ID: 948619736

View in Genome Browser
Species Human (GRCh38)
Location 2:239226937-239226959
Sequence CTGTTTCAGCAGAATCTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 243}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948619736_948619739 23 Left 948619736 2:239226937-239226959 CCTCCAAGATTCTGCTGAAACAG 0: 1
1: 0
2: 1
3: 13
4: 243
Right 948619739 2:239226983-239227005 CACCAACACAACACACACACAGG 0: 1
1: 0
2: 9
3: 70
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948619736 Original CRISPR CTGTTTCAGCAGAATCTTGG AGG (reversed) Intronic
900376971 1:2359305-2359327 CTGACTCAGCAGACACTTGGTGG - Intronic
901304074 1:8219729-8219751 GTGTTTAAGGAGAATCTTTGGGG + Intergenic
902362469 1:15949678-15949700 CTGTGACATCAGCATCTTGGGGG + Intronic
902584361 1:17429189-17429211 CTGTCTCTGCAGAAACTTGAAGG - Exonic
902626031 1:17676858-17676880 CTGATTGGGCAGAATCTTCGTGG + Intronic
903078330 1:20788807-20788829 CTGTCTCAAAACAATCTTGGTGG + Intergenic
905621081 1:39448594-39448616 GAGTTTCAGAAGACTCTTGGTGG + Exonic
906702596 1:47870832-47870854 CAGTTTGAGCTGAATCTTGAAGG + Intronic
909152727 1:72028692-72028714 ATATTTCAGCAGAATCTTGAAGG - Intronic
909186263 1:72490323-72490345 ATGTTTTAGCTGAATTTTGGTGG + Intergenic
911121121 1:94297714-94297736 GTGTTTCATCAGGAACTTGGGGG + Intergenic
916812119 1:168314728-168314750 CTGTTGGATCAGAATCTTTGGGG + Intergenic
919102729 1:193113608-193113630 AGGTCTCAGCTGAATCTTGGTGG - Intergenic
919184330 1:194125504-194125526 TTGTTTCCACAGTATCTTGGAGG - Intergenic
920258176 1:204670799-204670821 CTGCTTCAGCAGAGTGATGGGGG + Intronic
923519744 1:234726292-234726314 CTGCTCCAGCAGACTCTAGGAGG - Intergenic
924606564 1:245540479-245540501 CTGCTTAAGCTGAATGTTGGTGG + Intronic
1064207891 10:13339915-13339937 CTGTATCTGCAGAATCCTCGTGG - Intronic
1066204270 10:33172220-33172242 CTTTTTCAGCAAGATCTTGGAGG - Intergenic
1066791512 10:39069680-39069702 CTCTTTCTGCAGAATCTGTGGGG + Intergenic
1066809898 10:39315969-39315991 CTGTTTTAGTAGAATCTGCGAGG - Intergenic
1070510118 10:77153300-77153322 ATTTGTCAGCAGAATTTTGGGGG - Intronic
1071306869 10:84307215-84307237 CTGACTCAGCAGGATCTTGCTGG + Intergenic
1073069411 10:100783820-100783842 ATGTTTCAGAGGAAACTTGGGGG - Intronic
1074409005 10:113208070-113208092 TTTTTTCAGCAGAAACTTTGCGG + Intergenic
1075103306 10:119520644-119520666 CTGTGTCAGGAGAATTTTGCTGG - Intronic
1076080791 10:127578786-127578808 CTCATTCAGCAGGATGTTGGTGG + Intergenic
1076777795 10:132707695-132707717 CTGTTTCACTTGAATTTTGGGGG + Intronic
1077299353 11:1839996-1840018 CTCTTTCAGCAGCGTCTTGGTGG - Intronic
1080482667 11:32667631-32667653 CTGCTTCAGCTCACTCTTGGTGG + Intronic
