ID: 948626264

View in Genome Browser
Species Human (GRCh38)
Location 2:239270235-239270257
Sequence GTGTAAAAATGAATGGATGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 583
Summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 530}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948626259_948626264 1 Left 948626259 2:239270211-239270233 CCTGTGGCCTGTCCACATCCGTA 0: 1
1: 0
2: 2
3: 8
4: 88
Right 948626264 2:239270235-239270257 GTGTAAAAATGAATGGATGACGG 0: 1
1: 0
2: 2
3: 50
4: 530
948626260_948626264 -6 Left 948626260 2:239270218-239270240 CCTGTCCACATCCGTATGTGTAA 0: 1
1: 0
2: 0
3: 4
4: 58
Right 948626264 2:239270235-239270257 GTGTAAAAATGAATGGATGACGG 0: 1
1: 0
2: 2
3: 50
4: 530
948626258_948626264 2 Left 948626258 2:239270210-239270232 CCCTGTGGCCTGTCCACATCCGT 0: 1
1: 0
2: 1
3: 25
4: 167
Right 948626264 2:239270235-239270257 GTGTAAAAATGAATGGATGACGG 0: 1
1: 0
2: 2
3: 50
4: 530

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948626264 Original CRISPR GTGTAAAAATGAATGGATGA CGG Intronic
900498136 1:2985870-2985892 GTGAATGAATGGATGGATGATGG - Intergenic
900498744 1:2989343-2989365 ATGGATAAATGAGTGGATGATGG - Intergenic
900535792 1:3176602-3176624 ATGGATAGATGAATGGATGATGG - Intronic
900573259 1:3370438-3370460 GGGAACAAATGAATGAATGAAGG - Intronic
900993299 1:6107653-6107675 ATGGAAAAATGAAGGGATGATGG + Intronic
900993330 1:6107784-6107806 ATGGAAGAATGAAGGGATGATGG + Intronic
900993435 1:6108158-6108180 GTGGAAAGATGGAGGGATGATGG + Intronic
901001267 1:6149966-6149988 ATGGGCAAATGAATGGATGATGG + Intronic
901001310 1:6150229-6150251 ATGGACAAATGAATGGATAACGG + Intronic
902034062 1:13443724-13443746 GTGTAAAGATGAATGATTGCAGG + Intergenic
902599030 1:17528577-17528599 GTGGACAAATGGATGGATGGAGG - Intergenic
902621821 1:17655251-17655273 GTGGATAGATGGATGGATGATGG - Intronic
903030422 1:20460056-20460078 ATGGACAAATGAATGGATGATGG + Intergenic
904270033 1:29343945-29343967 GTGAGAAAAGGAATGGATGAAGG + Intergenic
904407423 1:30301649-30301671 GTGTATAAATGCATAGATAATGG + Intergenic
904632116 1:31850124-31850146 GTAGAAAAATGACAGGATGAGGG + Intergenic
904987106 1:34560992-34561014 TTGAAAAAATAAATGAATGAAGG - Intergenic
905703487 1:40037075-40037097 GTGTAAAAAGGATTGGATCTGGG - Intergenic
905963067 1:42061506-42061528 GTTTCAAAATAAAGGGATGAAGG + Intergenic
906726226 1:48046529-48046551 GTGTAAGAATGGATGTATAATGG - Intergenic
907197319 1:52697534-52697556 GTGGAAAAAAGACTGGGTGAAGG - Intronic
908032104 1:60012217-60012239 GTGTAAATATTAATGGATCTAGG - Intronic
908731179 1:67228194-67228216 GTCTAAAAAAGAAGGGAGGAAGG - Intronic
908806393 1:67937336-67937358 GTGTCAACCTGAATGGATTAGGG - Intergenic
