ID: 948619299

View in Genome Browser
Species Human (GRCh38)
Location 2:239224090-239224112
Sequence GAATTCATGGGGAATGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 224}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948619299_948619306 19 Left 948619299 2:239224090-239224112 CCACCCACATTCCCCATGAATTC 0: 1
1: 0
2: 0
3: 24
4: 224
Right 948619306 2:239224132-239224154 GCTTAAAGCCAAAAATCCTGAGG 0: 1
1: 0
2: 1
3: 13
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948619299 Original CRISPR GAATTCATGGGGAATGTGGG TGG (reversed) Intronic
901400103 1:9010090-9010112 GGAGTCATGGGGAGGGTGGGAGG - Intronic
901536141 1:9883981-9884003 GAATCCATGGGGAAGGAGGAAGG + Intronic
902149055 1:14427702-14427724 GAATTTAAGGAGAATGTGGTTGG + Intergenic
904910747 1:33932376-33932398 GTATTTAAGGGGAATGAGGGTGG + Intronic
904935695 1:34128135-34128157 GAGTCCAGAGGGAATGTGGGAGG - Intronic
905255254 1:36677531-36677553 GAATTTATGGGCGAAGTGGGTGG + Intergenic
905894851 1:41538921-41538943 GGATTCATGGGGCATGGGGGTGG + Intronic
905970966 1:42142112-42142134 GAGCTCAGGGGGAAGGTGGGAGG + Intergenic
906006763 1:42479790-42479812 GAACTCATAGGGAGTATGGGAGG + Intronic
909487372 1:76188959-76188981 GAAGGCATGGGAGATGTGGGTGG + Intronic
909957868 1:81801501-81801523 GAATTCCTTGGGATTGTTGGGGG + Intronic
910532064 1:88248786-88248808 AAAATTATGGGGAAGGTGGGGGG - Intergenic
911432253 1:97805853-97805875 GAATTCAAGAGGTTTGTGGGAGG + Intronic
912733805 1:112132662-112132684 GAATTAAAAGGGAATGTGGAAGG - Intergenic
913171174 1:116233683-116233705 GAAGTCATGGGGCCTGTGGCCGG + Intergenic
913173053 1:116249602-116249624 GAATGCGTGGGGGCTGTGGGTGG + Intergenic
916491956 1:165309716-165309738 AAGTTCATGGGGAAGGTGGGTGG - Intronic
918003474 1:180520242-180520264 GAATTGATTGGGAAGCTGGGAGG + Intergenic
919254482 1:195103942-195103964 GAATTATTGGGTAATGTTGGTGG - Intergenic
919401966 1:197129752-197129774 GAATTAACGGGGAATGAGGGTGG + Intronic
919463305 1:197903237-197903259 GAATTGATGGAGAAGGTGGAGGG + Intronic
919790921 1:201290480-201290502 TAGTTCCTGGGGAATGGGGGAGG - Intronic
920348965 1:205325051-205325073 GAATTCCTGGGTCATGTGGTCGG + Intergenic
922883834 1:229003094-229003116 GAATTCAAGATGAATTTGGGGGG + Intergenic
923008648 1:230071375-230071397 GCAGCCATCGGGAATGTGGGTGG + Intronic
923153309 1:231254291-231254313 GAATTACTGGGGAATATGGAAGG - Intronic
1063928848 10:11008987-11009009 TAATTCCTGGGGAATTTGCGGGG + Intronic
1064389792 10:14932082-14932104 GAAGTCATGGTGCATGTCGGTGG + Intronic
1067052902 10:43034489-43034511 TAATTCTTGGAGAAGGTGGGGGG - Intergenic
1070484003 10:76912457-76912479 GTATTTGTGGGGGATGTGGGAGG + Intronic
1071238400 10:83676590-83676612 GAATACATAGGGAATTTGGTAGG - Intergenic
1073006655 10:100330096-100330118 GCATTCATGGGGAATGAGGTGGG + Exonic
1073201670 10:101740523-101740545 GAAATCGTTGGGAAAGTGGGAGG + Intergenic
1073470709 10:103720520-103720542 GAATTCATGGGGGCTGGGGTGGG - Intronic
1074204947 10:111275095-111275117 GAATTCATGGGGAATATTTGGGG + Intergenic
