ID: 948625405

View in Genome Browser
Species Human (GRCh38)
Location 2:239265214-239265236
Sequence AGGATGGGTCCAGCACACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 205}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948625389_948625405 25 Left 948625389 2:239265166-239265188 CCTTAACCCCCAAGTGACAAGCA 0: 1
1: 0
2: 0
3: 9
4: 221
Right 948625405 2:239265214-239265236 AGGATGGGTCCAGCACACTCAGG 0: 1
1: 0
2: 0
3: 9
4: 205
948625398_948625405 -4 Left 948625398 2:239265195-239265217 CCACATGTGTGCCAACCCCAGGA 0: 1
1: 0
2: 0
3: 15
4: 197
Right 948625405 2:239265214-239265236 AGGATGGGTCCAGCACACTCAGG 0: 1
1: 0
2: 0
3: 9
4: 205
948625394_948625405 17 Left 948625394 2:239265174-239265196 CCCAAGTGACAAGCAGGGCTCCC 0: 1
1: 0
2: 1
3: 17
4: 142
Right 948625405 2:239265214-239265236 AGGATGGGTCCAGCACACTCAGG 0: 1
1: 0
2: 0
3: 9
4: 205
948625396_948625405 -3 Left 948625396 2:239265194-239265216 CCCACATGTGTGCCAACCCCAGG 0: 1
1: 0
2: 1
3: 17
4: 175
Right 948625405 2:239265214-239265236 AGGATGGGTCCAGCACACTCAGG 0: 1
1: 0
2: 0
3: 9
4: 205
948625388_948625405 26 Left 948625388 2:239265165-239265187 CCCTTAACCCCCAAGTGACAAGC 0: 1
1: 0
2: 0
3: 5
4: 131
Right 948625405 2:239265214-239265236 AGGATGGGTCCAGCACACTCAGG 0: 1
1: 0
2: 0
3: 9
4: 205
948625393_948625405 18 Left 948625393 2:239265173-239265195 CCCCAAGTGACAAGCAGGGCTCC 0: 1
1: 0
2: 0
3: 17
4: 139
Right 948625405 2:239265214-239265236 AGGATGGGTCCAGCACACTCAGG 0: 1
1: 0
2: 0
3: 9
4: 205
948625395_948625405 16 Left 948625395 2:239265175-239265197 CCAAGTGACAAGCAGGGCTCCCA 0: 1
1: 0
2: 0
3: 26
4: 192
Right 948625405 2:239265214-239265236 AGGATGGGTCCAGCACACTCAGG 0: 1
1: 0
2: 0
3: 9
4: 205
948625392_948625405 19 Left 948625392 2:239265172-239265194 CCCCCAAGTGACAAGCAGGGCTC 0: 1
1: 0
2: 0
3: 12
4: 141
Right 948625405 2:239265214-239265236 AGGATGGGTCCAGCACACTCAGG 0: 1
1: 0
2: 0
3: 9
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948625405 Original CRISPR AGGATGGGTCCAGCACACTC AGG Intronic
900305456 1:2004599-2004621 ATGATGGTGCCATCACACTCTGG + Intergenic
900617403 1:3571572-3571594 AGGAAGGACCCAGCACACTTGGG - Intronic
900617506 1:3571956-3571978 AGGAAGGACCCAGCACACCCAGG - Intronic
900617517 1:3571995-3572017 AGGAAGGACCCAGCACACCCAGG - Intronic
900617532 1:3572055-3572077 AGGAAGGACCCAGCACACCCAGG - Intronic
900617543 1:3572093-3572115 AGGAAGGACCCAGCACACCCGGG - Intronic
900617566 1:3572189-3572211 AGGAAGGACCCAGCACACCCAGG - Intronic
900617589 1:3572286-3572308 AGGAAGGACCCAGCACACCCAGG - Intronic
900617628 1:3572439-3572461 AGGAAGGACCCAGCACACCCAGG - Intronic
900617634 1:3572459-3572481 AGGAAGGACCCAGCACACCCAGG - Intronic
900617669 1:3572614-3572636 AGGAAGGACCCAGCACACCCAGG - Intronic
900617675 1:3572634-3572656 AGGAAGGACCCAGCACACCCAGG - Intronic
900617720 1:3572828-3572850 AGGAAGGACCCAGCACACCCAGG - Intronic
