ID: 948617854

View in Genome Browser
Species Human (GRCh38)
Location 2:239212972-239212994
Sequence ACGTGGGTACAGAGGCTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 110}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948617854 Original CRISPR ACGTGGGTACAGAGGCTAGA GGG (reversed) Intronic
902050745 1:13562041-13562063 CAGTGGGAACAGAGACTAGAGGG - Intergenic
902989284 1:20174986-20175008 AGGTGGGTGCAGAGGCTCTAAGG - Exonic
904907126 1:33906073-33906095 ATGTGGGTACCCAGGCTCGAGGG - Intronic
907918990 1:58895730-58895752 ATGTGGGTACAGAGATTACAAGG - Intergenic
916444474 1:164859406-164859428 ACTTGGGTGCAGAGGATAAATGG - Intronic
917715504 1:177733004-177733026 TGGTGGTTACAGAGGCTGGAGGG + Intergenic
919748886 1:201024478-201024500 ACCTGGGTAGAGAGGCTGGGCGG + Intergenic
921658639 1:217771811-217771833 ACGTGTATACATAGGCTAGATGG - Intronic
922486918 1:225980567-225980589 ACCTAGGAAGAGAGGCTAGATGG + Intergenic
924378802 1:243441280-243441302 ATGTGGGTACAGGGGATGGATGG + Intronic
1064950404 10:20842875-20842897 TGGTGGTTACAGAGGCTGGAGGG - Intronic
1067147001 10:43701338-43701360 TTGGGGGTACAGAGGCTGGAAGG + Intergenic
1073218290 10:101849101-101849123 AAGTGGGTACAGAGGCCTGCAGG + Intronic
1076813119 10:132899339-132899361 AGGTGGGTACAAGGGCAAGAGGG + Intronic
1078354220 11:10622304-10622326 ACAGAGGCACAGAGGCTAGAGGG + Intronic
1080857911 11:36128425-36128447 TCGTGGGTAGAGATGCCAGAGGG + Intronic
1081734626 11:45394308-45394330 TTGTGGGCACAGAGGGTAGAGGG + Intergenic
1083643215 11:64156811-64156833 ACTTGGGTCCATAGACTAGAAGG - Intronic
1087331476 11:96786596-96786618 GCTTTGGTACACAGGCTAGAGGG - Intergenic
1087985054 11:104668458-104668480 ACGTTGGTACAGAGGAAAGGAGG + Intergenic
1089205306 11:116756685-116756707 ACGTGGGTACAGATGTTGGTAGG + Intronic
1091456020 12:608591-608613 GCTTGGGTACAGCGGCTAAAGGG - Intronic
1108238462 13:48434721-48434743 ACAGGGGTAGAGAGGCTGGAGGG - Intronic
1113093138 13:106635851-106635873 ACGAGGGAGCAGAGGCTGGACGG - Intergenic
1114654409 14:24307579-24307601 ATGAGGGTAGAGTGGCTAGAGGG + Exonic
1115324251 14:32120255-32120277 ACGTCACTACAGATGCTAGAAGG - Intronic
1122863438 14:104592985-104593007 ACCTGGGGCCAGAGGCTGGAAGG + Exonic
1124934219 15:34155068-34155090 ATGTGAGTATAAAGGCTAGAAGG + Intronic
1124935025 15:34161812-34161834 ATGTGAGTATAAAGGCTAGAAGG + Intronic
1125425029 15:39540008-39540030 GCCTGGCTACAGAGGCTGGAAGG + Intergenic
1127827287 15:62715861-62715883 AGGTGGGGACAGAGGGAAGAGGG - Intronic
1128568051 15:68714193-68714215 GCTTGGGTACAGAGGCTTCAAGG + Intronic
1129186438 15:73910118-73910140 ATGTGGGTAGTGAGGATAGATGG - Intergenic
1130449014 15:84032052-84032074 AAGTGGGGAGAGAGCCTAGAAGG + Intronic
1132756668 16:1488520-1488542 AGGTGGGGCCAGAGGCTAGAAGG - Intronic
1136402425 16:30025820-30025842 ACCTGGGCACAGAGGCAGGAAGG + Exonic
