ID: 948620335

View in Genome Browser
Species Human (GRCh38)
Location 2:239230594-239230616
Sequence AGTGGCCCCCACGGAAGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 101}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948620335_948620340 -3 Left 948620335 2:239230594-239230616 CCAGTCCTTCCGTGGGGGCCACT 0: 1
1: 0
2: 2
3: 13
4: 101
Right 948620340 2:239230614-239230636 ACTCGAGGAACCACCAGAGATGG 0: 1
1: 0
2: 0
3: 7
4: 99
948620335_948620342 4 Left 948620335 2:239230594-239230616 CCAGTCCTTCCGTGGGGGCCACT 0: 1
1: 0
2: 2
3: 13
4: 101
Right 948620342 2:239230621-239230643 GAACCACCAGAGATGGCCGTGGG 0: 1
1: 0
2: 0
3: 4
4: 93
948620335_948620341 3 Left 948620335 2:239230594-239230616 CCAGTCCTTCCGTGGGGGCCACT 0: 1
1: 0
2: 2
3: 13
4: 101
Right 948620341 2:239230620-239230642 GGAACCACCAGAGATGGCCGTGG 0: 1
1: 0
2: 1
3: 8
4: 132
948620335_948620345 15 Left 948620335 2:239230594-239230616 CCAGTCCTTCCGTGGGGGCCACT 0: 1
1: 0
2: 2
3: 13
4: 101
Right 948620345 2:239230632-239230654 GATGGCCGTGGGTCCTTCACTGG 0: 1
1: 0
2: 0
3: 5
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948620335 Original CRISPR AGTGGCCCCCACGGAAGGAC TGG (reversed) Intronic
900137862 1:1126084-1126106 AGGGACCCCCCGGGAAGGACGGG + Intergenic
900641003 1:3688028-3688050 TGTGGCCCCCAGGAAAGGGCAGG + Intronic
902792359 1:18777995-18778017 AGTGGCTCCCAAGGCAGGCCAGG + Intergenic
904237082 1:29122939-29122961 TGTGGCCCCCACGAAAGGGAGGG + Intronic
915349017 1:155213108-155213130 GGCGGCCACCAGGGAAGGACAGG - Intronic
915352204 1:155233735-155233757 GGCGGCCACCAGGGAAGGACAGG - Intergenic
915723529 1:158001623-158001645 AGTGGGGCCCAAGGATGGACAGG + Intronic
917285624 1:173419006-173419028 TGTGGCCCCCACGGTGGGGCTGG + Intergenic
918050935 1:180971860-180971882 AGTAACCCCCACCGAAGGAGGGG - Intergenic
924135000 1:240956523-240956545 TGTGGCCCCCACTGAAGGAGTGG - Intronic
1062906150 10:1180648-1180670 AGGGGACCCCACGTAAGGAAAGG - Exonic
1064286877 10:13999165-13999187 TGTGGCTCTCAAGGAAGGACAGG - Intronic
1067178790 10:43969734-43969756 AGTGGCCCCCGCGGCTGCACAGG - Intergenic
1070112265 10:73497140-73497162 AGAGGCCCCCACGGAAGGAGAGG + Intergenic
1070850353 10:79558138-79558160 AGTGCCCCACACAGAAGGAGGGG + Intronic
1070856865 10:79613158-79613180 AGTGCCCCACACAGAAGGAGGGG - Intronic
1071470061 10:85977754-85977776 AGTGACTGCCACGTAAGGACTGG - Intronic
1075387734 10:122069186-122069208 TGTTGCCCCCACTGAAGGTCTGG - Intronic
1076848147 10:133080152-133080174 AGCGGGTCCCACGGAAGGGCGGG + Intronic
1077135254 11:994912-994934 AGTGGCCCCCAGGACAGGCCAGG - Intronic
1080611915 11:33911751-33911773 AGTGGCCCACAAGAAAGGACTGG + Intergenic
1081911344 11:46701596-46701618 AGCGGCCCCCACAGCAGGCCGGG - Exonic
1084660789 11:70545134-70545156 AGAGACGCCCACGGCAGGACTGG - Intronic
1085249304 11:75131694-75131716 AGTGGTCCCCAAGCAAGAACAGG + Intronic
1085943451 11:81235846-81235868 AGTAGCCCCCATAGAAGGATGGG - Intergenic
1092164900 12:6336668-6336690 AGTGGCCCTCAGGGAAGGGAGGG - Intronic
1097167910 12:57095315-57095337 ACTGGCCCCCTCGGGAGGCCTGG + Exonic
1097464348 12:59903941-59903963 CCTGTCCCCCAGGGAAGGACAGG - Intergenic
