ID: 948616617

View in Genome Browser
Species Human (GRCh38)
Location 2:239203226-239203248
Sequence GGGTGGGCACCCACTTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 193}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948616617_948616622 -7 Left 948616617 2:239203226-239203248 CCCCAGCAAGTGGGTGCCCACCC 0: 1
1: 0
2: 1
3: 13
4: 193
Right 948616622 2:239203242-239203264 CCCACCCAGCACAGACAAGGTGG 0: 1
1: 0
2: 1
3: 39
4: 412
948616617_948616628 10 Left 948616617 2:239203226-239203248 CCCCAGCAAGTGGGTGCCCACCC 0: 1
1: 0
2: 1
3: 13
4: 193
Right 948616628 2:239203259-239203281 AGGTGGACACAGGTGCACCTGGG 0: 1
1: 0
2: 1
3: 31
4: 221
948616617_948616627 9 Left 948616617 2:239203226-239203248 CCCCAGCAAGTGGGTGCCCACCC 0: 1
1: 0
2: 1
3: 13
4: 193
Right 948616627 2:239203258-239203280 AAGGTGGACACAGGTGCACCTGG 0: 1
1: 0
2: 3
3: 19
4: 176
948616617_948616620 -10 Left 948616617 2:239203226-239203248 CCCCAGCAAGTGGGTGCCCACCC 0: 1
1: 0
2: 1
3: 13
4: 193
Right 948616620 2:239203239-239203261 GTGCCCACCCAGCACAGACAAGG 0: 1
1: 1
2: 4
3: 22
4: 221
948616617_948616626 0 Left 948616617 2:239203226-239203248 CCCCAGCAAGTGGGTGCCCACCC 0: 1
1: 0
2: 1
3: 13
4: 193
Right 948616626 2:239203249-239203271 AGCACAGACAAGGTGGACACAGG 0: 1
1: 0
2: 2
3: 25
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948616617 Original CRISPR GGGTGGGCACCCACTTGCTG GGG (reversed) Intronic
900138354 1:1128306-1128328 GGGGGGGCACCAACTCCCTGGGG - Intergenic
902509568 1:16958804-16958826 AGGTGGGCACCCCAATGCTGGGG + Intronic
902606335 1:17571358-17571380 CGGTGGGCACACACTTGGTTGGG + Intronic
902711045 1:18239988-18240010 GGCTGGGCACACACAGGCTGTGG + Intronic
902734437 1:18390840-18390862 GGGGGGGCACCCGCGTGTTGAGG + Intergenic
903706621 1:25290519-25290541 TGTTGGGCACCTACTTTCTGTGG - Intronic
904373175 1:30063622-30063644 GGGTGGGCACACCTTTGCAGAGG + Intergenic
904422816 1:30405112-30405134 TAGTGGGCACCCACATGCTCAGG + Intergenic
905208662 1:36358170-36358192 CTGTGGGCTGCCACTTGCTGGGG - Intronic
907939235 1:59071459-59071481 GGGTGTGCAGCCTCCTGCTGTGG - Intergenic
909866973 1:80686003-80686025 GGGTGGGCTCCCACAGGCTTGGG + Intergenic
915168101 1:153959749-153959771 AGGTGGGTACCCAGCTGCTGTGG - Exonic
915512021 1:156391671-156391693 TGGTGGGCACCCAGTAACTGAGG - Intergenic
916758070 1:167792197-167792219 CGGAGGGCATCCACCTGCTGGGG + Intergenic
918332164 1:183471599-183471621 GGGTGTCCCCCCAGTTGCTGTGG + Intergenic
920824888 1:209416011-209416033 GGCAGGGCATCCACCTGCTGAGG - Intergenic
922172613 1:223168297-223168319 GGGTCAGCACCCACTTGAGGAGG - Intergenic
923540737 1:234886290-234886312 GGGTGGGCACCGACTGGATGAGG + Intergenic