1082146117 11:48671614-48671636 CTGTTTTGGCAGAATCTGTGAGG + Intergenic
1082588961 11:54981261-54981283 CTGTTTTGGCAGAATCTGTGAGG + Intergenic
1083164522 11:60875295-60875317 TTTTGTCAGCACAATCTTGGGGG - Intronic
1084545782 11:69814438-69814460 CTGAGTCAGCAGGATGTTGGGGG + Intronic
1085069081 11:73525530-73525552 CTTTCTCAGCAGAACTTTGGAGG - Intronic
1087937591 11:104052972-104052994 TTTTTTCAGTAGAATATTGGTGG + Intronic
1088916964 11:114234862-114234884 CTTTTTCAGCAGCAACCTGGGGG + Intronic
1089382697 11:118047483-118047505 CTTCCTCAACAGAATCTTGGTGG + Intergenic
1089410163 11:118234383-118234405 CTATTTCAGCTGGGTCTTGGAGG + Intronic
1091098177 11:132843437-132843459 CCGTTGCATCAGAATCTTGCTGG - Intronic
1092637100 12:10463641-10463663 CTTTTTGTGCAGAATCTTGCAGG + Intergenic
1093636959 12:21481966-21481988 CTGTTTCAGTAGTATGGTGGTGG + Intronic
1094681384 12:32670384-32670406 CTCTTTCTGCATAAACTTGGTGG - Intergenic
1095141348 12:38667062-38667084 GAGGTTCAGCAGAATATTGGGGG - Intronic
1097983024 12:65753633-65753655 GTGTTTCACCAGAACCTTGTTGG - Intergenic
1098185971 12:67896694-67896716 CTGTTTGAGGAAAATCTGGGAGG + Intergenic
1100386141 12:94105889-94105911 CAGTTTCAACATAAGCTTGGAGG + Intergenic
1101505592 12:105343306-105343328 CTGTTTAAACATAACCTTGGTGG - Intronic
1102466704 12:113134660-113134682 CTGAATCAGCAGAATATGGGGGG - Intronic
1102999911 12:117377446-117377468 ATGTTTGAGCTGAGTCTTGGAGG + Intronic
1103042123 12:117704454-117704476 CTGTTTCACCAGGGTTTTGGGGG - Intronic
1106169037 13:27272879-27272901 CTGCTTCTGCAGAAGCTGGGTGG + Intronic
1107248993 13:38334830-38334852 CTGTTTCAGCACTGACTTGGTGG + Intergenic
1108154877 13:47575074-47575096 CTGTTTCACCATGATCTCGGGGG - Intergenic
1110394242 13:75011506-75011528 CTGTTTCACCAGAGGCATGGGGG + Intergenic
1111023739 13:82490641-82490663 CTGTTTTTGCAGAATGTTGCGGG + Intergenic
1115042390 14:28947579-28947601 CTGTTTCAACGGAATTTTAGGGG - Intergenic
1115382312 14:32754839-32754861 ATTTTTCAGCAGAAACTTTGCGG - Intronic
1115786885 14:36836641-36836663 CAGTTTCAGTAGAATGGTGGAGG + Intronic
1117108004 14:52418525-52418547 CTGTTAAAGCAGAATCTTGGAGG + Intergenic
1119256880 14:73206077-73206099 TTGTTTCAGTGGAATCTTGCTGG + Intronic
1121970644 14:98352904-98352926 CTGTGTCAGAGGAATCTTGGGGG - Intergenic
1123127843 14:105962088-105962110 CTGCTTCAGCTCACTCTTGGTGG + Intergenic
1123408307 15:20037901-20037923 CTGCTTCAGCTCACTCTTGGTGG + Intergenic
1123517631 15:21044552-21044574 CTGCTTCAGCTCACTCTTGGTGG + Intergenic
1124460323 15:29884296-29884318 CTGTATCAGGACCATCTTGGGGG + Intronic
1126684166 15:51232832-51232854 ATGTTTCAGCAGAATCATTCTGG - Intronic
1127848194 15:62889977-62889999 CTGTGTGAGCAGAGGCTTGGAGG + Intergenic