909850385 1:80454928-80454950 ATGTACAAAAGAATGGATGTTGG + Intergenic
910186514 1:84546820-84546842 TTTTAAAAGTGAATGAATGAGGG + Intergenic
910241182 1:85087681-85087703 GGGGAAAAAAGAATGGAGGAGGG + Intronic
910407463 1:86904455-86904477 AGGTAAAAAAGAATGGATGAGGG - Intronic
911236982 1:95422165-95422187 GGGTAACAATGAGTGGATGCGGG + Intergenic
911545813 1:99215068-99215090 ATGCAAAAGTGAATGGATGGGGG - Intergenic
911627331 1:100139517-100139539 ATGAAGAAATGAATGGAGGAAGG + Intronic
914240884 1:145852081-145852103 GTGTAAAAATAAATAAATAAAGG + Intronic
914351374 1:146843018-146843040 GTGGATGGATGAATGGATGATGG + Intergenic
914351887 1:146847055-146847077 GTGAAAAAAGGAAATGATGAGGG - Intergenic
915006943 1:152647028-152647050 GTGTGTACATGCATGGATGATGG - Intergenic
915895043 1:159805459-159805481 GTGAAACAATGAATGAATGTAGG - Intronic
916614627 1:166427320-166427342 GGCTAAAAATAAATGGATGGAGG - Intergenic
917610880 1:176687868-176687890 GGGTAAAACTCAATTGATGAAGG + Intronic
918225013 1:182473528-182473550 GGGTGAAAATGATGGGATGATGG - Intronic
918281714 1:183012610-183012632 GTAAAAAAATGATTGGATAAAGG + Intergenic
920455594 1:206098737-206098759 ATGAACAAATGAATGAATGAAGG - Intronic
920722271 1:208398896-208398918 ATGAATGAATGAATGGATGATGG - Intergenic
921684637 1:218075894-218075916 GGGAAAAAATGCATGGGTGAGGG - Intergenic
921917513 1:220628639-220628661 GTGTAAGAATGAATAGAAGAGGG - Intronic
921946654 1:220890496-220890518 TGAAAAAAATGAATGGATGAAGG - Intergenic
922521626 1:226257881-226257903 GATTAAAAGTAAATGGATGAAGG + Intronic
1064275458 10:13901304-13901326 TTGTAAAATTGAATGGAGGCTGG + Intronic
1064750037 10:18519279-18519301 GTGGAAAAGTGAATGGAAGAGGG - Intronic
1064947464 10:20806768-20806790 GTGACTAAATGAATGAATGATGG + Intronic
1065468973 10:26056763-26056785 GTGTACAATTAAATAGATGATGG - Intronic
1065676859 10:28185593-28185615 GTGTAATAATGTATGGCTGAAGG - Intronic
1065687543 10:28301861-28301883 GTTTACAAGTGAATTGATGAAGG - Intronic
1066528148 10:36305034-36305056 GAGTACATGTGAATGGATGATGG - Intergenic
1066573410 10:36798928-36798950 ATGAATAAATGAATGAATGAGGG + Intergenic
1066687538 10:37994990-37995012 AAGTAAAAAAGAATGGATGTTGG + Intergenic
1067051489 10:43024059-43024081 ATGGATAAATGGATGGATGATGG + Intergenic
1067237348 10:44462223-44462245 GTGTGGGAAAGAATGGATGAGGG - Intergenic
1067510004 10:46886686-46886708 GTAGAAAACTGAATGGATTAAGG + Intergenic
1067652250 10:48165172-48165194 GTAGAAAACTGAATGGATTAAGG - Intronic
1067808240 10:49407934-49407956 ATGAAAAAATGGATGGATGAAGG + Intergenic
1069044493 10:63728314-63728336 TTGTAATCATGAAGGGATGATGG - Intergenic
1069285243 10:66706239-66706261 AAGGAAGAATGAATGGATGAAGG - Intronic
