ID: 948617671

View in Genome Browser
Species Human (GRCh38)
Location 2:239211765-239211787
Sequence CAGTTTAAGATGCTGGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948617671 Original CRISPR CAGTTTAAGATGCTGGATTC TGG (reversed) Intronic
903327788 1:22581185-22581207 CAATTGAAGGTGCTGGAGTCAGG - Intronic
904850303 1:33454369-33454391 CATTTTGAGGTGCTGGAGTCAGG - Intergenic
905619933 1:39436164-39436186 TAGTTTAAGATGCTTGAGTAAGG + Intronic
905834475 1:41105775-41105797 CGGATTCAGATGCTGGAGTCAGG - Intronic
906243942 1:44260119-44260141 CTGTTTGAGTTGCTGGGTTCTGG - Intronic
906502032 1:46348410-46348432 CTCTTAAAGATGATGGATTCTGG + Intronic
908211766 1:61907296-61907318 CAGTTTAAGGTCCTAGTTTCAGG + Intronic
909362782 1:74783460-74783482 GTGGTTAAGATGCTGGAATCTGG + Intergenic
909626400 1:77720860-77720882 CATTTTAACAGGCTAGATTCAGG - Intronic
910202171 1:84711198-84711220 CATTTAAATATGCTGAATTCTGG - Intergenic
912604310 1:110972823-110972845 CCTTTTAAGATACTGGAATCAGG + Intergenic
914810924 1:151027467-151027489 CAGTGAGAGATGCTGGACTCTGG - Intronic
917645787 1:177027411-177027433 CAGGTAGAGATGCTGGATTATGG - Intronic
920892708 1:210007741-210007763 GTGTTTAAGATCATGGATTCTGG + Intronic
1064483301 10:15760917-15760939 CAGTTTAAATTGGTGGTTTCTGG - Intergenic
1065159699 10:22907229-22907251 CATTCTAAGTTGCTGTATTCAGG + Intergenic
1071025079 10:81103087-81103109 TAGTTTAAAATCCAGGATTCGGG + Intergenic
1071876604 10:89849893-89849915 CAGCTTAGGAAGCTGGAATCTGG + Intergenic
1072338101 10:94418356-94418378 CAGTTACAGATGCTGTAATCTGG - Intronic
1072772169 10:98151263-98151285 CTGGTTAAGAGGCTGGGTTCTGG + Intronic
1074625770 10:115184257-115184279 AAGTATAAGATGCTGGCTTTGGG - Intronic
1075219947 10:120576232-120576254 CATTCAAAGAAGCTGGATTCAGG - Intronic
1075602419 10:123779993-123780015 CATTTCAAGATTCTGGGTTCAGG - Intronic
1076452083 10:130563278-130563300 CATTTTAAGGTGCTGGTATCTGG + Intergenic
1079384323 11:19965406-19965428 GAGTCTAAGATTCTGGGTTCTGG - Intronic
1085220862 11:74872733-74872755 CAGTTTCAGCTGCTGGAGCCAGG - Intronic
1085462853 11:76705429-76705451 ACGTTCAAGATGCTGGATTTTGG - Intergenic
1088035071 11:105301358-105301380 CAGTTGCATATGCAGGATTCTGG - Intergenic
1090018914 11:123109859-123109881 CAGTTTTAGATGCTGAAAACTGG + Intronic
1093961975 12:25284130-25284152 TAGTTTAAGATTGTGGATTTGGG - Intergenic
1102064539 12:109962834-109962856 CAATTTAAAATGCTGGCTACAGG + Intronic
1102503367 12:113368305-113368327 TGGTTTAAGCTGCTGGATTGGGG - Intronic
1102587315 12:113932489-113932511 CAGGGTAAGCTGCTGGCTTCAGG + Intronic