1128452423 15:67813445-67813467 GCATTTCAGCTGAATCTTGGAGG - Intergenic
1129255683 15:74332814-74332836 CTGTTGCTGCAGAATGATGGGGG - Exonic
1130516092 15:84626769-84626791 TTGTTTCATTAGAATATTGGTGG - Intronic
1132154416 15:99485650-99485672 CTCATTCAGCTGAATCTTGACGG - Intergenic
1134406920 16:13969219-13969241 CTGATTCAGCACAATCTCAGTGG - Intergenic
1137045706 16:35657794-35657816 CTGTTTCTGTAGAATCTACGAGG + Intergenic
1137059310 16:35772991-35773013 CTCTTTCTGGAGAATCTAGGAGG - Intergenic
1137807308 16:51319540-51319562 CTTTTAAAACAGAATCTTGGGGG + Intergenic
1137952345 16:52795723-52795745 TTTTTTCAGGAGTATCTTGGAGG + Intergenic
1138911409 16:61403912-61403934 GTGCTTCTTCAGAATCTTGGGGG - Intergenic
1141752505 16:85968270-85968292 CTGTTTCAGCAGAACTAGGGTGG + Intergenic
1142102989 16:88285452-88285474 CTGTCACAGCAGAATCTTCCAGG + Intergenic
1143124973 17:4636172-4636194 CAGTTTCTGCAGAATGCTGGAGG - Intronic
1143334487 17:6162124-6162146 CTAATTCAGCAGAATCGGGGAGG - Intergenic
1143403541 17:6660985-6661007 CAGTTTCTGCAGAATGCTGGAGG + Intergenic
1144823168 17:18089608-18089630 GTGATACAGCAGAATATTGGGGG + Intronic
1145121018 17:20260063-20260085 CTGTTTCTTTAGAATCTTGCTGG + Intronic
1145365090 17:22255637-22255659 CTGTTTTAGTAGAATCTAAGAGG - Intergenic
1146022258 17:29290011-29290033 CTGAGTCAGGAGAATCTGGGAGG - Intronic
1149145964 17:53492719-53492741 GTGACTCAGCAGGATCTTGGAGG - Intergenic
1149355688 17:55836978-55837000 GTGTTTAAATAGAATCTTGGAGG + Intronic
1150457347 17:65317442-65317464 CTGGATCAGAAGAACCTTGGGGG + Intergenic
1152257105 17:79246516-79246538 CTGTCTCAGCTGAGTGTTGGAGG - Intronic
1152788081 17:82262265-82262287 CTGCTTCAGCAGTAGCCTGGGGG + Intronic
1155602076 18:27561216-27561238 CTCTTTCTCCAGAATATTGGTGG - Intergenic
1155676581 18:28436714-28436736 CAGTTTCAGGAGCATTTTGGTGG + Intergenic
1156217742 18:35017706-35017728 CTGTTCCAGCAGTATTTTGGTGG + Intronic
1158592706 18:58791039-58791061 CTGTTAAATGAGAATCTTGGAGG + Intergenic
1159669001 18:71200021-71200043 CAGTTTTAGCAGAATCATAGTGG + Intergenic
1159719190 18:71865031-71865053 CTGTTTCAACATAATACTGGAGG - Intergenic
1160905443 19:1449794-1449816 ATGTTACATCAGCATCTTGGCGG - Intronic
1162281356 19:9700405-9700427 CTGTTTCACCTTTATCTTGGTGG - Exonic
1164339667 19:24377616-24377638 CTGTTTTTGTAGAATCTGGGAGG + Intergenic
1164431929 19:28196488-28196510 CTGTTGCAGCACACGCTTGGAGG - Intergenic
1164435229 19:28222984-28223006 CTGTTTGAGCTGAGTCTTGAGGG - Intergenic
925822288 2:7811534-7811556 GTGTTTCTGCATGATCTTGGAGG + Intergenic
925920129 2:8632583-8632605 CTGTTTGAGCAGAAGGATGGAGG + Intergenic
927998789 2:27505761-27505783 GGTTTCCAGCAGAATCTTGGTGG - Exonic