1069833627 10:71295647-71295669 GTGAGAAGATGAATAGATGACGG - Intronic
1070381673 10:75885653-75885675 GTGTAAAAATGAATGACACATGG - Intronic
1070574069 10:77664141-77664163 GCATAAACAAGAATGGATGAGGG - Intergenic
1070580371 10:77714448-77714470 GTGAATGAATGAATGGTTGATGG - Intergenic
1071482381 10:86074834-86074856 GTGTTCAAATGAATGAATGATGG + Intronic
1072442794 10:95471716-95471738 GTGTCAAAAAGAAAGGGTGAAGG + Intronic
1072853092 10:98917740-98917762 GAGTGAAAGTGAATGAATGAAGG + Intronic
1073429015 10:103474167-103474189 GAGGATAGATGAATGGATGAAGG - Intronic
1073876105 10:107922870-107922892 GTGTCAAAATAAAGGGATGGAGG + Intergenic
1074047970 10:109856595-109856617 GTTTACAACAGAATGGATGATGG - Intergenic
1074128527 10:110552038-110552060 ATGTACAAATGCAGGGATGAAGG + Intergenic
1074668268 10:115757020-115757042 GGCTCAAAATGAATGGATGGAGG - Intronic
1074960091 10:118436619-118436641 ATGAAAAAGTGAATGAATGAAGG - Intergenic
1075112917 10:119602509-119602531 GTAAAAAAATGAAAGGAGGAGGG + Intergenic
1075270752 10:121048061-121048083 GTGTCAACTTGACTGGATGAAGG - Intergenic
1075305878 10:121366644-121366666 ATGTAAAAATGGATGGAGGGTGG - Intergenic
1075977646 10:126709864-126709886 GTGTAAATATCAATGCCTGAAGG + Intergenic
1076091790 10:127692987-127693009 GTGAATGAATGAATGAATGAAGG - Intergenic
1076348007 10:129793877-129793899 GGGTAAAAAAGAAAGGAGGAGGG - Intergenic
1076578002 10:131483681-131483703 GTGGATGGATGAATGGATGATGG + Intergenic
1077537446 11:3131249-3131271 GTGTATAGATGAGTGGATGGTGG - Intronic
1077891316 11:6419864-6419886 GTGTAAAGATGTAAGGAAGATGG + Intergenic
1077895706 11:6451628-6451650 GTGAGAACATGAAGGGATGAAGG + Intronic
1078120686 11:8505768-8505790 GTGAACAAATGAATGAAGGAAGG + Intronic
1078484494 11:11708929-11708951 CTTTAAAAATAAATGGATGAGGG - Intergenic
1078827937 11:14949686-14949708 GTGTATAAATAAATGCATGAGGG - Intronic
1079367102 11:19819026-19819048 AAGTAAAAATGGATGGAGGAAGG - Intronic
1079398255 11:20084553-20084575 GGGTAAAATTGAATGGGGGAAGG + Intronic
1079594677 11:22227783-22227805 GTTTAAAAGTGAGTGGTTGATGG + Intronic
1079602893 11:22331433-22331455 ATGGATAAATGAATGGAAGAAGG - Intergenic
1079698342 11:23512642-23512664 GTGAAGAAAGGAAGGGATGAGGG + Intergenic
1080311559 11:30898972-30898994 GTGTTAAAGAGAATGGAAGAAGG + Intronic
1080550172 11:33367557-33367579 GTGGATGGATGAATGGATGAAGG - Intergenic
1081060540 11:38469659-38469681 GTGTCAAAATGAATATTTGATGG - Intergenic
1081348067 11:42014878-42014900 GTGTGAAGATGAAGGGATTAGGG - Intergenic
1081850230 11:46270624-46270646 GGAGAAAAATGAATGGATGTAGG - Intergenic
1082746248 11:56966519-56966541 GGGTCAAAATAAAGGGATGAAGG - Intergenic