900617731 1:3572867-3572889 AGGAAGGACCCAGCACACCCAGG - Intronic
900617742 1:3572906-3572928 AGGAAGGACCCAGCACACCCAGG - Intronic
901853918 1:12032048-12032070 AGGATGGAACCAGCACACGTGGG - Intergenic
904283939 1:29442121-29442143 GGGATGGGACCAACAGACTCTGG + Intergenic
904539317 1:31222206-31222228 AGGCTGGGTCCAGGGCAGTCTGG + Intronic
905649338 1:39646147-39646169 AGGACAGGCCCAGCACACCCCGG - Intergenic
907440426 1:54475090-54475112 GGGGTGGGGCCAGGACACTCAGG + Intergenic
908218106 1:61976062-61976084 AGCATGGCTGCAGCACACACAGG - Intronic
908745474 1:67372295-67372317 AAGATGGTTCAAGCACAGTCTGG - Intronic
915662169 1:157413614-157413636 AGGATGGGTCCTGGACATTTTGG + Intergenic
915994605 1:160550240-160550262 AGGATGAGTCCTGCTCAGTCAGG + Intronic
916436927 1:164785916-164785938 AGGCTGGGTCCAGGAAGCTCTGG + Intronic
917991943 1:180389175-180389197 AGGAAGGGGACATCACACTCTGG - Intronic
922821459 1:228488046-228488068 GGGAGGGGCCCAGCACACGCTGG - Intronic
924899609 1:248383070-248383092 AGGATAGGATGAGCACACTCAGG - Intergenic
924899614 1:248383138-248383160 AGGATAGGATGAGCACACTCAGG - Intergenic
924899625 1:248383274-248383296 AGGATAGGATGAGCACACTCAGG - Intergenic
924899631 1:248383342-248383364 AGGATAGGATGAGCACACTCAGG - Intergenic
924899636 1:248383410-248383432 AGGATAGGATGAGCACACTCAGG - Intergenic
924899641 1:248383478-248383500 AGGATAGGATGAGCACACTCAGG - Intergenic
924899652 1:248383614-248383636 AGGATAGGATGAGCACACTCAGG - Intergenic
924899658 1:248383682-248383704 AGGATAGGATGAGCACACTCAGG - Intergenic
924899663 1:248383750-248383772 AGGATAGGATGAGCACACTCAGG - Intergenic
924899668 1:248383818-248383840 AGGATAGGATGAGCACACTCAGG - Intergenic
924899679 1:248383954-248383976 AGGATAGGATGAGCACACTCAGG - Intergenic
924899690 1:248384090-248384112 AGGATAGGATGAGCACACTCAGG - Intergenic
924899696 1:248384158-248384180 AGGATAGGATGAGCACACTCAGG - Intergenic
924899707 1:248384294-248384316 AGGATAGGATGAGCACACTCAGG - Intergenic
924899712 1:248384362-248384384 AGGATAGGATGAGCACACTCAGG - Intergenic
924899725 1:248384498-248384520 AGGATAGGATGAGCACACTCAGG - Intergenic
924899730 1:248384566-248384588 AGGATAGGATGAGCACACTCAGG - Intergenic
1063461025 10:6215158-6215180 AGGAAGGGGCCAGCTCACACCGG - Intronic
1063648220 10:7907327-7907349 AGGATAGGAACAGCACACTTTGG - Intronic
1067695058 10:48528560-48528582 AGGAGGGGTCCAGCACCTTAGGG + Intronic
1069629116 10:69887216-69887238 AGGAAGGGGCCAGCATCCTCTGG - Intronic
1071267244 10:83975179-83975201 AGGATGAGTCCAGGACCCACTGG + Intergenic
1073074532 10:100815523-100815545 GGGATGTGGCCAGCAGACTCAGG - Intronic
1074455750 10:113593950-113593972 AGAAAGGGGCCTGCACACTCGGG - Intronic
1074757472 10:116635148-116635170 AGTAAGGGCCCAGCACAGTCAGG - Intronic
1075539450 10:123299902-123299924 AGAATGGATCCCCCACACTCAGG + Intergenic