928143284 2:28749585-28749607 CGGTCTCAGCAGAGTTTTGGAGG - Intergenic
930534397 2:52629190-52629212 CTTTTTTAGCAAAATCTTGGTGG + Intergenic
931716068 2:65029676-65029698 CAGTTTAATCAGAATCTTTGTGG - Intergenic
933402849 2:81820694-81820716 AAGTTTCACCAGTATCTTGGTGG - Intergenic
936856249 2:116961057-116961079 CTTTTTTAGCAGAATATTGAAGG + Intergenic
939087164 2:137735257-137735279 ATTTTTCAGCAGAAACTTGCAGG - Intergenic
939877949 2:147599043-147599065 CTTTTTCTGCAGAAGCCTGGAGG + Intergenic
940970550 2:159892111-159892133 CTGATTCAGTAGATTTTTGGTGG - Intronic
941594908 2:167464248-167464270 CTGCTTCAGTAGTATCTTGAAGG + Intergenic
942369518 2:175267525-175267547 CTGTTTCACCAAGAGCTTGGTGG - Intergenic
943846390 2:192654823-192654845 ATGTTACAGCACAATGTTGGTGG + Intergenic
944554790 2:200877024-200877046 CTTTTTCAGCACAATGTTAGAGG - Exonic
947465078 2:230336471-230336493 CTGTTTCATGAGAATCTATGAGG + Intronic
947612260 2:231531397-231531419 CTGTTTCATCAGAAACTTCTAGG + Intergenic
948518039 2:238518435-238518457 CTGTTTCCTCAGAATCCTGCAGG + Intergenic
948619736 2:239226937-239226959 CTGTTTCAGCAGAATCTTGGAGG - Intronic
1170130268 20:13011498-13011520 CTTTGTCAACAGAATCTTGTAGG - Intronic
1170567530 20:17615451-17615473 CTGTTTCTGAAGACTCTAGGGGG + Exonic
1171774806 20:29355259-29355281 CTGTCTCTGGAGAATCCTGGGGG + Intergenic
1172364159 20:34336040-34336062 CTGTTTCTGCAGTAGCCTGGTGG - Intergenic
1172418596 20:34794038-34794060 CTGTTTCACCATAACCTTGCTGG - Intronic
1172567648 20:35943247-35943269 CTGAAGCAGCAGAATCTAGGAGG + Intronic
1174534989 20:51244518-51244540 CTCGATCAGCAGAATGTTGGAGG - Intergenic
1175579968 20:60090784-60090806 CTGCTTCAGCAGAATCTGAGCGG + Intergenic
1175770017 20:61617682-61617704 CGGTTCCAGCTGATTCTTGGAGG - Intronic
1176667528 21:9701258-9701280 CTGTATGAGCAGAAATTTGGAGG - Intergenic
1177099731 21:16885430-16885452 CTGTTTCAGCTGAAGCTGGATGG + Intergenic
1178696392 21:34796473-34796495 CTGATTCAGCAGAAGTGTGGGGG + Intronic
1179785889 21:43729345-43729367 CGGTTGCAGCAGGGTCTTGGAGG + Intronic
1180958414 22:19751373-19751395 CTGGTTCAGCAGAGCCTTGGAGG + Intergenic
1181668199 22:24412770-24412792 CTGTTTAAGCTGAATCCTCGTGG + Intronic
1181845044 22:25700040-25700062 GTGTTTCAGCAGAAGCAAGGGGG - Intronic
1184090913 22:42292636-42292658 GTGTTTAAGCAGGAACTTGGAGG + Intronic
1184576353 22:45370133-45370155 CTAATTCAGGAAAATCTTGGAGG - Intronic
949249960 3:1972143-1972165 CTGTTTCTGCTGATTCTTGCTGG - Intergenic
951999403 3:28768473-28768495 AAGTTTCAGCATAATTTTGGAGG + Intergenic
953439057 3:42902538-42902560 ATGCTTCATCAGAACCTTGGAGG - Intronic
955129045 3:56145496-56145518 CTGTGAGAGCTGAATCTTGGAGG - Intronic