1084575921 11:69987883-69987905 CTGTAATCATGGATGGATGACGG + Intergenic
1084576524 11:69992156-69992178 GTGGGTAGATGAATGGATGATGG + Intergenic
1085005079 11:73080397-73080419 GTGTAAATATGAATGTATGCAGG - Intronic
1086087806 11:82972515-82972537 GTGAATAAATGGATGGGTGAAGG + Intergenic
1086902819 11:92386871-92386893 GGGAAAAGATGAATGAATGAAGG - Intronic
1089166396 11:116480576-116480598 ATGTATAGATGGATGGATGAAGG + Intergenic
1089227815 11:116940743-116940765 GTGGAGAGATGCATGGATGAAGG - Intronic
1089529000 11:119114389-119114411 GTGTATAAAAGAAGAGATGAGGG - Intronic
1089815470 11:121169617-121169639 GTGTAAAAATCAATGGTTTTTGG + Intronic
1090237171 11:125157951-125157973 GTGAATAAATGAATGGATGAGGG + Intergenic
1091302439 11:134516023-134516045 TTTTAAGAATGAATGAATGATGG + Intergenic
1091767894 12:3133786-3133808 CTGTGAAAATGGATGGATGACGG + Intronic
1091791045 12:3272373-3272395 ATGAATAAATGAATGAATGATGG - Intronic
1093715390 12:22376223-22376245 GTGGCATAATGAATGGAAGATGG + Intronic
1094355590 12:29574194-29574216 GTGAATGAATGAATGGAGGAAGG - Intronic
1095514260 12:42988862-42988884 GTGAAAAAATGAATGATTGATGG - Intergenic
1095691010 12:45088455-45088477 GGGCAAAAAGGAATGGGTGAAGG + Intergenic
1096013607 12:48245700-48245722 GTGTAAAGATGAACTGATAATGG + Intergenic
1096321562 12:50618570-50618592 CTGTAAAAATGAATATATGGTGG + Intronic
1096460090 12:51817567-51817589 GTGAAGAAATGAATGCATGGAGG - Intergenic
1097736095 12:63182744-63182766 ATGTGCAAATGAATGGAGGAGGG + Intergenic
1097757416 12:63422221-63422243 TTGAATAAATGAATGGATTAGGG - Intergenic
1098743771 12:74208495-74208517 GTGTAGAAAGGAATAGAAGAGGG + Intergenic
1098924901 12:76338448-76338470 GTGTAACAAAGACTGGAGGAAGG + Intergenic
1099096762 12:78383793-78383815 TTGTGAAGATGAATGGAAGAAGG + Intergenic
1099395655 12:82135268-82135290 GTGTATAAATGAGTGAATGAAGG - Intergenic
1099984899 12:89650831-89650853 GTGTAAAAATATAAGGATCAAGG + Intronic
1100056788 12:90521578-90521600 ATTTAGAAATGAATGGAAGAAGG + Intergenic
1101130717 12:101688550-101688572 TTCTAAAAATGAATGGTTAAGGG - Intergenic
1101657955 12:106740558-106740580 ATGAACAAATGAATGAATGAGGG - Intronic
1101801097 12:108022528-108022550 GTAGATGAATGAATGGATGATGG - Intergenic
1102452729 12:113053843-113053865 GTGTATGGATGAATGGATGATGG + Intergenic
1102755829 12:115339445-115339467 GGGAAAAAATGAAGGGATGTGGG - Intergenic
1102777611 12:115534142-115534164 TTGTTAAAAGGAATGAATGAAGG + Intergenic
1102959261 12:117081560-117081582 GTATAAAGATGAACAGATGAGGG + Intronic
1103160733 12:118727106-118727128 TTGTAAAAATGAGAGGAAGAGGG - Intergenic
1103188812 12:118982909-118982931 GTTTAAGAATGAAGGGAAGAAGG + Intronic
1103189806 12:118991636-118991658 GTGTGAAAGTGATTCGATGAGGG - Intronic