1139377433 16:66508982-66509004 ACGTGGGGGCAGAGGGGAGAGGG + Exonic
1141469454 16:84228623-84228645 AAGTGGGGACAGCTGCTAGAAGG - Intronic
1143409970 17:6702914-6702936 AAGTGGGTACCGGGGCTGGAGGG - Intronic
1146548114 17:33756582-33756604 TCCTGGGTCCAGATGCTAGAAGG - Intronic
1148769318 17:50057687-50057709 AGGTGGGGGCAGAGGCTAGGTGG - Intronic
1152447464 17:80354183-80354205 ACGTGGGGGCAGGGGCAAGAGGG - Intronic
1152807603 17:82363879-82363901 TGGTGGGAACAGAGGATAGAAGG + Intergenic
1155129682 18:22920183-22920205 ACTTGGGCACAGTGGTTAGAAGG + Intronic
1156781373 18:40854475-40854497 AAGTAGGTACAGAGGCAAGGTGG - Intergenic
1158724404 18:59956365-59956387 ATGTGGGTATAGATGCTAGTGGG + Intergenic
1159573862 18:70152080-70152102 AAGTGGAGACAGAGGTTAGAAGG - Intronic
1160812338 19:1018214-1018236 AGGTGGATACTGAGGCTGGATGG + Intronic
1161081077 19:2310451-2310473 AGGTGGAGACCGAGGCTAGAGGG - Intronic
1163338081 19:16686660-16686682 TCTTGGGTACAGAGACCAGAGGG + Intronic
1163550663 19:17964868-17964890 AGGTGGGTACAGGGGCTTCAGGG + Intronic
1165462521 19:35952542-35952564 ATGTGAGTACAGAGGCAGGAAGG - Intergenic
1167634966 19:50649100-50649122 ACGTGGGGACAGAGGGGAGGAGG + Intronic
1168288462 19:55345908-55345930 ACGGGGCCACAGAGGCTGGAGGG + Intronic
925258817 2:2512090-2512112 TCGTGGGTACAGAGGCTGTCTGG + Intergenic
926575899 2:14580961-14580983 CGGTGGTTACAGAGGCTGGAGGG - Intergenic
926726725 2:16004439-16004461 AGGTGGGAACAAAGACTAGAGGG + Intergenic
936391559 2:112079279-112079301 TGGTGGGTACAGAGGCTGGGAGG - Intronic
937696704 2:124816398-124816420 AGGTGGGAACAGAGACTGGATGG - Intronic
948617854 2:239212972-239212994 ACGTGGGTACAGAGGCTAGAGGG - Intronic
1172117498 20:32581560-32581582 CCCTGGGGACAGAGGCTATATGG + Intronic
1175246178 20:57583517-57583539 ACATTGGGACAGAGGCTCGAGGG - Intergenic
1179295224 21:40055593-40055615 ACGTGAGTACCAAAGCTAGAAGG - Intronic
1181057634 22:20267672-20267694 ACGTGGGTACCGAGGGTGGGTGG - Intronic
1181319305 22:21992196-21992218 AGGTGGGTACAGAGCCCTGAAGG - Intergenic
1184872527 22:47249999-47250021 ACATGGGGACAGAGGCTTGGAGG - Intergenic
949676011 3:6454254-6454276 AGGTGGGTACAGTGGCTCAAAGG - Intergenic
953626941 3:44579422-44579444 ACGTGGGAGCGGAGGCGAGAGGG - Intronic
964893953 3:161571692-161571714 ACTTGGGAGCAGAGGCTAGGAGG - Intergenic
965553303 3:169992693-169992715 ATGTGTGTACAGAGGCCTGAAGG - Exonic
967222047 3:187255633-187255655 ACTTGTGTACAGAGGCTAAGAGG - Intronic
967613496 3:191536722-191536744 ATATAGGTAAAGAGGCTAGAAGG + Intergenic
970405451 4:15758706-15758728 TGGTGGTTACAGAGGCTAGAGGG - Intergenic
972004720 4:34086174-34086196 ACGAGGGTACAAAGGATAAAAGG + Intergenic
973031422 4:45346118-45346140 ACATGGGTACAGAGGTTAAGTGG - Intergenic
976261467 4:83148948-83148970 ATGTGGGTAGAGAGGGAAGAGGG + Intergenic
980790504 4:137613758-137613780 AGATGGGTAGAGAGGCAAGAAGG - Intergenic