1102867696 12:116387065-116387087 CAGATTAAGGTGCTGGGTTCAGG - Intergenic
1102960129 12:117087078-117087100 CACTTCATGATGCTGGATGCTGG + Intronic
1106218841 13:27727769-27727791 CAGGTGAAGATGCCTGATTCGGG - Intergenic
1107292040 13:38865775-38865797 CAGTATAAGATGGTGGAATCTGG + Intronic
1107858588 13:44639327-44639349 CAGTGTTAGGTGCTAGATTCTGG + Intergenic
1108651761 13:52487884-52487906 CAGTTTAAGATGTTAGATAAAGG + Intergenic
1108835222 13:54537438-54537460 CAATTTAATATTCTTGATTCTGG + Intergenic
1108966926 13:56319374-56319396 CATTTTCAGATGATGAATTCAGG + Intergenic
1111255221 13:85659061-85659083 CAGTTCAAGTTGCTGAGTTCTGG - Intergenic
1114463278 14:22901980-22902002 CAGTCAGAGCTGCTGGATTCAGG + Exonic
1116565255 14:46437608-46437630 AGGCTTAAGATGCTGGGTTCTGG + Intergenic
1118060691 14:62135053-62135075 CAGGTGAAGATGATGGAATCGGG - Intergenic
1119651039 14:76383134-76383156 CAGTTTTAAATGCAGGATTTTGG - Intronic
1120314746 14:82876674-82876696 AAGGTTAAGATGCTGGCATCTGG - Intergenic
1121209576 14:92198016-92198038 CAGTTGAAAATGCCAGATTCTGG - Intergenic
1121558004 14:94852795-94852817 CAGTTTCACATGCTGGGTGCTGG - Intergenic
1122653727 14:103242755-103242777 CAGGTTAAGATGAAGGATTGTGG - Intergenic
1123505244 15:20935965-20935987 CAGTTTATGTTTCTGGAATCTGG - Intergenic
1123562483 15:21509667-21509689 CAGTTTATGTTTCTGGAATCTGG - Intergenic
1123598728 15:21946944-21946966 CAGTTTATGTTTCTGGAATCTGG - Intergenic
1127520856 15:59741789-59741811 CATTTAAAGATGCTGAATTGTGG - Intergenic
1202970835 15_KI270727v1_random:236807-236829 CAGTTTATGTTTCTGGAATCTGG - Intergenic
1134288216 16:12880805-12880827 CATTTTAAAATGCTGATTTCTGG + Intergenic
1137717987 16:50610753-50610775 GCGGTTAAGATGCTGGATTAGGG - Intronic
1139228498 16:65256909-65256931 TCCTTTAAGATGCTGGATACAGG - Intergenic
1139325550 16:66150148-66150170 CAGTTTAAGATGGGGGACTCAGG - Intergenic
1147036382 17:37684698-37684720 CAGTGTTAGCTGCTGAATTCAGG - Intergenic
1151992147 17:77582294-77582316 CATTTTAAAAACCTGGATTCAGG + Intergenic
1152157261 17:78642539-78642561 CAGTTAAAGATGGTGGAGCCAGG + Intergenic
1155146211 18:23085834-23085856 CAGGTTAAGATACAGGATTGTGG + Intergenic
1155216009 18:23643322-23643344 CAGTTGATGATGCTGGGTTCCGG + Intronic
1157931139 18:51824872-51824894 CAATTAAAGATGCAGGTTTCTGG + Intergenic
1158835856 18:61331529-61331551 CAGTTTAAGCTGCTAGAGACCGG + Intergenic
1159910117 18:74138086-74138108 CAGTTTCAGATGAGAGATTCAGG - Intronic
1161804724 19:6436252-6436274 GAGTCTAAGATTCAGGATTCAGG + Intronic
1163318813 19:16559960-16559982 CAATTGATGATGCTGGGTTCAGG + Intronic