1103190328 12:118995829-118995851 GTGGATAAATAAATGGATGCAGG - Intronic
1103982480 12:124745728-124745750 GTGAAAGAATGAATGAAGGAAGG + Intergenic
1104546162 12:129714748-129714770 TTTTAGAAATGAATGGATAAAGG + Intronic
1104778648 12:131405544-131405566 GTGGATAGATGTATGGATGATGG - Intergenic
1105059811 12:133138836-133138858 GTGTAAAAAGGGATGAATAAAGG + Intronic
1105283087 13:18980983-18981005 GAGTAATAATGGATGGATGATGG + Intergenic
1105534780 13:21255506-21255528 GTCTAACAATGAATGAATGAGGG + Intergenic
1105538164 13:21289299-21289321 GTGTCAACATGACTGGATTAAGG + Intergenic
1105786535 13:23755323-23755345 CTGAATAAATGAATGGCTGAAGG + Intronic
1105786537 13:23755363-23755385 CTGAATAAATGAATGGCTGAAGG + Intronic
1106093125 13:26616956-26616978 ATGTAAAAATCAAGGGATGTTGG - Intronic
1106153989 13:27135191-27135213 GTGGAAAAATCAATAGCTGAAGG + Intronic
1106745736 13:32704468-32704490 GTGTAAAAAGGACTGGGTCAAGG - Intronic
1107306352 13:39024328-39024350 GTGAGAGAGTGAATGGATGAGGG - Intronic
1107894974 13:44952558-44952580 GTTTAAAAAAGAAGGGAGGAGGG - Intronic
1108165693 13:47690622-47690644 TTGTCAAAATGGATGGATAATGG + Intergenic
1108770782 13:53698378-53698400 GTGTAAAAATATATAGAAGAAGG + Intergenic
1108811939 13:54237397-54237419 GTATTAAAATGAAAGAATGAAGG - Intergenic
1108983874 13:56557749-56557771 GTGTCAATGTGATTGGATGAAGG - Intergenic
1109427242 13:62180944-62180966 ATGTAAAAATAAATGAATAAGGG + Intergenic
1109526721 13:63585277-63585299 GTGTAATAATGAATGAATCAAGG - Intergenic
1110419594 13:75291143-75291165 GGGTACAATAGAATGGATGAGGG - Intronic
1110863040 13:80365289-80365311 GTGTTAAAATGATCTGATGATGG - Intergenic
1110897709 13:80776143-80776165 GTGTTTAAATGAATGGAGAATGG - Intergenic
1111223365 13:85236571-85236593 GTGTCAAATTGACTGGATCATGG + Intergenic
1112218207 13:97458414-97458436 GTGAATAAATGAAGGGAAGAAGG + Intronic
1112885050 13:104159736-104159758 GTGAACAAGTGAATGAATGAAGG - Intergenic
1112890925 13:104230369-104230391 GTTTGAAAATGAGTGGATTAAGG + Intergenic
1113257916 13:108528012-108528034 GTGTCAAAATGAATGGAATCAGG - Intergenic
1114599844 14:23945740-23945762 GGCTCAAAATGAAGGGATGAAGG + Intergenic
1114831790 14:26152345-26152367 TTGTAAACATGAATGAATGCAGG - Intergenic
1114966644 14:27969467-27969489 GGTTCAAAATAAATGGATGAAGG + Intergenic
1115784181 14:36805696-36805718 GTTTGAAAATTAAAGGATGAAGG - Intronic
1116477224 14:45354535-45354557 TTGTATAAATGAATGGACAAAGG + Intergenic
1116549020 14:46210495-46210517 GTCTGAAAATGAAAGAATGAGGG - Intergenic
1116734816 14:48675781-48675803 ATGTAAAAATTAATTCATGATGG + Intergenic
1116744099 14:48794747-48794769 GGCTCAAAATAAATGGATGAAGG + Intergenic