1077101851 11:825965-825987 GGGCTGGCTCCAGCACCCTCAGG - Intergenic
1080662333 11:34307268-34307290 AGGAGGAGTCCAGCACAATTAGG + Intronic
1082579002 11:54843814-54843836 AGGAAGGGAACATCACACTCTGG + Intergenic
1083456536 11:62782591-62782613 AGCATCTGTACAGCACACTCGGG - Intronic
1083886818 11:65577072-65577094 AGGCTGGGGCCTGCACCCTCTGG - Intronic
1086457498 11:86973600-86973622 AGGCTGGGTCCTGCAGCCTCAGG - Intergenic
1088857807 11:113772238-113772260 ATGTTGGGTCCAGAACACGCAGG + Intronic
1089555519 11:119314202-119314224 AGGATTGCACCACCACACTCCGG - Intronic
1089809907 11:121123134-121123156 AGTGTGGGTCCAGGACACCCTGG + Intronic
1092510161 12:9146818-9146840 CTGATGGGTCCAGCACAGACTGG - Intergenic
1096881509 12:54676413-54676435 AGGATGGTTCATGGACACTCAGG + Intergenic
1097985638 12:65780462-65780484 AGTATGGGTCCAGCAGAGCCTGG - Intergenic
1108050531 13:46432427-46432449 GGGTTGCATCCAGCACACTCGGG + Intronic
1108055551 13:46481433-46481455 ATGCTGGCTCCAACACACTCAGG + Intergenic
1109543110 13:63806051-63806073 GGGTTGCATCCAGCACACTCGGG + Intergenic
1109556901 13:63988322-63988344 AGGATAGGTCAGGCTCACTCTGG + Intergenic
1109952420 13:69516074-69516096 AGGAGGGGAACAGCACACACTGG + Intergenic
1113605877 13:111605268-111605290 AGGATGGGAACATCACACACTGG - Intronic
1113922321 13:113920037-113920059 ACACAGGGTCCAGCACACTCAGG - Intergenic
1114170429 14:20267317-20267339 AGGAAGGGAACATCACACTCTGG + Intronic
1117118139 14:52537564-52537586 TGTATTTGTCCAGCACACTCAGG + Intronic
1117582877 14:57170494-57170516 GAGATGGGTCCTCCACACTCAGG + Intergenic
1119899753 14:78249564-78249586 AGTATGGGTCCATCACAGTGAGG + Intronic
1120064475 14:80024659-80024681 AGAATGGTTACAGCACACTCCGG - Intergenic
1121315767 14:92960256-92960278 AGTATGGGGTCAGCACGCTCAGG - Intronic
1127485834 15:59416805-59416827 AGAATGGTTCCAGCACCCTTTGG - Intronic
1128604390 15:69026251-69026273 AGTGTGGGTCCACCTCACTCGGG + Intronic
1128710372 15:69867009-69867031 AGGATGGGCCCACCCCACCCAGG - Intergenic
1128738822 15:70069630-70069652 AGGACCGGTCCAGCAGACTCTGG + Intronic
1128972203 15:72117810-72117832 AGGGTGGGCCCAGCAGCCTCAGG + Exonic
1129336348 15:74854321-74854343 TCGCTGGGTCCAGCACACTTGGG + Intronic
1132065510 15:98727742-98727764 CGGGTGGGTCCAGCACCCGCTGG + Intronic
1132610864 16:815672-815694 AGGATGGCGCCAGTGCACTCTGG - Intergenic
1132985930 16:2767636-2767658 AGGATGGCTCCAGCATTGTCTGG + Exonic
1134174933 16:11998030-11998052 AGGATGCGCCCAGCACACGGTGG + Intronic
1136688301 16:32009087-32009109 AGGCTGTGTCCAGGACACCCAGG + Intergenic
1136788902 16:32952642-32952664 AGGCTGTGTCCAGGACACCCAGG + Intergenic
1136880910 16:33901292-33901314 AGGCTGTGTCCAGGACACCCAGG - Intergenic
1140179719 16:72702850-72702872 AGGAGGGGAACATCACACTCTGG - Intergenic
1140457866 16:75115147-75115169 AGGATGGTCCCAGCACACCTTGG - Intronic