1066595922 10:37049949-37049971 GGGTCAGGACCCACTTGATGAGG + Intergenic
1068210145 10:53910198-53910220 GGGTAGGGACCCACTTGAGGAGG - Intronic
1068452602 10:57211715-57211737 GGGTGGGCTCCCACAGTCTGGGG + Intergenic
1070149552 10:73797457-73797479 GGCTGGGCCCCCACCTCCTGGGG + Exonic
1071504018 10:86222159-86222181 GGGGGGCCACCCATTTGCAGAGG + Intronic
1075658679 10:124178330-124178352 TGGTGGGGACCTTCTTGCTGTGG + Intergenic
1076734432 10:132452395-132452417 GCGTGGGCACCCAGTGCCTGGGG - Intergenic
1076903676 10:133351931-133351953 TGGTGGGCACCCTCCTGCGGGGG + Intronic
1077215321 11:1393032-1393054 GGGTGGGAACCCACCTGCAAAGG + Intronic
1077503168 11:2918292-2918314 GGGTGGGCCCCCACGGGCAGAGG + Intronic
1077980231 11:7292560-7292582 GGTTGGGATCCCACTTCCTGTGG + Intronic
1080818180 11:35779133-35779155 GGGAGGGCATCCACTTGCTGAGG - Intronic
1091992143 12:4964022-4964044 AACTGGGCACCCACCTGCTGGGG + Intergenic
1092994305 12:13933784-13933806 GGGTGTGGAGCTACTTGCTGTGG + Intronic
1094099101 12:26742040-26742062 GTGTGGGCACTCCCTTGCAGAGG - Intronic
1101296148 12:103425351-103425373 GGGCAGGCACCCACTTGAGGAGG - Intronic
1104719007 12:131034262-131034284 GGGTGGGAATGCACTTGATGTGG - Intronic
1113849803 13:113411703-113411725 GGGTGAGCCCCGCCTTGCTGAGG + Intergenic
1115641683 14:35339305-35339327 GGGTGCGCACCTGGTTGCTGAGG - Intergenic
1122649744 14:103220109-103220131 GGGTAGGCACTGACTTGGTGTGG - Intergenic
1122873544 14:104652252-104652274 GGGTGGACACACACTTGGTGGGG - Intergenic
1123061796 14:105597838-105597860 TGGTGGGCACCCACCTCCAGGGG - Intergenic
1123086534 14:105719569-105719591 TGGTGGGCACCCACCTCCAGGGG - Intergenic
1127265186 15:57355273-57355295 GACTGGGCACCCACTTGCCATGG - Intergenic
1127981985 15:64042065-64042087 GAGAGGGTACCCACCTGCTGTGG - Intronic
1129853911 15:78811107-78811129 GGGCGGACACCCACCTGGTGCGG + Exonic
1130206674 15:81881895-81881917 GGGCGGGCACCCACAAGCAGAGG + Intergenic
1130394990 15:83493915-83493937 GGGTGGGCAGCCACTGGGAGAGG + Intronic
1131102532 15:89704201-89704223 TGGTGGGCACCCAGGTGCTCGGG + Intronic
1131179081 15:90228063-90228085 TGGTGGGCACCCAACAGCTGGGG + Exonic
1136786661 16:32939134-32939156 GGGTGGACACCCCCTTGTAGGGG - Intergenic
1138197912 16:55067554-55067576 GGGTGGGTTCCCACCTGCTGTGG + Intergenic
1138351472 16:56348313-56348335 GAGTGGGCACACTCCTGCTGGGG + Intronic
1141533877 16:84665688-84665710 AGGTGGGCATCCAGATGCTGAGG + Intronic
1203145534 16_KI270728v1_random:1795629-1795651 GGGTGGGGCCCCCCTGGCTGGGG + Intergenic
1142515030 17:422319-422341 GGCTTGGCTCCCACCTGCTGAGG - Intronic
1143783068 17:9239595-9239617 GGGTGGGCTCCCAGCTGCTGTGG - Intronic
1144813819 17:18019276-18019298 GGGTGGGCAGCCACTGGCCCTGG - Intronic