1116838439 14:49794687-49794709 GTATAAAAATGAGGGGATTATGG - Intronic
1117012307 14:51483397-51483419 GTTCAAAAATGAATGGGGGATGG + Intergenic
1117079089 14:52133008-52133030 GTGCAAAGATGAATGTATGTTGG + Intergenic
1117410110 14:55442510-55442532 CAGTAAAACTGGATGGATGAAGG + Intronic
1118432464 14:65733730-65733752 GTGTAGAAATGGATGGATTCTGG - Intronic
1118515856 14:66528324-66528346 GGCTAAAAATAAAGGGATGAAGG - Intronic
1118567141 14:67153783-67153805 GAAGAAAAATGAATGGATGAAGG - Intronic
1118906300 14:70026110-70026132 GTGAAGGAATGAATGGATGGGGG + Intronic
1119901332 14:78262454-78262476 GGGTAAAAATGAAGGGCTGCTGG + Intronic
1120464244 14:84835852-84835874 GAAGAAATATGAATGGATGATGG + Intergenic
1120762464 14:88297843-88297865 GCATGAAAATGAATGGATGTGGG + Intronic
1121449357 14:93997612-93997634 GTGAATAAATGCATGGATGGGGG + Intergenic
1122109083 14:99482431-99482453 ATGAAAGAATGGATGGATGATGG + Intronic
1122320986 14:100855641-100855663 GTGAATGAATGAAGGGATGAAGG - Intergenic
1124384227 15:29193169-29193191 GTGTCAACTTGACTGGATGAAGG + Intronic
1125173095 15:36789481-36789503 GTTAAAAAATTAATGGGTGAAGG + Intronic
1125779570 15:42252382-42252404 CTGTAAAAATGAATGGGAGCTGG - Intronic
1126318034 15:47391855-47391877 GTGTAAATATGAATAGCTGGTGG - Intronic
1127168241 15:56270509-56270531 GTGTCAAAATAAAAGGATGGAGG - Intronic
1127652925 15:61026707-61026729 GTTTAAACAGGAATAGATGAAGG + Intronic
1128265211 15:66260117-66260139 ATGGATGAATGAATGGATGATGG + Intergenic
1129112924 15:73348481-73348503 GTGTAAAAATGGATGCATGTAGG - Intronic
1130070529 15:80643347-80643369 GTGTAAAAGTGAAGGGATGTTGG - Intergenic
1130353625 15:83111358-83111380 GTGAATAGATGGATGGATGATGG - Intronic
1130376954 15:83337826-83337848 ATGAATAAATGAATAGATGAAGG + Intergenic
1130384954 15:83403076-83403098 GTCAAAATATGAATGGATAATGG + Intergenic
1131577279 15:93604548-93604570 GTGTAAAAATGAATGGAGACTGG - Intergenic
1132183963 15:99787577-99787599 TTTTAAAAATGAGTGAATGAAGG + Intergenic
1132233683 15:100203270-100203292 GGGTAAAAATGAAGGGGTGTGGG + Intronic
1132395839 15:101473619-101473641 GTGCTAAAATGAATGGTTGTAGG + Intronic
1133204914 16:4227449-4227471 GTGGATAAGTGAATGGATGATGG + Intronic
1133563022 16:6967216-6967238 ATGTATAAACAAATGGATGATGG - Intronic
1134106039 16:11486601-11486623 GTGGTTAGATGAATGGATGATGG + Intronic
1134106134 16:11486915-11486937 GTGGTAGGATGAATGGATGATGG + Intronic
1134345765 16:13389932-13389954 GTGGAAAAAAGAATGGAGAATGG - Intergenic
1135538601 16:23313141-23313163 ATGAATAAATGAATGAATGATGG + Intronic
1137386160 16:48044276-48044298 GTATATCAATGAATGGATGATGG - Intergenic
1137386165 16:48044316-48044338 GTGGATCAATGGATGGATGATGG - Intergenic