1140975428 16:80055609-80055631 AGGAAGTGTCCAGAACAATCCGG - Intergenic
1142234705 16:88916546-88916568 GGGATGGCTGCAGAACACTCCGG + Intronic
1203091099 16_KI270728v1_random:1214131-1214153 AGGCTGTGTCCAGGACACCCAGG + Intergenic
1143293598 17:5853643-5853665 AGGAGGGGTGGGGCACACTCAGG + Intronic
1143598608 17:7929987-7930009 AGGATGGCTCCTGCACCCTCTGG + Intronic
1143627351 17:8118123-8118145 AGGATGGGCCCAGCTCTCTCTGG + Exonic
1143798584 17:9358851-9358873 AGGATGAGTACAGGAAACTCCGG + Intronic
1145748590 17:27339034-27339056 AGCCTGGGTCAAACACACTCCGG - Intergenic
1147149289 17:38504793-38504815 AGGCTGTGTCCAGGACACCCAGG + Intronic
1148345097 17:46897915-46897937 TGGGTGGGTCCTGCACACCCAGG + Intergenic
1148860440 17:50601720-50601742 AGGGTGGGCCCAGCTCACCCTGG + Intronic
1153908922 18:9689283-9689305 AGGAGGGGAACAGCACACACCGG - Intergenic
1157969900 18:52254619-52254641 AGAATGGGACCAGCAGACACAGG + Intergenic
1158043925 18:53132371-53132393 AGGCTTGCTCCAGCACACTGCGG + Intronic
1158176607 18:54664376-54664398 AGGAGGGGAACATCACACTCTGG - Intergenic
1158420459 18:57288470-57288492 AGGATAGGACCAGCATATTCAGG - Intergenic
1158493791 18:57934429-57934451 GGGAGGGGAACAGCACACTCTGG - Intergenic
1161241803 19:3227106-3227128 AAAATGGGTCCAGTACCCTCGGG + Intronic
1162283526 19:9719713-9719735 AGGATGGACCCATCACACCCGGG + Intergenic
1164518031 19:28953032-28953054 AGCAGGGAGCCAGCACACTCAGG - Intergenic
1164794232 19:31013597-31013619 AGGATGGGTCCGGGGCACCCGGG - Intergenic
925293667 2:2764233-2764255 GGAATGCTTCCAGCACACTCAGG + Intergenic
926221075 2:10935751-10935773 AGGATGAGTCCAGCACGGTTAGG - Intergenic
927602565 2:24456971-24456993 AGGCAGGGTCCACAACACTCAGG - Intergenic
929441822 2:41970986-41971008 AGAGTGGGTCCAGCCCATTCAGG - Intergenic
930871216 2:56172845-56172867 AGGAAGGGGACATCACACTCTGG - Intergenic
932074842 2:68653277-68653299 AGGATGGGTTGCGCCCACTCTGG - Intronic
932237484 2:70132359-70132381 AGGATGGCTTCAGCACAGCCTGG + Intergenic
932638287 2:73412745-73412767 AGGATGGCGCCAGTGCACTCTGG + Intronic
932817456 2:74873432-74873454 ATGATGAGTCAAGGACACTCAGG - Intronic
934930470 2:98418370-98418392 AGGATGAGGACAGCACCCTCAGG - Intergenic
935414654 2:102802784-102802806 AGGATGTGGCCTGGACACTCAGG + Intronic
945734927 2:213587280-213587302 AGGATGGCTCCAGCTGACCCAGG - Intronic
946472078 2:219970416-219970438 AGGATGGGAGCTGCAAACTCTGG - Intergenic
947366719 2:229403883-229403905 TGGATGGGGCCAGACCACTCAGG + Intronic
948056919 2:235015608-235015630 GTGATGGGTACAGCTCACTCTGG + Intronic
948625405 2:239265214-239265236 AGGATGGGTCCAGCACACTCAGG + Intronic
1168790630 20:573528-573550 GGGATGCGTCCAGCCCCCTCTGG - Intergenic
1171730483 20:28688920-28688942 AGGAAGGGAACATCACACTCTGG + Intergenic
1172885455 20:38228038-38228060 AGGCTGGGACCAGGACTCTCAGG - Intronic
1175391263 20:58628825-58628847 AGGATGAGACCCTCACACTCTGG - Intergenic