1077276059 11:1709142-1709164 CAATTCATGGAGCATGTGGGTGG + Intergenic
1077707785 11:4504532-4504554 GAGTTCATGGCAAATGTTGGAGG + Intergenic
1078237880 11:9502825-9502847 GAAATCATGCAGTATGTGGGGGG + Intronic
1078353104 11:10611541-10611563 GAATTCAGGAGGAAGGTGGTTGG - Intronic
1078594371 11:12674285-12674307 GACGTCATGGGGAATCGGGGCGG - Intergenic
1079320553 11:19448158-19448180 GAATTCAGGGGGAGTGTGATGGG - Intronic
1081875036 11:46402734-46402756 GAATTCAAGGGCACTGTGGAGGG - Intronic
1084499766 11:69528485-69528507 GAAGTCAGGGGGCATTTGGGAGG + Intergenic
1084819781 11:71678245-71678267 GGACTCAGGGGGAAGGTGGGAGG + Intergenic
1085742870 11:79091964-79091986 GAAGTCAGGGGGCATGTGGGAGG - Intronic
1085816055 11:79738749-79738771 GAAAGCATGGTGTATGTGGGTGG + Intergenic
1086815982 11:91371570-91371592 GATTTCTTGGGGCATGTGGGGGG - Intergenic
1087584042 11:100095519-100095541 AAATACATGGGTAATGTGCGTGG + Intronic
1090091269 11:123700603-123700625 GTTTTCAAGGGGAATGAGGGAGG + Intergenic
1090439800 11:126716046-126716068 GAGGTGAGGGGGAATGTGGGAGG + Intronic
1093180727 12:15964369-15964391 GTATTAATGGGGAACTTGGGGGG - Intronic
1093955128 12:25207945-25207967 CAAGTCATGGGGCATGTGGAAGG + Intronic
1094114141 12:26891890-26891912 GAACTCAAGGGGAAAATGGGAGG - Intergenic
1098883435 12:75940040-75940062 GAATGCATGGTGTACGTGGGAGG + Intergenic
1099344777 12:81484423-81484445 GGATTAATGGTGACTGTGGGAGG + Intronic
1099707522 12:86176135-86176157 GAAGTCATGGAGAATGTGTTAGG - Intronic
1103131132 12:118469587-118469609 AAGTCCATGGGGAAAGTGGGGGG - Intergenic
1103797786 12:123516705-123516727 GAAGTCATGGTGGATGAGGGGGG + Intronic
1104960663 12:132487262-132487284 GAAGTCAGTGGGAGTGTGGGGGG + Intergenic
1105479560 13:20761846-20761868 TAATTCAGGTGGAATGTGGGAGG + Intronic
1105481655 13:20783741-20783763 GAATTTATGGCAAATGTTGGTGG - Exonic
1106001106 13:25724212-25724234 GCATTCATGTGGCATCTGGGAGG + Intronic
1113513611 13:110874340-110874362 GAATGTAGGGGGAATGTGGAGGG - Intergenic
1113939772 13:114012544-114012566 GAATGCATGGGGAGTGTGCATGG - Intronic
1113939857 13:114013016-114013038 GAATGCGTGGGGAGTGTGTGAGG - Intronic
1114839973 14:26251974-26251996 GAATTCATGGGTATTATGAGGGG + Intergenic
1114871208 14:26660715-26660737 AAATTCGTGGGAACTGTGGGAGG - Intergenic
1118548209 14:66918589-66918611 GAATTAATGGGGAGAGAGGGAGG + Intronic
1120073896 14:80134265-80134287 GAATTCATGGAGATGCTGGGAGG + Intergenic
1120860571 14:89251548-89251570 TATTTAATGTGGAATGTGGGTGG + Intronic
1122220372 14:100235130-100235152 GAATGAATGGGAAATGAGGGAGG + Intergenic
1124410098 15:29429931-29429953 GTATAGATGGGGTATGTGGGTGG - Intronic
1125539272 15:40460353-40460375 GCATTCATGGGAAAGGTGGTAGG + Intronic
1126097933 15:45102333-45102355 GAATCCAGGGGTGATGTGGGAGG - Intronic
1126433748 15:48614421-48614443 GAGTTCAGAGGAAATGTGGGAGG - Intronic
1127562335 15:60151703-60151725 CCATTCCTGGGGATTGTGGGTGG - Intergenic
1127728103 15:61770963-61770985 GAATTCATGGGTAATGAGGCAGG + Intergenic