1137397974 16:48130360-48130382 GTGAATAAATGAATGAATAAAGG + Intronic
1137569442 16:49555752-49555774 GTGAATAAATAAATGGATGGAGG + Intronic
1137748823 16:50842978-50843000 ATGAATAAATGAATGAATGAAGG + Intergenic
1137956107 16:52831531-52831553 TTGTAAAAATGGAAGGAGGAAGG + Intergenic
1138231584 16:55341137-55341159 TTGAAAAAGTGAATGGATGCGGG + Intergenic
1138572145 16:57882479-57882501 GTGGAAAAATGAAAGAATGTGGG - Exonic
1139176666 16:64697826-64697848 ATATATAAATGAATGGATGGGGG + Intergenic
1139736325 16:68991991-68992013 GTTTAAAAAAAAAAGGATGATGG - Intronic
1139982146 16:70868481-70868503 GTGAAAAAAGGAAATGATGAGGG + Intronic
1139982664 16:70872529-70872551 GTGGATGGATGAATGGATGATGG - Intronic
1140329578 16:74041060-74041082 GTATAATAATGAATGGATGAGGG - Intergenic
1140540395 16:75751598-75751620 GTGTCAACTTGACTGGATGAAGG + Intronic
1140678930 16:77364671-77364693 GGGTAGAAATAAATGGATAATGG + Intronic
1140970831 16:80010625-80010647 GTGAATAAAGGAATGGATGGTGG - Intergenic
1141031992 16:80597079-80597101 GTGGATAGATGGATGGATGATGG + Intergenic
1141377663 16:83546918-83546940 ATGCAGAAATGAATGAATGAAGG + Intronic
1141854739 16:86673408-86673430 CTGCACAAATGAATGAATGAAGG - Intergenic
1141854759 16:86673523-86673545 GTGGATGGATGAATGGATGAAGG - Intergenic
1143656437 17:8296412-8296434 GTGCAAAAAAAAATGGATGGGGG - Intergenic
1143766328 17:9139945-9139967 ATGGATGAATGAATGGATGATGG - Intronic
1144839492 17:18177018-18177040 GTGGATAGATGGATGGATGAAGG + Intronic
1146489233 17:33268319-33268341 ATGGAAAGATGGATGGATGATGG - Intronic
1146545047 17:33731072-33731094 GTGAATGAGTGAATGGATGAGGG + Intronic
1147844504 17:43395270-43395292 GTGAATTAATGAATGCATGATGG - Intergenic
1148235987 17:45969479-45969501 ATGTATAATTGGATGGATGATGG - Intronic
1149382789 17:56110646-56110668 GTGAATGAATGAATGAATGAAGG + Intergenic
1149453737 17:56770531-56770553 GTGTATGAATAGATGGATGATGG - Intergenic
1149454349 17:56775768-56775790 GTGTAAAGGTGAGAGGATGAAGG + Intergenic
1149512228 17:57253416-57253438 GTGGATGAATGAATGAATGATGG - Intergenic
1149615762 17:57996744-57996766 GTGTTAAAATGTATGGATGCTGG + Intronic
1149811084 17:59672878-59672900 GTGTATAAATGAATTCCTGATGG + Intronic
1150206510 17:63412623-63412645 GAGGAAAAAAAAATGGATGAAGG - Intronic
1150439050 17:65176973-65176995 GTGTACGAATGGATGGAGGAAGG - Intronic
1150631426 17:66883050-66883072 ATGGAAGAATGGATGGATGATGG - Intronic
1151411844 17:73935905-73935927 GTGTATAAGTGAATGCATGTGGG - Intergenic
1152057775 17:78044850-78044872 CTGTTACAATGAATGTATGAGGG + Intronic
1152301846 17:79499469-79499491 GTGGATGAATGAATGGATGGTGG - Intronic
1152345137 17:79746895-79746917 ATGGATAAATGAATGCATGAGGG + Intergenic