956983050 3:74662637-74662659 CTGTAAAAGCAGAATCTAGGTGG - Intergenic
957151692 3:76494506-76494528 CTGTTTGTACAGAATTTTGGGGG + Intronic
957168412 3:76705574-76705596 CAGTTTCAGTAGAATCATTGGGG + Intronic
957431139 3:80108823-80108845 TTTTTTCAGCATTATCTTGGAGG + Intergenic
958073698 3:88648827-88648849 CTCTTTCAGCAGAGTCTTTGGGG - Intergenic
959770493 3:110089763-110089785 ATGTTTCAGGAGAATATAGGTGG - Intergenic
960790324 3:121423178-121423200 CTGTGTCAGGAGAAACGTGGTGG + Exonic
962686662 3:137854587-137854609 TGGTTTCATGAGAATCTTGGAGG + Intergenic
963622920 3:147634895-147634917 TTTTCTGAGCAGAATCTTGGAGG + Intergenic
965183484 3:165434368-165434390 GATCTTCAGCAGAATCTTGGGGG - Intergenic
966266790 3:178055716-178055738 CAGTTTCAGGAGTATCCTGGGGG - Intergenic
966715171 3:183007230-183007252 CTCCTGCATCAGAATCTTGGGGG - Intergenic
967246336 3:187490959-187490981 TTCCTTGAGCAGAATCTTGGGGG + Intergenic
969399257 4:6943080-6943102 CGTTTTCAGCAGAAGCTTGCTGG + Intronic
970530140 4:16973420-16973442 GTGTTGTAGAAGAATCTTGGTGG - Intergenic
970551327 4:17184739-17184761 CAGTATCACCAGAAACTTGGTGG - Intergenic
970703195 4:18767743-18767765 ATCTTTCAGCAGAATCTTTAGGG + Intergenic
973709498 4:53614375-53614397 CATTTCCAGAAGAATCTTGGAGG - Intronic
974159618 4:58121026-58121048 TTTATTCAGCAGAATATTGGGGG - Intergenic
974578689 4:63765492-63765514 GTGTTTCAGAAGAATGTAGGTGG + Intergenic
975171318 4:71234754-71234776 CTTTTCCACCAGAATCTTGATGG + Intronic
977407651 4:96620526-96620548 CTGTTTCAGTAGAGTCTTATGGG + Intergenic
978489919 4:109302005-109302027 CTTCTTCAGCAGCATCGTGGCGG + Exonic
979277122 4:118827025-118827047 CTGCTTGAGCTGAATCTTGAAGG + Intronic
980461842 4:133125345-133125367 CTGCTTCTGTAGAATCTTAGTGG - Intergenic
983757740 4:171362166-171362188 CTGTTTCAGCAGTAACTGAGTGG - Intergenic
984642324 4:182181346-182181368 CTCTTTCAGCAGAAGATTTGGGG - Intronic
985115673 4:186588170-186588192 TTGTTTCAACTGAATTTTGGTGG - Exonic
985245287 4:187974433-187974455 CTGTGTCAGCATCATCTTGTTGG - Intergenic
985407280 4:189650347-189650369 CTGTATGAGCAGAAATTTGGAGG + Intergenic
988269057 5:28991229-28991251 CTGCTTCAGCACATGCTTGGTGG - Intergenic
988577538 5:32442531-32442553 TTATTACAGCAAAATCTTGGGGG - Intronic
988629714 5:32915817-32915839 AAGTTTCAGCAGAATCATGCTGG + Intergenic
992852645 5:80826102-80826124 CAGCTGCATCAGAATCTTGGCGG + Intronic
994680125 5:102876363-102876385 CTGTTTTAATAGAATCTTTGTGG - Intronic
996416680 5:123218021-123218043 CTGTTTCAGAGGAAACTTCGGGG + Intergenic
998608279 5:143659670-143659692 CTGTATCAGCAGTGTCTGGGAGG - Intergenic
1000201060 5:159011544-159011566 CTGTTTCAGCAGAATGGAAGCGG + Intronic