1145041658 17:19581912-19581934 GAGTGGACACCCAGATGCTGAGG - Intergenic
1146055974 17:29581426-29581448 AGGTGGGCTCCCAGCTGCTGAGG - Intronic
1147376781 17:40027249-40027271 GGGTGGGCACCTGGTTTCTGAGG + Intronic
1150961437 17:69916901-69916923 GGATGGGCAGACACATGCTGAGG + Intergenic
1152223653 17:79082758-79082780 GGCTGGGCCCCAACTGGCTGTGG - Intronic
1154346497 18:13547642-13547664 GGGTGGGCAGCTCCTTGCTGTGG + Intronic
1155057799 18:22200466-22200488 GGAAAGGCCCCCACTTGCTGGGG + Intronic
1156322393 18:36038736-36038758 GGGTGGGCTCCCACTGCCTTGGG - Intronic
1159570338 18:70104941-70104963 GGTTGGGGACCCACTTGAGGAGG + Intronic
1160960811 19:1719980-1720002 GGGTGGGCAGCCACTTGCCAGGG + Intergenic
1161045059 19:2130249-2130271 GGCTGGGCCTCCCCTTGCTGGGG - Intronic
1161152037 19:2714649-2714671 GTGGGGGCACCCACATGCGGGGG + Exonic
1161638943 19:5407502-5407524 GGGTGGGCAGCCACTTCCCAGGG - Intergenic
1163328477 19:16620510-16620532 ATTTGGGCACCCACGTGCTGTGG + Intronic
1163647970 19:18501071-18501093 GGGTGTGCGCCCACATGCTTGGG - Intronic
1165424443 19:35738190-35738212 AGGTGGGCTCCCAGTGGCTGTGG + Exonic
1168311802 19:55464459-55464481 GGGCGGCCGCCCACATGCTGCGG - Intergenic
925993065 2:9269388-9269410 GGGTGGGCACACACGGCCTGCGG - Intronic
926112582 2:10192592-10192614 GGCTGGGCACCCCCTCGCTGGGG + Intronic
927943248 2:27118832-27118854 GGGGTGTCACCCACCTGCTGCGG + Exonic
929876878 2:45804173-45804195 GGGTTTGCTCCCACTGGCTGTGG - Intronic
931475770 2:62586291-62586313 GGGTAGGGACCCACTTGAGGAGG + Intergenic
931716259 2:65031403-65031425 GTGTGGGCAAGCACCTGCTGCGG - Intergenic
932327317 2:70871739-70871761 GGGCGGGCACCGACTGGCGGCGG + Intergenic
933864721 2:86505791-86505813 GGGTAGGCAGCCCCTAGCTGCGG + Exonic
934553257 2:95274856-95274878 GGCTGGGGACCCAAATGCTGAGG - Intronic
936963028 2:118096767-118096789 TGGTGGGTACCCCCATGCTGTGG + Exonic
938244287 2:129765235-129765257 TGGTGGGCACCAAGGTGCTGAGG + Intergenic
942417572 2:175775150-175775172 GGGTGGGAACCCTGTTGATGCGG - Intergenic
942521612 2:176809752-176809774 GGGTGGGCCCCAAGTTCCTGAGG - Intergenic
944104000 2:196059781-196059803 GGGTGGACAAACATTTGCTGAGG - Intronic
945495843 2:210506083-210506105 GGGTCAGCACCCACTTGAGGAGG - Intronic
946164179 2:217853814-217853836 GGGTGTGCACCCACTCCCCGGGG + Intronic
946696815 2:222368207-222368229 GGGTAGGGACCCACTTGAGGAGG + Intergenic
947697579 2:232204796-232204818 GGCTGGGCTCCCAAGTGCTGAGG + Intronic
947745791 2:232506673-232506695 GGGTGGGGAAACACTGGCTGGGG + Intergenic
948616617 2:239203226-239203248 GGGTGGGCACCCACTTGCTGGGG - Intronic
1169097478 20:2915794-2915816 AGATGGGCACCATCTTGCTGAGG - Intronic