1128694837 15:69753722-69753744 GAATGCAAGGAAAATGTGGGGGG - Intergenic
1133041957 16:3065596-3065618 GGTTTTATGGGGAAAGTGGGGGG - Exonic
1135660131 16:24289183-24289205 GAATTCATCGGGAAGGAGAGGGG - Intronic
1138038338 16:53631727-53631749 TAATTAATGGCGAGTGTGGGGGG - Intronic
1138614984 16:58158105-58158127 GAAAGCATGGGGAATGTGAAGGG - Exonic
1140194211 16:72843647-72843669 GAAGCCATGGGCAGTGTGGGCGG + Intronic
1141154224 16:81585926-81585948 GAGCTCATGGAGAATGGGGGAGG - Intronic
1142109180 16:88322239-88322261 GATTTCCTGGGGACTGTGTGGGG - Intergenic
1143997768 17:11022831-11022853 GGACTCAGGGGGAATGTGGGAGG + Intergenic
1146519361 17:33514440-33514462 AAATTTGGGGGGAATGTGGGAGG + Intronic
1146643904 17:34563653-34563675 AATTACATGGGGAATGTGGGAGG - Intergenic
1147918297 17:43901309-43901331 GAACTCATGGGAGATGGGGGAGG - Intronic
1148765283 17:50035274-50035296 AAACTCATGGAGAATGTTGGAGG + Intergenic
1148853751 17:50567404-50567426 GGATTCATGGGCTATGGGGGAGG + Intronic
1149317135 17:55449130-55449152 GAATTCTTGTGGAATGTAAGTGG + Intergenic
1150862782 17:68818305-68818327 TAACTCATGGGGGATGAGGGGGG + Intergenic
1152607831 17:81301905-81301927 GAATGCCTGGGGGAGGTGGGCGG + Intergenic
1153295025 18:3536828-3536850 GAGAACATGGGGAAGGTGGGAGG + Intronic
1153619043 18:6959277-6959299 GAGCTCAGAGGGAATGTGGGAGG - Intronic
1153924949 18:9827479-9827501 GTATTCATGGGGAGGGTAGGAGG - Intronic
1155074665 18:22343873-22343895 GAATTCATGGGGTTGGTGGCGGG + Intergenic
1156840525 18:41605219-41605241 GCCTCCATGGGGAATGTGAGCGG - Intergenic
1156904108 18:42333948-42333970 AAATGCATAGGAAATGTGGGAGG + Intergenic
1156926225 18:42583368-42583390 AAATCCATGAGGATTGTGGGTGG - Intergenic
1158643624 18:59223434-59223456 GCATATATGGGGAATGTGTGGGG - Intronic
1158972205 18:62679189-62679211 TAACTAATGGGGAATCTGGGGGG - Intergenic
1160396806 18:78578221-78578243 ACATACATGGGGAATGTGGCCGG + Intergenic
1160435276 18:78847387-78847409 GAATAAATGGTTAATGTGGGAGG - Intergenic
1161863845 19:6819694-6819716 GACTTCATGGAGAGTGTTGGGGG + Intronic
1165952706 19:39483127-39483149 GAACTCATCAGGAATCTGGGAGG - Exonic
1166134235 19:40765876-40765898 GAAATCATGGGGCGTGTGGGTGG + Intergenic
926179621 2:10630120-10630142 GAATTCACGGGGTCCGTGGGTGG - Intronic
927150425 2:20192399-20192421 GAACTCATGGGGGAGGTGGGAGG - Intergenic
927705493 2:25294117-25294139 GAAGTCAAGGGGAAAGTGAGAGG - Intronic
928313632 2:30230642-30230664 CAATTCCTGGGCAGTGTGGGAGG + Intergenic
929612375 2:43280947-43280969 GAATTCATGACGAAAGTGAGAGG + Intronic
933805701 2:85996935-85996957 GATTTCATGGGGAATAAGGAAGG - Intergenic
933877235 2:86631566-86631588 GAATCCAGGGGGACTGTAGGTGG - Intronic
934921502 2:98347944-98347966 GAATTCATGGGGGACGCGGGTGG + Intronic
935660531 2:105462999-105463021 TAATTCCTGGGGTATGTAGGAGG - Intergenic
936818568 2:116490428-116490450 GAACTTTAGGGGAATGTGGGAGG + Intergenic
937084413 2:119161218-119161240 GCAGGCTTGGGGAATGTGGGAGG - Intergenic
937933770 2:127226246-127226268 GCATTGCTAGGGAATGTGGGAGG - Intergenic