981213483 4:142136146-142136168 ACGTGAGTACAGAGCCTCAAAGG + Intronic
982617834 4:157663818-157663840 ACTTGGGGCCAGTGGCTAGATGG - Intergenic
982864570 4:160493776-160493798 ACGTGGGTACACAGAGTAAAGGG - Intergenic
985933880 5:3080011-3080033 AGGTGGTTGCAGAGGTTAGAAGG + Intergenic
986645767 5:9914535-9914557 ATGTGTGTACAGAGGCTAAATGG + Intergenic
989478007 5:41896431-41896453 AAGAGGGAACAGAGGCCAGAAGG + Intergenic
994182519 5:96783090-96783112 CCGTGCGTACAGAGGGCAGAAGG - Exonic
994741862 5:103628927-103628949 AGGTGGATCCAGAGGCTTGATGG + Intergenic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
998231936 5:140366447-140366469 ACGTGAGTACAGAGAATACACGG + Intronic
998658532 5:144208709-144208731 ACCTTGGTAGAGAGGCTAGTGGG + Intronic
1001066497 5:168538915-168538937 AGGTGTTTTCAGAGGCTAGAAGG - Intergenic
1001155850 5:169271976-169271998 AAGTGGGTACAGAGGAGAGTAGG + Intronic
1008195202 6:48510305-48510327 ATGTGGGGACTGAGGCTGGAAGG - Intergenic
1014139966 6:117930226-117930248 ACGTGGATCCAGGGGCTAAAAGG + Intronic
1018689617 6:166334145-166334167 ATGAGTGTACAGAGGCTGGAAGG - Intronic
1022729187 7:33006728-33006750 ATTTGGGAACAGAGGATAGAAGG - Exonic
1023895549 7:44430218-44430240 ACCTGGGTACAGGGGCTGCAGGG - Intronic
1025044467 7:55681252-55681274 ATTTGGGAACAGAGGATAGAAGG + Intergenic
1030684961 7:112476544-112476566 ACTTGGGTGCTGAGGCAAGAGGG + Intronic
1031957348 7:127955899-127955921 ATGTGGGTAACGAAGCTAGAAGG - Intronic
1034062824 7:148108674-148108696 TGGTGGGTACAGAGGCTGGAAGG + Intronic
1037296125 8:17402439-17402461 ACATGGAGACAGAGGGTAGAAGG - Intronic
1042414353 8:68501874-68501896 ACATAGGTACAAAGGGTAGAAGG + Intronic
1043132029 8:76473406-76473428 ATATGGGAACAGAGGCAAGATGG - Intergenic
1046042725 8:108926349-108926371 ACATGGGTAAACAGACTAGAAGG - Intergenic
1046709416 8:117493039-117493061 ACTTGAGGACAGAGGGTAGAAGG - Intergenic
1047224139 8:122942578-122942600 TCGGGGGTTCAGAGGCCAGAGGG - Intronic
1049698804 8:143997264-143997286 AAGTGGGTCCAGAGGGTGGAGGG - Intronic
1049865713 8:144934189-144934211 ACGTGGGTGCAGTGGGTAGAGGG - Intronic
1051484164 9:17590181-17590203 ATGTGTGTACAGTGGCTTGATGG + Intronic
1052354045 9:27486190-27486212 ACTTGTGCACAGAGACTAGAAGG + Intronic
1053191802 9:36077569-36077591 AAATGGGTAAAGAGGCAAGATGG + Intronic
1062586069 9:137250679-137250701 CTGGGGGCACAGAGGCTAGAGGG - Intergenic
1185543863 X:926231-926253 AGGTGGGGACAGAGTCCAGAGGG - Intergenic
1187267228 X:17746752-17746774 AAGTGGGTGCAGAGGCGAGCTGG + Intronic
1187317233 X:18207120-18207142 AAGTGGGTGCAGAGGCGAGCTGG - Intronic
1189719991 X:43906007-43906029 ACATGGGTGAACAGGCTAGATGG + Intergenic
1190430907 X:50377015-50377037 ATGTGGGTACAGTGGGTAGAGGG + Intronic
1191942480 X:66496361-66496383 ACATGGGTATAGAGAGTAGAAGG - Intergenic
1201693900 Y:16802113-16802135 ACATAGATACATAGGCTAGATGG + Intergenic