1169211041 20:3766553-3766575 GGCTAAGCACCCACTAGCTGAGG - Intronic
1169389446 20:5177738-5177760 GGCTGGGCACCCCCTTCCTGAGG + Intronic
1169622569 20:7524646-7524668 GGGTGGGCATAGATTTGCTGTGG - Intergenic
1170265920 20:14466977-14466999 GGTTGGGGACCCACTTGAGGAGG + Intronic
1171166526 20:22976758-22976780 GGGTGGGCTCACCCATGCTGGGG - Intergenic
1171372692 20:24671875-24671897 AGGTGGGCCCCGACTTGCTGAGG + Intergenic
1172707301 20:36891585-36891607 GAGTGGGCACCACCTTGGTGGGG - Exonic
1172914965 20:38436495-38436517 GGGTGGTTACCCCCATGCTGCGG + Intergenic
1173142742 20:40498528-40498550 GGGTGGGGAACCACTTGTGGGGG + Intergenic
1173347666 20:42215782-42215804 GGCTGGATACCCACTGGCTGGGG - Intronic
1174197589 20:48784668-48784690 TGGTGGGCTCCCAGTTCCTGTGG - Intronic
1174212594 20:48891763-48891785 GGGAAGACACCCACCTGCTGGGG + Intergenic
1175138492 20:56842544-56842566 GGGTGGGCACACGCTTGGGGTGG + Intergenic
1175776347 20:61656235-61656257 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1175776353 20:61656255-61656277 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1175776359 20:61656275-61656297 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1176054889 20:63139835-63139857 GTCTGGGCACCCTCTTGTTGTGG + Intergenic
1176086143 20:63296469-63296491 GGGTGGGAGCCCACACGCTGGGG + Intronic
1176140736 20:63543631-63543653 GTGTGGGCAGCCACAGGCTGGGG + Intronic
1178002848 21:28182813-28182835 GAGTGGGCACCCACATCCTTGGG - Intergenic
1178760099 21:35393958-35393980 GGGTGCTCACCTACTTGCTTTGG - Intronic
1179069458 21:38058184-38058206 GGGTGGACAGCCCCTTCCTGAGG + Intronic
1180000793 21:44994653-44994675 CCGCGGGCACCAACTTGCTGCGG - Intergenic
1180200118 21:46219196-46219218 GGGTGGCTTCCCTCTTGCTGTGG - Intronic
1181459708 22:23078775-23078797 GGGTGGGAGCACACTTGCAGGGG + Intronic
1182303154 22:29350021-29350043 GGGCGGGCACGCACTTGTTGGGG + Exonic
1182512318 22:30828072-30828094 GGCTGGGGACTCACTTTCTGGGG + Intronic
1184185346 22:42861171-42861193 GGGTGGGCATCCAGCTGCTCAGG + Intronic
1185132803 22:49049559-49049581 GGGTGGTTACCCAGATGCTGCGG - Intergenic
1185242444 22:49754000-49754022 GGCTGGCCTCCCACCTGCTGGGG + Intergenic
949261362 3:2106091-2106113 AGGTGGGCTCCCACTGTCTGGGG + Intronic
950525049 3:13518582-13518604 GAGTGGGCACCCGCCTGCAGAGG + Intergenic
951509713 3:23487160-23487182 GGGTGTGCACACACTTGGGGTGG - Intronic
956005874 3:64777453-64777475 GGTTGGGGACCCACTTGAGGAGG - Intergenic
961476568 3:127150419-127150441 GGCTGGGTTCCCACTTGCTGGGG - Intergenic
962939250 3:140110758-140110780 AGGTGGGCACCCAGAGGCTGAGG - Intronic
963549306 3:146700428-146700450 GGGTGGTTACCCACAGGCTGAGG - Intergenic
965301501 3:167011077-167011099 GGGTGGGCTCCCACAGGCTTGGG + Intergenic