938629141 2:133146597-133146619 GAATCCATGGTGAATGCGAGGGG + Intronic
939181280 2:138805046-138805068 GAAATCATGAGGAATTTGAGAGG - Intergenic
939405940 2:141756099-141756121 TAATTAATAGGGAATTTGGGAGG - Intronic
941642850 2:168007806-168007828 GAAGCCATGGTGATTGTGGGTGG + Intronic
944480538 2:200153075-200153097 GACTTCATGGGGAAGAAGGGAGG + Intergenic
945033248 2:205684234-205684256 GAATCCATGGGGAATGCAGTGGG + Intronic
945796009 2:214364751-214364773 GAATTCATGGCAAATAAGGGTGG + Intronic
946273433 2:218612835-218612857 GCCTTCAGGGAGAATGTGGGGGG - Intronic
946554104 2:220835824-220835846 GAAGTCATGGGTACAGTGGGAGG - Intergenic
947217632 2:227763699-227763721 GAGTTCTTTGGGAATTTGGGGGG + Intergenic
948444622 2:238022778-238022800 GCACTGAGGGGGAATGTGGGAGG + Intronic
948617779 2:239212599-239212621 GAATTCTGGGGGAATGGGGTTGG - Intronic
948619299 2:239224090-239224112 GAATTCATGGGGAATGTGGGTGG - Intronic
949025124 2:241764164-241764186 GCATCCGTGGGGACTGTGGGAGG + Intronic
1168793400 20:595483-595505 GAATTCCCGGGGATTCTGGGTGG - Intergenic
1169522786 20:6391096-6391118 GAATTGATGAGTAATGTGGAGGG - Intergenic
1170855005 20:20044214-20044236 TAATTCATGGAGAATGTATGAGG - Intronic
1172592840 20:36129429-36129451 GCCTTCCTGGGGAATGTGTGAGG + Intronic
1172883986 20:38219324-38219346 GAACTCATGGGGAAGGTGCTAGG - Intronic
1173500238 20:43548011-43548033 GTGTGCATGGGGAATGGGGGAGG - Intronic
1174317258 20:49713062-49713084 GGAGTCATGGGGAGTGGGGGAGG + Intronic
1176095991 20:63344884-63344906 GAATACACGGGGGATGTGGGAGG + Exonic
1179916996 21:44484154-44484176 GAATGAATTTGGAATGTGGGTGG - Intergenic
1181825197 22:25509371-25509393 GATTTCTTGGGTAGTGTGGGAGG - Intergenic
1184947535 22:47814120-47814142 GAATCCATGTGGGATGTGGCAGG - Intergenic
949400795 3:3663667-3663689 CAATTCAAGGGAAATTTGGGTGG - Intergenic
949799670 3:7889956-7889978 GGACTCAGGGGGAAGGTGGGAGG + Intergenic
949807639 3:7973458-7973480 GAAGACATGGAGAATGTGAGGGG - Intergenic
951031356 3:17885246-17885268 AATTTCATGGAGAATGGGGGTGG + Intronic
954431411 3:50472764-50472786 GGGTGCATGGGGAATGGGGGTGG - Intronic
955019117 3:55101415-55101437 GAAAACATGGGAAATTTGGGAGG - Intergenic
955410832 3:58654373-58654395 GAATTGATGGAAACTGTGGGGGG - Intronic
957211366 3:77262794-77262816 TAAATGCTGGGGAATGTGGGAGG - Intronic
957303308 3:78421473-78421495 GCACTCATGAGGAATGTGAGAGG + Intergenic
958557479 3:95699013-95699035 AAATTTATGGAGATTGTGGGAGG - Intergenic
959178286 3:102945835-102945857 AAATTTATGGGAAATGTAGGGGG + Intergenic
959748735 3:109808328-109808350 GACTTCAGGAGGAATGTTGGTGG + Intergenic
962339382 3:134569137-134569159 GAATTCAGGTGAAATTTGGGTGG + Intronic
963838327 3:150079513-150079535 TATTTAATGTGGAATGTGGGTGG + Intergenic
964912497 3:161800084-161800106 GAATTCAAGATGAATTTGGGTGG + Intergenic
966631574 3:182081707-182081729 GTATGCATGGGGATAGTGGGGGG + Intergenic
966853849 3:184180752-184180774 GAAGGGATGGGGAATGAGGGTGG + Intronic
968077620 3:195825127-195825149 GAGTTCATGGGGAATGAGAGAGG + Intergenic