1175598962 20:60257288-60257310 AGCAGGGGTCCAGCATACACGGG + Intergenic
1179178595 21:39026521-39026543 AGGCTGGGGCCAGAACAGTCAGG + Intergenic
1179289772 21:40008233-40008255 AGGCAGAGTCCAGCACTCTCTGG + Intergenic
1181472261 22:23147895-23147917 AGAGTGTGTGCAGCACACTCCGG + Intronic
1181861856 22:25825123-25825145 AGGATGGGTGCATCACACACAGG + Intronic
1183293800 22:37018627-37018649 AGGACGCGTCCAGCACCCGCAGG + Exonic
1184050485 22:42000125-42000147 TGCTTGGGGCCAGCACACTCAGG + Intronic
1184326415 22:43790874-43790896 AGGAGGAGTCCATCATACTCTGG + Intronic
949807428 3:7970910-7970932 AGGAAGGTTCTGGCACACTCAGG + Intergenic
950171896 3:10844477-10844499 AGGGTGGGTAGAGCTCACTCTGG - Intronic
958201420 3:90321287-90321309 AGGAAGGGAACATCACACTCTGG + Intergenic
961077597 3:123996387-123996409 ATGATGGGTACACCATACTCAGG + Intergenic
961306980 3:125964893-125964915 ATGATGGGTACACCATACTCGGG - Intergenic
961553325 3:127681094-127681116 AGGATGGGCCCAGGCCACACTGG - Intergenic
961674530 3:128556348-128556370 ATGATGGAACCAGAACACTCTGG + Intergenic
963066565 3:141269043-141269065 AGGGTGGGGCCTGCACTCTCAGG - Intronic
963706077 3:148689938-148689960 AGGAGGGGAACATCACACTCTGG - Intergenic
964291921 3:155190852-155190874 AGGCTGGCTCCAGCACATTGTGG - Intergenic
964326132 3:155547857-155547879 AGGAAGGGGACATCACACTCTGG + Intronic
969197480 4:5574519-5574541 AGCATGGGCCCAGCACACAGAGG - Intronic
970788607 4:19829527-19829549 AGGCTGGGTCCTCAACACTCTGG + Intergenic
971098424 4:23434930-23434952 AGGATGTCTCCAGCAGCCTCAGG + Intergenic
971588245 4:28432717-28432739 ATGATGGGTGCAGCACACCAGGG - Intergenic
972814451 4:42628780-42628802 AGGCGGGGAACAGCACACTCTGG - Intronic
973242318 4:47970117-47970139 AGGATGGTTGCAGCAACCTCGGG + Intronic
973346272 4:49059869-49059891 AGGGTGGCTCCTGCAGACTCAGG - Intronic
981637756 4:146899779-146899801 GGCAGGGCTCCAGCACACTCAGG - Intronic
985958898 5:3284649-3284671 AGGATGGGACCCTCACACTGAGG + Intergenic
986162342 5:5241130-5241152 AGCATGGGGCCAGGACACTCAGG + Intronic
986269201 5:6216737-6216759 AGGATGGGAGGAGCACATTCTGG - Intergenic
989943161 5:50179339-50179361 AGGAGGGGAACATCACACTCTGG - Intergenic
989998640 5:50865872-50865894 AGGATGGAGCCAGCATTCTCAGG + Intergenic
990718590 5:58667416-58667438 AGGATGGCTCCTACACACCCAGG - Intronic
994048478 5:95335640-95335662 AGGATGGGTGAAGAACACACAGG + Intergenic
994571767 5:101524912-101524934 AGGAAGGGTACATCACACACCGG - Intergenic
995282978 5:110356090-110356112 AGGATGGCTCCAGCAGAGCCAGG + Intronic
995699167 5:114914857-114914879 AGGAAGGGAACATCACACTCTGG - Intergenic
999176033 5:149632302-149632324 AGGGTGGGTGAAGCACACTCAGG + Exonic
999803427 5:155059042-155059064 AGGAAGGGAACATCACACTCTGG - Intergenic
1000476347 5:161712611-161712633 AGGAAGGGAACATCACACTCTGG + Intergenic
1000861552 5:166462001-166462023 TGGATGGGTCCTGAGCACTCTGG + Intergenic
