 5:75109480-75109502 CATATTCAGCAGCAAGAGTAAGG + Intronic
993764488 5:91838937-91838959 CTACTTCATCAGAATGAGCTTGG - Intergenic
994213712 5:97113596-97113618 CATCTTAAGGTGCATGACCTTGG - Intronic
994357603 5:98811535-98811557 CATTTTCAACAGCATGAACAAGG - Intergenic
995728556 5:115209884-115209906 CCAGTTCAGCAGCATGATCTTGG - Intergenic
999561657 5:152810003-152810025 CATCATCAGCAGCATAACCTGGG + Intergenic
999777163 5:154820598-154820620 CATCTGCATCAGAATAAGCTGGG + Intronic
1000231980 5:159324438-159324460 CACCATCAGCAGCATCACCTTGG + Intronic
1001016056 5:168142237-168142259 CATCTTCTGAAGCCTGAGCAGGG - Intronic
1001217056 5:169865914-169865936 CCTTTGCAGCAGCATGAACTCGG - Intronic
1001879992 5:175235017-175235039 CCTCGTCAGCAGAATGAGGTTGG - Intergenic
1002271440 5:178075274-178075296 GTGCTTCAGAAGCATGAGCTGGG + Intergenic
1002573531 5:180158189-180158211 CCACTGCAGCAGCGTGAGCTAGG - Intronic
1004564325 6:16781359-16781381 CAGCTGCAGCAGCATCACCTGGG + Intergenic
1006384240 6:33720383-33720405 CATCTTCTCCAGCATGAGCCGGG + Intergenic
1006613967 6:35312322-35312344 GGTACTCAGCAGCATGAGCTTGG + Exonic
1006918836 6:37614478-37614500 CATCTTCAGCAGAAAGATCAAGG - Intergenic
1010442471 6:75913181-75913203 CATCTTTAGCAGCATAATTTTGG - Intronic
1013264355 6:108480197-108480219 CATGTTCAGCAGTCTGAGTTAGG + Intronic
1015190805 6:130470073-130470095 CATTTTCAGCATCATCAGTTAGG + Intergenic
1016568767 6:145489739-145489761 CAGCCTCAGCAGCATCTGCTTGG + Intergenic
1016830722 6:148430774-148430796 CATCTGCATCAGCATCACCTGGG - Intronic
1016932751 6:149426394-149426416 CACCTTCAGCACCATGAGGTTGG + Intergenic
1018372418 6:163180259-163180281 CATCTTCACAAGGATCAGCTCGG - Intronic
1019195861 6:170282787-170282809 CCTCTTCAGCAGCATTCGTTGGG + Exonic
1021155376 7:17203467-17203489 CATCTTTACCAGCATGAACATGG - Intergenic
1023714016 7:43024682-43024704 CATCTTTAGAATCATGAGTTAGG - Intergenic
1024431805 7:49297310-49297332 CTTTTTCAGCAGCATGAGAATGG - Intergenic
1024607353 7:51033146-51033168 CATCTTCATCAGCTTGGGGTGGG - Intronic
1024758852 7:52569456-52569478 CATCCTCAGGAGCAGGGGCTGGG + Intergenic
1027557716 7:79686883-79686905 CATCTTCAGAGCCAGGAGCTTGG + Intergenic
1032568801 7:132977213-132977235 CAGCTGCAGTAGCATCAGCTGGG + Intronic
1033409646 7:141105643-141105665 CATCTTTAGCAGCTCGAACTTGG - Intronic
1033665785 7:143439120-143439142 CATCCTCAGCAGCAGCATCTGGG - Intergenic
1035368335 7:158362705-158362727 CATTTTCACCAGGATGAGCGTGG - Intronic
1038436259 8:27538908-27538930 GATCTTAAGCAGTAAGAGCTTGG + Intronic
1038975358 8:32689876-32689898 CATTTTCAGAAGCAAGAGGTAGG - Intronic
1039376025 8:37034965-37034987 CCTCTGCAGCAGGATGAGCTAGG - Intergenic
1040436754 8:47398715-47398737 GATCTTTTGAAGCATGAGCTAGG + Intronic
1040829223 8:51659353-51659375 CAGCTTCATCAGCTTGTGCTGGG - Intronic
1041410746 8:57551706-57551728 GTTCTTCAGCAGCAGGGGCTGGG + Intergenic
1042778128 8:72458185-72458207 CTTCTTAAGAAGCATAAGCTGGG - Intergenic
1045359469 8:101419305-101419327 CATCATCATCAGGATGTGCTGGG - Intergenic
1047821732 8:128528592-128528614 CATCTGCAGTATCATGAGGTTGG - Intergenic
1048796172 8:138152119-138152141 CATCTTCAGCAGCCTCCTCTGGG + Exonic
1052271666 9:26634109-26634131 CATTTTCAGCAGCATGAAAATGG - Intergenic
1054776757 9:69130534-69130556 CAGCAGCAGCAGCATGACCTGGG - Intronic
1059989179 9:119848521-119848543 CAGCTTCAGAAACATGAGCCTGG + Intergenic
1060863715 9:126978030-126978052 CATTTTCAGCAGGAGGAGCCTGG - Intronic
1061087194 9:128405983-128406005 CCTTCTCAGCAGCAGGAGCTGGG + Intergenic
1062284930 9:135768634-135768656 CATCCTCAGCAGCAGGAACGAGG + Exonic
1187971043 X:24658842-24658864 CATCTTCCTTAGCATGAGCTGGG + Intronic
1188206761 X:27369399-27369421 CATCATCATCATCATGATCTGGG + Intergenic
1188617228 X:32173122-32173144 CATTTTCAGCAGCATGTGGCAGG + Intronic
1190813777 X:53909850-53909872 AATCTTCAGCATTTTGAGCTAGG + Intergenic
1193332769 X:80254250-80254272 CATCTTCAGAAGTTTGACCTGGG - Intergenic
1195418608 X:104647664-104647686 CATCTTCACCAGCATCAGAGAGG - Intronic
1196069418 X:111503636-111503658 CATATTCATCAGCCTGAGATGGG + Intergenic
1197644318 X:129001633-129001655 CATCAGCATCAGCATGATCTGGG + Intergenic
1198802588 X:140462552-140462574 CATCATCATCATCATGAGCTGGG - Intergenic
1199543379 X:148982340-148982362 CATCTGCAGCACGATGGGCTGGG + Intronic
1200066183 X:153505124-153505146 CACCATCACCAGCATGAACTTGG - Intronic
1201483504 Y:14467210-14467232 CATCTTAAGAAGCACGAGTTGGG - Intergenic
1201701141 Y:16883603-16883625 CCCCTTCAGCAGGATGAACTTGG + Intergenic