968675781 4:1878482-1878504 GAATTCACATGGAATGTTGGAGG - Intronic
969453650 4:7288777-7288799 GAATTCATGTGGGGTGGGGGGGG + Intronic
970828087 4:20302574-20302596 GCGTTCATGAGGACTGTGGGAGG + Intronic
970951441 4:21760821-21760843 GAATGCATTGGGAGTGTGGATGG - Intronic
972715691 4:41644083-41644105 GAATTTGTGGGGAAAGAGGGCGG - Intronic
973036829 4:45417279-45417301 GGACTCATGGGGAAGGTGAGCGG - Intergenic
973803949 4:54506718-54506740 CAATTCATAGGTTATGTGGGGGG + Intergenic
974416648 4:61616617-61616639 GAAATCTTGGTCAATGTGGGAGG - Intronic
974896321 4:67943933-67943955 GAATTCATGGGCATTCTGAGTGG + Intronic
976133461 4:81909421-81909443 AGGTTCATGGGGAATGGGGGTGG + Intronic
979025990 4:115576272-115576294 GAATGCATAGGGAATGTGACAGG - Intergenic
979924021 4:126537090-126537112 GAAGCCATGGGCAATGTGGAAGG + Intergenic
986076678 5:4345012-4345034 GATTTCTTGGGCAATGGGGGTGG + Intergenic
986525839 5:8674057-8674079 CAATTCAAGGGGAATTTGGGTGG - Intergenic
987583424 5:19824472-19824494 GAAGGCATGGGGAACTTGGGAGG - Intronic
989975371 5:50579714-50579736 GGACTCAGGGGAAATGTGGGAGG - Intergenic
992253008 5:74894448-74894470 GAATTCTTGGGGAGTGGGGAGGG - Intergenic
992675975 5:79106812-79106834 GAAGTCATGGGGTATTTGGTGGG + Intronic
993071452 5:83169031-83169053 GAATTCAAGGGAGCTGTGGGTGG + Intronic
993685413 5:90931238-90931260 GAAGTCATGGGGGATGAGGCTGG + Intronic
994085214 5:95750750-95750772 GTCTTTATGGGGAATGGGGGAGG + Intronic
994128345 5:96195241-96195263 CAATTCATTAGGAATGTGGATGG + Intergenic
994188191 5:96838592-96838614 GAATTCAAGTGGACTTTGGGAGG - Intronic
994282797 5:97926158-97926180 GGACTCAGGGGGAATGTTGGGGG - Intergenic
996950454 5:129119653-129119675 GAATTCAACAGGAATTTGGGTGG + Intergenic
998533572 5:142908281-142908303 GAATTCAGGGGGCATTTGGATGG + Intronic
1000768966 5:165327089-165327111 AAATTCCTTAGGAATGTGGGAGG - Intergenic
1001903068 5:175446681-175446703 CAGTTCTTGGGGAATGTGTGTGG - Intergenic
1002289331 5:178188881-178188903 GACTTGATGAGGAAGGTGGGAGG + Intergenic
1002300947 5:178257051-178257073 GAGTCCATGGGGGGTGTGGGCGG + Intronic
1004671184 6:17798722-17798744 GAATTTGTGGTGAATGTGGTTGG - Intronic
1006356194 6:33559632-33559654 GAATTCAGAGGAAATGTGGAGGG + Intergenic
1007921330 6:45612193-45612215 GTATTTATGGAGATTGTGGGAGG - Intronic
1008021624 6:46584795-46584817 GATTTCCTGGGGAAAGTGGCGGG - Intronic
1008754074 6:54772956-54772978 CAAATCATGGGGCATGTGGAAGG - Intergenic
1010157362 6:72810406-72810428 GAATTCATGTGGTATGTTGCTGG + Intronic
1010259477 6:73798725-73798747 ATATTAATGGGGAATGTTGGAGG + Intronic
1011091097 6:83600871-83600893 GAATATTTGGGGAATGTAGGAGG - Intronic
1013138476 6:107306204-107306226 GAATTCAAGATGAATTTGGGTGG - Intronic
1013756205 6:113464641-113464663 GAATTGATGGGGAAGGAGAGGGG + Intergenic
1014989283 6:128053672-128053694 GTCTTCATGGGGACGGTGGGTGG - Intronic
1015971936 6:138751228-138751250 AAATTCATGGGGAATGAGTGTGG + Intronic
1016336290 6:143008500-143008522 GATTGAATGGGAAATGTGGGGGG - Intergenic