966302218 3:178492487-178492509 TGGTAGACACCCACTGGCTGTGG - Intronic
970319910 4:14864833-14864855 GTGTAAGCACTCACTTGCTGTGG - Intergenic
972364538 4:38361862-38361884 TGGTGAGCGCCCTCTTGCTGGGG - Intergenic
973982197 4:56315921-56315943 GTGTGGGCCACCACTTTCTGCGG - Exonic
975057817 4:69957389-69957411 GGGTAGGGCACCACTTGCTGGGG + Exonic
976226171 4:82797442-82797464 GGGTGGGCACGCAGTCCCTGGGG + Intronic
979990355 4:127367710-127367732 GGGTGAGCACACACTTGCGAAGG + Intergenic
980848800 4:138355432-138355454 GGGTAGGGACCCACTTGAGGAGG - Intergenic
981128607 4:141133374-141133396 GCCTGGGCACGCACTTGCCGCGG + Intronic
982820125 4:159934514-159934536 GGTTGGGGACCCACTTGAGGAGG + Intergenic
983694381 4:170510536-170510558 GGGTAGGGACCCACTTGAGGAGG + Intergenic
986148277 5:5101455-5101477 TGGAGGGCAGCCACTGGCTGGGG - Intergenic
986679479 5:10220446-10220468 GGCTGGACAGCCACTTGGTGGGG - Intergenic
989725267 5:44579625-44579647 GGTCGGGCACCCACTTGAGGAGG - Intergenic
999240436 5:150124483-150124505 GGGTGAGCACCCACACTCTGAGG + Intronic
1000001038 5:157139400-157139422 GGAAGTGCACTCACTTGCTGTGG + Exonic
1001925600 5:175633942-175633964 GGATGGTCACTCACTTACTGGGG + Intergenic
1001984220 5:176060613-176060635 CGGTGTCCAGCCACTTGCTGCGG - Intronic
1002233255 5:177783452-177783474 CGGTGTCCAGCCACTTGCTGCGG + Intronic
1002262723 5:178006329-178006351 CGGTGTCCAGCCACTTGCTGCGG - Intergenic
1002282272 5:178138250-178138272 GGGTGGCCACCCACCTGCGCTGG - Exonic
1004159446 6:13200675-13200697 GGGTGGCCACCCACTTTGGGAGG + Intronic
1006173086 6:32106652-32106674 GGGTGGGGAGCCTCTTGGTGTGG - Intronic
1006742491 6:36319535-36319557 GGGTGGCTACCAGCTTGCTGAGG + Exonic
1007788352 6:44294991-44295013 GGGTGGATACCCAATAGCTGGGG + Intronic
1008940407 6:57040282-57040304 GGGTGAATACCCTCTTGCTGTGG - Intergenic
1009630068 6:66186279-66186301 GGATGGGTAATCACTTGCTGTGG + Intergenic
1010668252 6:78655288-78655310 GGTTGGGGACCCACTTGAGGTGG + Intergenic
1013170935 6:107635685-107635707 GGCTTGGCACTCACATGCTGTGG - Intronic
1015967666 6:138711377-138711399 GGTTGGGGACCCACTTGAGGAGG + Intergenic
1016584961 6:145673980-145674002 GGTTGGGGACCCACTTGAGGAGG - Intronic
1022691859 7:32663924-32663946 GGCTGAGCACACACTTTCTGAGG - Intergenic
1022919521 7:34998465-34998487 GGCTGAGCACACACTTTCTGAGG - Intronic
1023835480 7:44065042-44065064 GGGTGGGGGCCCACTGGCTTGGG - Intronic
1023891350 7:44394083-44394105 GGGTGGGCACCGATGTGGTGCGG + Intronic
1024520822 7:50303617-50303639 GGGTGGGCACTCGCATCCTGGGG + Intergenic
1024692581 7:51819011-51819033 GGGTGCAGAGCCACTTGCTGAGG + Intergenic
1025202026 7:56968375-56968397 TGGTGGGCACACACCAGCTGTGG - Intergenic