1001901440 5:175433818-175433840 CTGTTTCAGCAGAATTAGTGTGG + Intergenic
1004333129 6:14739827-14739849 ATCTTCCAGCAGAATCTTGAAGG + Intergenic
1004425473 6:15504178-15504200 CTTTTTCAGCAGAGCCTTGGAGG + Intronic
1004442456 6:15666759-15666781 CTGTCTCAGCAGATTCTTATTGG + Intergenic
1005052391 6:21696706-21696728 CTGTTTCAGCAAGATGATGGAGG - Intergenic
1005894825 6:30169007-30169029 CTGTTTCAGCCTTATCGTGGGGG - Intronic
1013043310 6:106458365-106458387 CTGTTTGAGCAGGATCTTAAAGG - Intergenic
1014416143 6:121187238-121187260 CTGCTTAAGCAGAACATTGGAGG - Intronic
1014988837 6:128048478-128048500 ATGTTTCAGCAGAAACCTGAAGG - Intronic
1015129783 6:129796213-129796235 CTCTTTCAGCAGAAGAGTGGGGG - Intergenic
1017466520 6:154699002-154699024 CTCTTTCAACACACTCTTGGAGG + Intergenic
1017467453 6:154707640-154707662 CACCTTCAGCAGAATCGTGGAGG + Intergenic
1017647622 6:156553597-156553619 CTTTTTCAGCATAATCCGGGTGG + Intergenic
1018111876 6:160544323-160544345 CTATTGCAGAAGCATCTTGGTGG - Intronic
1020901787 7:14012614-14012636 GTATTTGAGCTGAATCTTGGTGG + Intergenic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1024597114 7:50947468-50947490 CTGTTTCAGCTGAAGCCTGTGGG - Intergenic
1024837334 7:53537488-53537510 CTGTTTCACCAGTACCTTGAAGG + Intergenic
1025575602 7:62636865-62636887 CTGTTTCTGGAGAATCTGTGAGG - Intergenic
1025593591 7:62895981-62896003 CTGTTTTGGTACAATCTTGGAGG - Intergenic
1027206026 7:76100206-76100228 GCGTTTCTGCAGAATTTTGGTGG - Intergenic
1027505594 7:79014003-79014025 CTGTTTCTTCAAAATCTTTGTGG + Intronic
1027647772 7:80825955-80825977 CTGTTAGACCACAATCTTGGGGG - Intronic
1028821183 7:95213737-95213759 CTGTTTAAACAGAAACTTGATGG - Intronic
1030885798 7:114935569-114935591 CTGGTTCAGTAGAATATTTGAGG + Intronic
1031160890 7:118166735-118166757 CAGTTTCAGCAGAATAATGGGGG + Intergenic
1032727772 7:134606923-134606945 CAGTGTCAGCAAAATGTTGGTGG + Intergenic
1033246494 7:139720864-139720886 CTGTTTCAAAAAGATCTTGGTGG + Intronic
1033321670 7:140345489-140345511 CTGTCTCAGCAGCATCTTAAGGG + Intronic
1034259957 7:149748922-149748944 CTGCTTCAGTAGAATGATGGTGG - Intergenic
1038414793 8:27387026-27387048 GTGTTTGAGCAGAATTCTGGGGG + Intronic
1038541201 8:28391548-28391570 ATGTTTCAAAAGAATCTTTGTGG - Intronic
1039078731 8:33715441-33715463 CTGATTCAGTAGAATCAGGGTGG + Intergenic
1039330091 8:36528050-36528072 CTGGTACAGCAAAATCTGGGAGG + Intergenic
1043276306 8:78399410-78399432 CTGTTTCTGAAGAATCTTTGTGG + Intergenic
1044704847 8:94998760-94998782 CTGCTTGAGCAGCATCTTGAAGG + Intronic
1046315984 8:112502239-112502261 CTGTATCAGAAGATGCTTGGGGG - Intronic
1048298574 8:133234752-133234774 GGGTTTCAGCAGCATCTGGGAGG - Intergenic