1100330170 12:93573783-93573805 CGTGGCCCACACGGAAAGACCGG - Intronic
1101781571 12:107843373-107843395 CGGGGCCTGCACGGAAGGACAGG + Intergenic
1103508158 12:121455148-121455170 AGTGGCCCCTCAGGAAGCACTGG + Intronic
1104537582 12:129632620-129632642 AGTGGCCTCGAGGGAGGGACTGG - Intronic
1104736050 12:131136570-131136592 ACAGGCCCCCAAGGAAGGGCAGG + Intronic
1106564260 13:30871424-30871446 CGTCGCCCCAAGGGAAGGACAGG - Intergenic
1109177260 13:59171833-59171855 AGTTGCCCCAAGGGAAGAACAGG + Intergenic
1113420281 13:110165613-110165635 AGTGGAACCCAAGGAAGGAGAGG - Intronic
1113911528 13:113843565-113843587 AGTGGCCGCTATGGCAGGACGGG + Intronic
1118716361 14:68562957-68562979 AGTGTGCTCCACGGAAGGCCCGG + Intronic
1121703204 14:95971889-95971911 CGGGGCCCCCACGGGGGGACTGG + Intergenic
1123038548 14:105481177-105481199 AGTGCCCCTCACTGAAGGAAGGG - Intergenic
1124235146 15:27983767-27983789 ACTGGCCCCCAGGGCAGGGCAGG + Intronic
1127849786 15:62902434-62902456 AGTGGCCCTCAGGGTAGGAGGGG + Intergenic
1127867210 15:63042585-63042607 AGCGGCCCCCGCGGGAGGAGCGG + Intergenic
1129822569 15:78615023-78615045 AGTGGCCCACTGTGAAGGACTGG + Intronic
1134600309 16:15528640-15528662 AAAGGCCCCCACGGCAGGAGGGG - Intronic
1140457541 16:75113903-75113925 AGAGGCCCCCTGGGAAGGCCAGG - Intronic
1140929076 16:79610361-79610383 ACTGGCCCCCAAGGCAGGCCAGG + Intergenic
1141449051 16:84084937-84084959 AGTAGCTCCCACGTCAGGACAGG - Intronic
1142225419 16:88874790-88874812 AGTGGCCCCGAGGGGAGGAGCGG - Intergenic
1143511065 17:7395167-7395189 AGTGGCCCCCAAGGCAGGACTGG - Intronic
1144736018 17:17555852-17555874 AGTGGCTCCCATAGAAGGAGGGG + Intronic
1150268873 17:63849636-63849658 AGTGGCCCTCACACAAGGATTGG + Intergenic
1151456035 17:74226351-74226373 AGTGTCCCACAAGGAAGGGCTGG + Intronic
1151975979 17:77483708-77483730 AGTGGCAGCCACGGAAGGCGAGG - Intronic
1152010575 17:77711059-77711081 AGTGGATCCCACGGAAGCGCTGG + Intergenic
1156828061 18:41457179-41457201 AGTTGCCCACACTGCAGGACTGG + Intergenic
1157104688 18:44762652-44762674 AGTGGTACCCAGGGAAGGAAAGG + Intronic
1157478863 18:48040143-48040165 AGAGGCCCCCCCGGCAGGTCAGG + Exonic
1160286120 18:77545079-77545101 AGAGGCCCCCACGGACTGGCTGG - Intergenic
1161176595 19:2846402-2846424 AGTTGCCCACAGTGAAGGACTGG - Intronic
1161597466 19:5157931-5157953 GGAGGACCCGACGGAAGGACAGG + Intergenic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
1163538280 19:17890953-17890975 AGTGGCCCCCAAGGAAGAAGTGG + Exonic
1166103178 19:40583331-40583353 AGGGGTCACCACGGAAGGAAAGG + Intronic
927508418 2:23629208-23629230 AGTGGCCCAGACGGACAGACAGG - Intronic
930314051 2:49775865-49775887 AGTGGCCTCCACAGAAGCAGAGG + Intergenic
937338146 2:121074693-121074715 AGTGGCCCCCAGGGATGGAGAGG + Intergenic
939505543 2:143041720-143041742 TGGGGACCCCATGGAAGGACTGG - Intronic
944426283 2:199586727-199586749 AGTGGCCCTGAAGAAAGGACTGG + Intergenic
946147373 2:217741241-217741263 AGTGGCCCCCATAGCAGGCCAGG - Intronic
948620335 2:239230594-239230616 AGTGGCCCCCACGGAAGGACTGG - Intronic
1168848397 20:960411-960433 ACCGGCGCCCACGCAAGGACAGG - Exonic