1002562560 5:180092206-180092228 AGGCTGGCTCCAGCTCACTCAGG - Intergenic
1003047204 6:2744730-2744752 AGCATGGCCCCAGCAGACTCGGG - Intronic
1007000779 6:38310296-38310318 AGGAGGCGTCCTTCACACTCAGG - Intronic
1008483467 6:52010308-52010330 ACGCTGGGGCCAGAACACTCAGG - Exonic
1009844193 6:69115413-69115435 AGGAGGGGAACAGCACACCCTGG + Intronic
1009946405 6:70346828-70346850 AGGATGGGGCCACCACACTTTGG + Intergenic
1012769169 6:103406358-103406380 AGCATGGGTCCAGCAAAAGCAGG - Intergenic
1014389707 6:120846487-120846509 AGGAAGGGAACATCACACTCTGG - Intergenic
1016007973 6:139108568-139108590 AGGAAGGCTCCAGCTCAGTCTGG + Intergenic
1017959556 6:159209931-159209953 AGCATGTGGCCAGCACACTAAGG - Intronic
1020760780 7:12266298-12266320 AAGATGGTACCACCACACTCCGG - Intergenic
1021046834 7:15933276-15933298 AGGCTAGATCCAGCACACTGAGG - Intergenic
1023017028 7:35978926-35978948 TGGCTGGGTCCAGCACCCTATGG - Intergenic
1023873194 7:44273662-44273684 AGGGTGGGTCCTGCACCCCCAGG - Intronic
1024094230 7:45971706-45971728 AAGATGGGTCTAGGACACCCAGG - Intergenic
1024443352 7:49447204-49447226 CTGATGGGTCCAGCAGAGTCTGG + Intergenic
1024865946 7:53905156-53905178 AGGATGAGTCCAGGACCCACTGG - Intergenic
1026555459 7:71404891-71404913 AGGATGGGAGCAGCAGGCTCTGG - Intronic
1027956366 7:84883590-84883612 AAGATGGGAACAGCACACACTGG - Intergenic
1029645344 7:101851875-101851897 ATGATGGTGCCACCACACTCTGG - Intronic
1034270849 7:149802894-149802916 AGGAGGGGTCCAGGAGACACAGG - Intergenic
1034589907 7:152130091-152130113 AGGATGGAATCAGCACACGCCGG + Intergenic
1036635942 8:10549491-10549513 AGCCTGTGTCCAGCACACTGGGG + Intronic
1036677766 8:10849458-10849480 TGGAAGGGACCAGCACACTTTGG - Intergenic
1036748623 8:11428743-11428765 AGCATGGGCCCAGCACAGCCAGG - Intronic
1040629967 8:49198937-49198959 AGGGTGGTGCCAGCACACACTGG - Intergenic
1043452554 8:80382606-80382628 AGGATGAGACCGGCACATTCTGG - Intergenic
1048219706 8:132530170-132530192 AGGATAGGACCAGCACAGGCAGG - Intergenic
1051584943 9:18717053-18717075 AGGAAGGGAACATCACACTCTGG + Intronic
1056130656 9:83583655-83583677 ATGATTGGGCCACCACACTCCGG - Intergenic
1056405568 9:86270910-86270932 AGGAAGGGAACATCACACTCTGG + Intronic
1058214607 9:102218082-102218104 AGGAAGGGGACATCACACTCTGG - Intergenic
1060860369 9:126948989-126949011 AGGAAGGGAACATCACACTCTGG - Intronic
1186479220 X:9883410-9883432 AGGATGGGGCCAGCACCCAGTGG + Intronic
1188020193 X:25148743-25148765 AGGAGGGGAACAACACACTCTGG - Intergenic
1190108908 X:47577449-47577471 AAGATGGGGCACGCACACTCTGG - Exonic
1191985047 X:66970514-66970536 AGGAAGGGGACATCACACTCAGG - Intergenic
1192711525 X:73595346-73595368 GGGAGGGGTACAGCACACACCGG - Intronic
1194190730 X:90834059-90834081 AGGAAGGGGACATCACACTCCGG - Intergenic
1199556426 X:149114137-149114159 AGGCTGGGTCCAGCACCTGCTGG - Intergenic