1049177667 8:141203605-141203627 CTGGTTCAGCAGAACATTGAGGG + Intergenic
1049215211 8:141404661-141404683 CTGAGTCAGCAGAGGCTTGGGGG + Intronic
1049648694 8:143752308-143752330 ATTTTTCATCAGAAACTTGGAGG - Intergenic
1050321810 9:4459972-4459994 CTGTTTCAGTAGAATAATAGAGG + Intergenic
1051407875 9:16758427-16758449 CTGAGGCAGGAGAATCTTGGAGG - Intronic
1051496415 9:17728381-17728403 CTCTTCCAGCAGAATGGTGGTGG + Intronic
1051791323 9:20805903-20805925 CTGCTGCAGCAGCATCTTTGGGG + Intronic
1053486143 9:38457870-38457892 CTGTTTCAGCAGAGTGATGAGGG + Intergenic
1056858781 9:90160475-90160497 CTGTGACAGCAGGATGTTGGAGG + Intergenic
1057164840 9:92917349-92917371 CAGTTTCTACAGAATGTTGGAGG + Intergenic
1058481645 9:105401950-105401972 CTGTCTCAGCTGAGTCTTGAAGG + Intronic
1058694181 9:107545451-107545473 CTGTTTAAGCAGAACCGGGGTGG - Intergenic
1060544285 9:124451226-124451248 CTGATGAAGCAGAACCTTGGCGG + Intergenic
1060943053 9:127554355-127554377 GTGTTTGAGCTCAATCTTGGAGG - Intronic
1061260879 9:129480477-129480499 CTGATTCAGTAGAATCTGAGGGG + Intergenic
1061360103 9:130135987-130136009 GTGTTTGATCAGAATTTTGGGGG + Exonic
1203658287 Un_KI270753v1:19441-19463 CTGTATGAGCAGAAATTTGGAGG + Intergenic
1186989911 X:15056211-15056233 CTGATTCAGCAGAGTTTGGGTGG + Intergenic
1187735650 X:22301410-22301432 ATGTTTTAGCAATATCTTGGTGG - Intergenic
1187975316 X:24699204-24699226 TTGTTTTAACAGGATCTTGGAGG + Intronic
1188501052 X:30826529-30826551 TTGTTTCAACATAATCTAGGGGG + Intergenic
1189189297 X:39084103-39084125 ATTTTTCATCAGAAACTTGGAGG + Intergenic
1191262956 X:58348013-58348035 CTGTTTTTGTAGAATCTGGGAGG + Intergenic
1191583079 X:62787234-62787256 CTGTTTTCGTAGAATCTTTGAGG - Intergenic
1192784812 X:74325415-74325437 CTCTTTCTGCAGCATCTTTGTGG + Intergenic
1192803812 X:74492904-74492926 CTCTTTCTGCAGCATCTTTGTGG - Intronic
1194053463 X:89101153-89101175 CTTTTTGAGCAGAATATGGGGGG - Intergenic
1195005195 X:100678728-100678750 CTGCTTCAGCAGATTCAAGGAGG - Intronic
1195550164 X:106160130-106160152 ATGTGTCAGCAGATTCTTTGTGG + Intergenic
1195742046 X:108074718-108074740 CTATTTGAGCAGGATCTTGAAGG + Intronic
1195907656 X:109861656-109861678 TTGTTGCAGCAGAATCTTTGAGG + Intergenic
1198444515 X:136698561-136698583 ATTTCTCATCAGAATCTTGGAGG + Intronic
1199861301 X:151802228-151802250 CTGCCTCAGCAGGCTCTTGGTGG + Intergenic
1201456727 Y:14176260-14176282 ATGTATCAGAAAAATCTTGGAGG + Intergenic
1201624595 Y:16000798-16000820 CTGTCTCATCACAATGTTGGGGG + Intergenic
1201735205 Y:17252627-17252649 TTGTTTCAGCAGCACCATGGAGG + Intergenic
1202333646 Y:23781510-23781532 CTGCTTCAGCTGATGCTTGGTGG + Intergenic
1202537123 Y:25888553-25888575 CTGCTTCAGCTGATGCTTGGTGG - Intergenic