1021435419 7:20607902-20607924 GAATTCAGAGGAAATGTGGTAGG + Intergenic
1021893054 7:25206084-25206106 GATTTCATGGAGATTGTGGAGGG + Intergenic
1022537715 7:31108131-31108153 GAATGCTTGGGGACTTTGGGTGG + Exonic
1022818771 7:33938376-33938398 GAAGTCATGCTGAATTTGGGTGG + Intronic
1023392871 7:39727410-39727432 GGAGTAGTGGGGAATGTGGGTGG - Intergenic
1024782764 7:52870920-52870942 GACTTCAGGGGGATTTTGGGAGG + Intergenic
1025035884 7:55592264-55592286 GTACACATGGGGAGTGTGGGGGG + Intergenic
1029008713 7:97236160-97236182 GAATTTATGGGGGAGGTGGGTGG + Intergenic
1030613398 7:111713104-111713126 GAATTCCTGGGCCATGTGGAAGG - Intergenic
1032401830 7:131629330-131629352 GCATCCATGGGGAGTGTGGGGGG + Intergenic
1032445140 7:131975905-131975927 GAATTCATGGCCAAAGTGGATGG - Intergenic
1033505613 7:141996834-141996856 GGTTTCCTGTGGAATGTGGGAGG + Intronic
1033565041 7:142570050-142570072 GAATTCCTGGGGAAAGGGGGTGG + Intergenic
1036443602 8:8802871-8802893 GAATTCATGGGGAAGGCAGGTGG + Intronic
1036589588 8:10156479-10156501 TAATTCTTGGTGAATGTAGGTGG + Intronic
1037770560 8:21796701-21796723 GAGTGCATGGGGACAGTGGGGGG - Intronic
1038147570 8:24913139-24913161 GAATGCAAGGGGAAGGAGGGAGG + Exonic
1039610089 8:38912850-38912872 GAGCTCATCAGGAATGTGGGAGG - Intronic
1040346412 8:46503131-46503153 GAAGCCATGGGGAATTTTGGAGG - Intergenic
1041111594 8:54488006-54488028 GAAGTCATGGTGCATGGGGGCGG + Intergenic
1041544668 8:59029225-59029247 GAAGTCATGGGGATGGGGGGTGG - Intronic
1043248567 8:78037932-78037954 TACTTCATGGGGGAGGTGGGAGG - Intergenic
1046759310 8:118004759-118004781 TATTACATGGAGAATGTGGGTGG - Intronic
1046802332 8:118442177-118442199 GAATACATGGTGAAGATGGGAGG + Intronic
1047364959 8:124203222-124203244 CATTTCATGGGGAGGGTGGGTGG + Intergenic
1047540478 8:125760428-125760450 GGAATCATGGAGGATGTGGGAGG + Intergenic
1051695123 9:19760246-19760268 GAATGGATGGGGAATGGGCGGGG - Intronic
1051916538 9:22215550-22215572 GAATTATGGGGGAATGGGGGAGG + Intergenic
1052553534 9:29984377-29984399 GACTTGATTAGGAATGTGGGTGG - Intergenic
1056791814 9:89630713-89630735 GAATTCAACGTGAATGTGGGAGG - Intergenic
1058235073 9:102479709-102479731 GTCTTCCTGAGGAATGTGGGTGG + Intergenic
1060861479 9:126958195-126958217 AATTTCAAGGGGAATGGGGGAGG + Intronic
1203779310 EBV:92045-92067 GAGCTCATGGGGAATGATGGGGG - Intergenic
1186392299 X:9173198-9173220 GAATTCAAGGAGAAAGTGGATGG - Intergenic
1187520643 X:20010897-20010919 GATCTCTTGGGGAATGTCGGGGG + Exonic
1188122414 X:26324911-26324933 GAATTCAATGAGAATGTGTGTGG + Intergenic
1188650571 X:32627018-32627040 GAATTGTTGGGGAATGGGGCTGG - Intronic
1192868977 X:75167930-75167952 GAATTGAGGGGGACAGTGGGAGG - Intergenic
1194263110 X:91722072-91722094 AAACTCAGGGGGAATGGGGGTGG + Intergenic
1194847634 X:98830788-98830810 GAGGTCATGGGGAATGTTAGAGG - Intergenic
1197702720 X:129611446-129611468 GAATTCTTGGGGGAAGAGGGGGG + Intergenic
1198392810 X:136193579-136193601 AAAATAATGGGGAATATGGGAGG - Intronic
1199214420 X:145249245-145249267 GATTTAATGGGCAATGTGTGAGG + Intronic