1166427174 19:42689248-42689270 CAGCTTAAGCTGCTGGAGCCAGG + Intronic
1166438711 19:42791714-42791736 CAGTTTGAGCTGCTGGAGCCAGG + Intronic
1166473723 19:43102503-43102525 CAGTTTCAGCTGCTGGAGCCAGG + Intronic
1166494505 19:43289440-43289462 CAGTTTGAGCTGCTGGAGCCAGG + Intergenic
1167124834 19:47542353-47542375 CACTTTAAAATGGTGTATTCAGG + Intronic
925597617 2:5571399-5571421 CAGTTGATGCTGCTGGTTTCAGG - Intergenic
926579711 2:14621963-14621985 CAGCTTAAGGTGCTGGAATAGGG - Intergenic
928124317 2:28605386-28605408 CAGATGAAGAGGCTGGAGTCAGG + Intronic
928726231 2:34176939-34176961 CAGTTAAAGATACAGGGTTCAGG + Intergenic
931419580 2:62114018-62114040 CAGTTTGAAATGAGGGATTCAGG + Intronic
931891654 2:66679571-66679593 CAGATTAAGATGGGGGATTAAGG + Intergenic
932017294 2:68044072-68044094 CAGTTTTAAATGCTGAAGTCAGG - Intronic
932284315 2:70519481-70519503 CAGGTGAGGATGCTGGCTTCAGG + Intronic
935056052 2:99567821-99567843 AAACTTTAGATGCTGGATTCAGG + Intronic
935660996 2:105466938-105466960 TTTTTTAAGATGCTGGATTTTGG + Intergenic
935954405 2:108361447-108361469 AGGTTTAAGATTCTGGACTCTGG + Intergenic
937393977 2:121518418-121518440 CAGTTTTAGAGGCCGGGTTCTGG - Intronic
938682779 2:133709206-133709228 CAATTTAAGATGCTATATTTAGG - Intergenic
938896147 2:135752607-135752629 CAGGTTAAGATATTGTATTCAGG + Intronic
939220591 2:139296768-139296790 CAGTCTAAGATGAGCGATTCAGG + Intergenic
939676036 2:145072765-145072787 AAGCTTTGGATGCTGGATTCTGG + Intergenic
943264591 2:185712227-185712249 ATGTTTAACATGCTGTATTCGGG + Intergenic
947443872 2:230148284-230148306 CACTTTCAGATGGTGCATTCTGG - Intergenic
947766061 2:232638278-232638300 CATTTTAAGATGTTGCATTGGGG - Intronic
948617671 2:239211765-239211787 CAGTTTAAGATGCTGGATTCTGG - Intronic
1169941167 20:10938848-10938870 CAGATTAAGTTACTGGATTGAGG - Intergenic
1170168060 20:13381985-13382007 AAGTTGAAGAGGCTGGATCCTGG - Intergenic
1178542295 21:33463606-33463628 CACTTTAAATTGGTGGATTCTGG + Intronic
1183188782 22:36308195-36308217 CAGTTTAAGACGCTGTCTTTAGG + Intronic
1185306180 22:50118119-50118141 CAGTTCAAGATGAGGGATTATGG + Intronic
950967108 3:17154234-17154256 CAGTTCAATGTGCAGGATTCTGG + Intergenic
959698500 3:109275219-109275241 CAGTATAAAATGATGGTTTCAGG - Intergenic
959780221 3:110223114-110223136 CAGTTTAAGATGGCAGATTGTGG - Intergenic
960335816 3:116416408-116416430 CAGTTTAAGATACTACATTTGGG + Intronic
960564577 3:119119602-119119624 CAGTCAAAGATGCTGGCTTTTGG - Intronic
962984510 3:140522248-140522270 CAGTTGAAGGTGCTGAATTCAGG + Intronic
963545124 3:146647486-146647508 CTCATTAAGTTGCTGGATTCTGG + Intergenic