1169569082 20:6887234-6887256 AGTGGTCCCCAAGGCAGGCCAGG - Intergenic
1175852128 20:62099293-62099315 AGGAGCCCCCACGGAAGGGCTGG - Intergenic
1175957132 20:62617110-62617132 AGTGGACCCCACGCAGGGATTGG + Intergenic
1176091213 20:63319399-63319421 GGCGGCCCCCACGACAGGACAGG - Intronic
1183623712 22:38989306-38989328 AGTGGCCCCCACAAAGGGAGTGG + Intronic
950097933 3:10340766-10340788 AGAGGCCCCCACGAAAGGCCAGG - Intronic
953916438 3:46923738-46923760 CGTGGCCCCCAGGGAGAGACGGG + Intronic
954213675 3:49112291-49112313 AGTAGCCCACACGGTAGCACCGG + Exonic
954762472 3:52886332-52886354 AGTGGGCCTCACTGCAGGACTGG - Intronic
957204596 3:77179946-77179968 AGTGGCTCCCATGGAATGACAGG + Intronic
962853450 3:139324902-139324924 AGTGGCCCGCTGGGAAGTACAGG - Intronic
966533892 3:181009532-181009554 TGTGGCCCCCACGCAAGAACTGG - Intergenic
968133563 3:196207198-196207220 AGTAGGCCCCCAGGAAGGACAGG + Intronic
984876495 4:184372229-184372251 AGTGGCTCCCAGGGAAGGGGTGG - Intergenic
985543911 5:499847-499869 AGTGGCCCCTACAGAGGGGCTGG - Intronic
999253591 5:150196858-150196880 AGTGGTCCCCAGGGAGGGAAGGG + Intronic
1003529767 6:6927959-6927981 AGTGGGACCCATGGAAGGACGGG + Intergenic
1004206323 6:13594704-13594726 GGTGCTCCCCAAGGAAGGACTGG + Intronic
1011544048 6:88465280-88465302 AGAAGCCCACACGGAAGGAATGG - Intergenic
1012921580 6:105225605-105225627 AGTGGCCACCACGAAAGGCAGGG + Intergenic
1017607980 6:156153594-156153616 ATTGGTCCCCAGGGAGGGACAGG - Intergenic
1019026368 6:168967466-168967488 TGTGGCCCCAGTGGAAGGACCGG + Intergenic
1020076140 7:5260286-5260308 AGTGGCCACCAGGCAAGGCCTGG - Intergenic
1021521307 7:21542151-21542173 AGTAGCCCCCATGGAAGGGGTGG + Intergenic
1024035441 7:45504180-45504202 TGTGGCCCCCACACAAGGAGGGG - Intergenic
1025202950 7:56973285-56973307 AGTGGCCACCAGGCAAGGGCTGG + Intergenic
1025668994 7:63603641-63603663 AGTGGCCACCAGGCAAGGGCTGG - Intergenic
1034404368 7:150892321-150892343 AGGGGCCCCCAGGGAATGACTGG + Intergenic
1035251121 7:157597806-157597828 AGTGGCCCCCACAGGACGGCAGG - Intronic
1037297940 8:17421014-17421036 AGTGGCCACCAAGGATGGAGAGG + Intergenic
1040414216 8:47182514-47182536 AGGGGCCCACATGGAAGGCCTGG - Intergenic
1047488779 8:125357094-125357116 GTTGGCCCCCATGTAAGGACTGG - Intronic
1049018039 8:139935232-139935254 AGTGGCTGCCAGGGAAGGAGAGG + Intronic
1049105349 8:140609110-140609132 CGTGGCCCCCAGGGAAGGGCTGG - Intronic
1049231800 8:141488501-141488523 TGTTGCCCCCACAGAAGGTCTGG + Intergenic
1053422133 9:37986388-37986410 AATGGCCCCCACAGAAGGTGGGG + Intronic
1056257295 9:84813224-84813246 AGTGGCCCCTCTGGAAGGGCAGG - Intronic
1056436770 9:86581788-86581810 AGTGGCACTCAGGGAAGAACAGG + Intergenic
1056932800 9:90892784-90892806 AGAGGCCCCCACTGGAGGGCTGG - Intronic
1059679960 9:116576487-116576509 GGTGGCCCCCATGGGAGGCCAGG + Intronic
1060733017 9:126049896-126049918 AGTTGCCCTCTCGGAAGGGCGGG + Intergenic
1061050343 9:128191461-128191483 AGTCGCCCCCACGGATGGGCCGG + Exonic
1062443191 9:136582662-136582684 AGTGGGCCACACGGCAGGCCTGG - Intergenic
1189461202 X:41244494-41244516 AGTGGCCCTTAAGAAAGGACTGG + Intergenic
1195329480 X:103785621-103785643 AGTGGCCACCAGGGAAGCAAAGG - Exonic