ID: 948621002

View in Genome Browser
Species Human (GRCh38)
Location 2:239234672-239234694
Sequence GCCTGTTTGCGTGGGAGCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 113}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948621002_948621012 12 Left 948621002 2:239234672-239234694 CCTAAGCTCCCACGCAAACAGGC 0: 1
1: 0
2: 0
3: 3
4: 113
Right 948621012 2:239234707-239234729 CCCCAGGTGCCCTCTGTGGGAGG 0: 1
1: 0
2: 3
3: 40
4: 322
948621002_948621008 -4 Left 948621002 2:239234672-239234694 CCTAAGCTCCCACGCAAACAGGC 0: 1
1: 0
2: 0
3: 3
4: 113
Right 948621008 2:239234691-239234713 AGGCAGCAGAGGCGGGCCCCAGG 0: 1
1: 0
2: 2
3: 47
4: 498
948621002_948621010 9 Left 948621002 2:239234672-239234694 CCTAAGCTCCCACGCAAACAGGC 0: 1
1: 0
2: 0
3: 3
4: 113
Right 948621010 2:239234704-239234726 GGGCCCCAGGTGCCCTCTGTGGG 0: 1
1: 0
2: 3
3: 30
4: 309
948621002_948621009 8 Left 948621002 2:239234672-239234694 CCTAAGCTCCCACGCAAACAGGC 0: 1
1: 0
2: 0
3: 3
4: 113
Right 948621009 2:239234703-239234725 CGGGCCCCAGGTGCCCTCTGTGG 0: 1
1: 0
2: 5
3: 35
4: 309
948621002_948621017 24 Left 948621002 2:239234672-239234694 CCTAAGCTCCCACGCAAACAGGC 0: 1
1: 0
2: 0
3: 3
4: 113
Right 948621017 2:239234719-239234741 TCTGTGGGAGGCTGAAGCCCCGG 0: 1
1: 0
2: 4
3: 50
4: 623

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948621002 Original CRISPR GCCTGTTTGCGTGGGAGCTT AGG (reversed) Intronic