963927495 3:150966382-150966404 CAGTTTAAGAAGTTAGATTTAGG + Intronic
965225707 3:165987000-165987022 AAGTTTTAGATTCTGGACTCAGG - Intergenic
967452464 3:189642453-189642475 ACGTTTAAGAGACTGGATTCGGG + Intronic
972028709 4:34423330-34423352 CTGCTTAAGATGCTGGATTGAGG - Intergenic
972658234 4:41087727-41087749 TTGTTTAAAATACTGGATTCTGG - Intronic
972846835 4:43001433-43001455 CAGTTTAAAATGCTGAATTCAGG + Intronic
972915486 4:43872651-43872673 CAGTTTAAAATGATGGGTTAAGG - Intergenic
974336959 4:60560600-60560622 GTGTTTAAGGTTCTGGATTCTGG - Intergenic
977525514 4:98141466-98141488 CAGGTTAAGATACAGGATTGTGG - Intronic
979434448 4:120672175-120672197 CAGTTGAATCTGCCGGATTCAGG - Intergenic
982223501 4:153144555-153144577 CAGTTTAAGATGCTCTATATTGG - Intergenic
982346892 4:154369629-154369651 TATTTTAAGCTGCTAGATTCAGG + Intronic
983003011 4:162443247-162443269 CAGTTAAAGGTGATGGACTCTGG + Intergenic
983064411 4:163192529-163192551 CAGTTTAAGCTGCTGGAGCCTGG + Intergenic
984328751 4:178288122-178288144 CAGTTTAAATTGCTGTCTTCTGG + Intergenic
986340492 5:6784914-6784936 AAGATTATGATGCTGGAGTCTGG + Intergenic
986490048 5:8280166-8280188 CAATTCTAGATTCTGGATTCTGG - Intergenic
988910329 5:35834341-35834363 TAGTTTAAGATCATGGATTTGGG - Intergenic
989070368 5:37504048-37504070 CTGTTTTGGATTCTGGATTCAGG + Intronic
989475871 5:41871775-41871797 CATTTTAAGAAGTTGGATTGGGG + Intergenic
992661046 5:78961008-78961030 CAGTTGCTGATGCTGGACTCAGG - Intronic
992877801 5:81075171-81075193 CAGTATAAGTAGTTGGATTCTGG + Intronic
997185903 5:131881586-131881608 CAGTTTATGATGCAGGAGTCTGG - Intronic
998101977 5:139442057-139442079 CAGTTTTAGTGGCTGGATTCAGG - Intronic
999882345 5:155879970-155879992 CAGCTGAAGAAGCTGGATTGGGG + Intronic
1003180966 6:3791154-3791176 CAGTTAAAGATTCTGGAAACGGG + Intergenic
1010574028 6:77510419-77510441 CAGTTTGAGCTGCTGGAGCCAGG + Intergenic
1010896153 6:81366887-81366909 CAGTTTTAAAGGCTGCATTCAGG + Intergenic
1013419930 6:109958194-109958216 CATTTCATGATGCTGGATTTGGG - Intergenic
1015885163 6:137910478-137910500 CAGCTTGAGATGCTGAATTGAGG - Intergenic
1015998141 6:139015466-139015488 AAGTTTAAGATGCTCTGTTCTGG - Intergenic
1016488220 6:144566789-144566811 CAGTTTGAGAAGCTGGAATAAGG - Intronic
1016844708 6:148559090-148559112 CAGTTTCAGATGACGGAATCAGG - Intergenic
1018177513 6:161189892-161189914 CATTTTAACATGCTGAAATCAGG + Intronic
1019220010 6:170465711-170465733 GGGTTTAGGATGCAGGATTCAGG - Intergenic
1024973722 7:55094232-55094254 CAGGATAAGAAGCTGGATGCTGG - Intronic
1026419991 7:70225103-70225125 CAGTTTAAGAAGCTTATTTCAGG + Intronic