1025669921 7:63608553-63608575 TGGTGGGCACACACCAGCTGTGG + Intergenic
1027188606 7:75985652-75985674 GCGTGGCCACCAACTGGCTGCGG + Exonic
1027233013 7:76282864-76282886 GGGCGGGCACTCACCGGCTGAGG - Exonic
1029636248 7:101786259-101786281 TTATGGGCACCAACTTGCTGGGG + Intergenic
1030820754 7:114087747-114087769 GTGTGGACCCTCACTTGCTGTGG + Intronic
1031739188 7:125407295-125407317 TGCTGGGCATTCACTTGCTGTGG + Intergenic
1033404378 7:141057652-141057674 GGGAAGGGACCCTCTTGCTGGGG - Intergenic
1040383397 8:46894630-46894652 GGTTGGGGACCCACTTGAGGGGG - Intergenic
1040389969 8:46941396-46941418 GGGTTGGGACCCACTTGAGGAGG - Intergenic
1040819288 8:51537274-51537296 GGCTGGACACCCTCTGGCTGGGG + Intronic
1046014684 8:108590739-108590761 GGGTAGGGACCCACTTGAGGAGG - Intergenic
1049589845 8:143452445-143452467 GTGTGAGCAGCCACTTTCTGTGG - Intronic
1049735528 8:144202825-144202847 GGGGGGGCACCCGCTCTCTGTGG + Intronic
1049850763 8:144829052-144829074 GGGTGGGCATCCACGTGTTCTGG - Exonic
1055451209 9:76433021-76433043 GGGTGGTCTCCCACTTGGTCGGG - Intronic
1057875330 9:98749273-98749295 GGGCTGGCAGCCACTGGCTGAGG - Intronic
1058937114 9:109779943-109779965 GCGTGGACACGCGCTTGCTGGGG - Intronic
1059331742 9:113539885-113539907 GGGAGGTCACTCCCTTGCTGTGG + Intronic
1059913941 9:119077640-119077662 GGATGGGCAATCGCTTGCTGAGG - Intergenic
1060221024 9:121764179-121764201 GTGTGGGCCCCCACTTGGGGTGG + Intronic
1061358480 9:130124465-130124487 GGGGGGTCTCCCACTAGCTGAGG - Intronic
1061541502 9:131280005-131280027 GTGTGGGCGCCCACATGGTGAGG + Intergenic
1061878515 9:133556873-133556895 GGGTGGCCACCCTCTATCTGGGG - Intronic
1062495224 9:136828337-136828359 GCGTGGGCACCCACAAGCTCTGG - Intronic
1062544826 9:137057015-137057037 GGGAGGGCACCCACTGGCCTGGG + Intergenic
1185461295 X:333777-333799 GGGTGGGGTCCCCCTGGCTGGGG + Intergenic
1191717979 X:64205920-64205942 GGGTGCGGAACCACTGGCTGGGG + Intergenic
1192497240 X:71623959-71623981 GGGTGGACACCCACTTGGCTGGG + Intergenic
1194015975 X:88622281-88622303 GGTTGAGCTGCCACTTGCTGGGG - Intergenic
1194206243 X:91015068-91015090 GGGTGGGCTCCCACGTCCTTGGG + Intergenic
1194888415 X:99348030-99348052 GTGAGGGCTCCCACTTGCTTAGG + Intergenic
1197784529 X:130187019-130187041 GGCTGGGCTCCCACTGTCTGTGG + Intergenic
1199173426 X:144757763-144757785 GGGTGGGCAGCCACTTGGGCAGG - Intergenic
1200064295 X:153497266-153497288 GGGTGGGGACCCACCAGCTGGGG + Intronic
1200126199 X:153816155-153816177 GGGTGGGGACCCACCAGCTGGGG - Intronic
1200551998 Y:4589889-4589911 GGGTGGGCTCCCACATCCTTGGG + Intergenic
1200746785 Y:6910538-6910560 GAGAGGGCACCCACTCGCCGCGG - Intergenic
1201308294 Y:12570257-12570279 GGTTGGGGACCCACTTGAGGAGG - Intergenic