1026492603 7:70875658-70875680 GCGATTAAGATCCTGGATTCTGG - Intergenic
1027459474 7:78435011-78435033 AAGTTTAAGAGCTTGGATTCTGG + Intronic
1027817675 7:82997883-82997905 CATTTAAAGATACTGGCTTCTGG + Intronic
1028125640 7:87109762-87109784 CAGTTCCACATGCTGGATTATGG + Intergenic
1030621822 7:111798293-111798315 CAGTTTGAGCTGCTGGAGCCAGG - Intronic
1031113737 7:117644182-117644204 GTGTTTATGATGCTGGTTTCTGG + Intronic
1031291192 7:119938151-119938173 AAAGTTAAGATGCTGAATTCAGG + Intergenic
1033357470 7:140611938-140611960 CAGTTTAAGATGGTGAATGTTGG + Intronic
1035897344 8:3418226-3418248 CAGTGTGAAATGCTGGACTCTGG + Intronic
1037738514 8:21586033-21586055 CAGTAAAAGCTGCTGAATTCAGG + Intergenic
1037927736 8:22857721-22857743 CAGTATTCGATGCTGGCTTCTGG - Intronic
1038692087 8:29773168-29773190 AAGTTGAAGATGCTGAACTCTGG + Intergenic
1043773446 8:84234424-84234446 CAGTTTAAGCTCAAGGATTCAGG - Intronic
1044529521 8:93291532-93291554 CAGTGTAACATGCTGGCTCCTGG - Intergenic
1044874821 8:96654948-96654970 CAGCTGAACATGCTGTATTCTGG - Intronic
1046028528 8:108754748-108754770 CAGCTTGAGATGGTGGATTGTGG - Intronic
1047473899 8:125206733-125206755 GAATTTAAGGTGCTGGATTTTGG + Intronic
1048582329 8:135740017-135740039 CAGTTGAAGCTGCTGGACTCAGG + Intergenic
1049701318 8:144014515-144014537 CTGTTTAAGAAGCTAGACTCTGG + Intronic
1050310725 9:4350623-4350645 CAATTTAACATTTTGGATTCTGG - Intergenic
1051628032 9:19116901-19116923 CAGTTTAAGATGATGAACTTTGG - Intronic
1053030106 9:34768262-34768284 CTGTTTAAGAAGCTTGAATCTGG + Intergenic
1055612377 9:78036119-78036141 TTGTTCTAGATGCTGGATTCAGG - Intergenic
1059236828 9:112768035-112768057 CACTTTATGAAGGTGGATTCTGG - Intronic
1060280262 9:122211051-122211073 CAGTTTTAGATGTTGGAATATGG - Intronic
1062647462 9:137556145-137556167 CTGTTTCAGAGTCTGGATTCTGG + Intronic
1186447983 X:9648122-9648144 CAGGTAAAGATGTGGGATTCAGG - Intronic
1188273071 X:28166479-28166501 CAGTTTAAGTACCTAGATTCTGG + Intergenic
1188803872 X:34563215-34563237 CAGTTTAAGATAAAGGATTTGGG + Intergenic
1188957330 X:36448959-36448981 CAGTTCCAGATGCTGTACTCAGG + Intergenic
1189140010 X:38593762-38593784 AAGATTAAGGTGCTGGAATCTGG - Intronic
1192183882 X:68933033-68933055 AAGGTTAAGATCATGGATTCAGG + Intergenic
1192789759 X:74369821-74369843 CAGATTAAGTAGCTGGCTTCTGG + Intergenic
1196676030 X:118420804-118420826 CAATTTTATCTGCTGGATTCAGG - Intronic
1197020466 X:121681594-121681616 CAGGTGAAGATGCTGGATATGGG + Intergenic
1198402953 X:136285311-136285333 CAGTTTGTGATGCTAGATTCTGG - Intergenic
1200041678 X:153375413-153375435 CAGTTTATGATGCTTTGTTCTGG + Intergenic