1152581493 17:81167331-81167353 GTGAATGAATGAGTGGATGAGGG - Intergenic
1153203098 18:2666587-2666609 GTGTCAACATGAATGGAGAATGG - Intronic
1154475838 18:14756560-14756582 GTGTAAAAATTAATTCAGGATGG - Intronic
1155323689 18:24644588-24644610 GTGTACAAATGAAGGGAGGGTGG + Intergenic
1155822876 18:30400196-30400218 CTATAAAAATCAATGGATTATGG - Intergenic
1156379570 18:36545476-36545498 ATGTAAAAAGCAATGGATTAAGG + Intronic
1156517938 18:37696840-37696862 GTGTACAAATAAATCCATGATGG - Intergenic
1156757422 18:40545140-40545162 CTGAAAAAATGAATGCCTGAAGG + Intergenic
1157007686 18:43605318-43605340 AGGTTAAAATAAATGGATGAAGG - Intergenic
1157459542 18:47875804-47875826 GTGTAAGACTAAATGGATTAGGG + Intronic
1158823043 18:61183273-61183295 GTGTAAAAATAAATTTCTGAGGG - Intergenic
1159141658 18:64403143-64403165 GGGGAAATATGAATGAATGAAGG + Intergenic
1159182843 18:64931469-64931491 GTGTACACATGAAGTGATGAAGG - Intergenic
1159210448 18:65314503-65314525 ATGAAAAGATGAATGGATAAAGG + Intergenic
1159282620 18:66306442-66306464 ATGGAAAAATGACAGGATGAAGG + Intergenic
1160280641 18:77486641-77486663 ATGTACAAATGAGTGAATGATGG - Intergenic
1160502508 18:79409228-79409250 GAGGAATAATGGATGGATGATGG - Intronic
1160502534 18:79409374-79409396 GAGGAATAATGGATGGATGATGG - Intronic
1160502561 18:79409525-79409547 GTGGATGAATGGATGGATGATGG - Intronic
1161433846 19:4250276-4250298 ATGAATAAATGAATGAATGAGGG - Intronic
1161934620 19:7364035-7364057 ATGGATAAATGAATGAATGAAGG + Intronic
1161934658 19:7364264-7364286 ATGGATAAATGAAAGGATGAAGG + Intronic
1162488320 19:10975974-10975996 GTGGAAAAAGCAAAGGATGAGGG - Intronic
1162649043 19:12071446-12071468 GTGTAAAATTCAATGAATGCTGG + Intronic
1162777492 19:12988756-12988778 GTGTAAAAATGAAGGAGAGATGG + Intergenic
1163380457 19:16963322-16963344 GTCTCAAAATAAATGGATGGAGG + Intronic
1163383546 19:16985272-16985294 GTGGATGAATGGATGGATGAAGG + Intronic
1164637921 19:29805140-29805162 GTGCATGGATGAATGGATGAGGG - Intergenic
925978373 2:9156734-9156756 GTGGAAGGATGGATGGATGATGG + Intergenic
926159433 2:10477308-10477330 TTGAAGAGATGAATGGATGAAGG - Intergenic
927806064 2:26147850-26147872 GTGAATGAATGAATGCATGAAGG + Intergenic
928394172 2:30931433-30931455 GAGGAAAAAAGAGTGGATGAAGG + Intronic
928887172 2:36163107-36163129 GTTTTAAAATGATGGGATGAAGG - Intergenic
928925514 2:36575087-36575109 AGGAAAAAATGAATAGATGATGG - Intronic
930010447 2:46934037-46934059 GTATAAGAATGATTTGATGAAGG + Intronic
930399500 2:50865076-50865098 GGAGAAAAATGAATGGATGAAGG + Intronic
931037101 2:58255822-58255844 GTTAAAAAATAAATGGAAGAAGG - Intergenic
931783362 2:65599815-65599837 CTGAAAGAATGAATAGATGAAGG - Intergenic
932638059 2:73410493-73410515 GTATCAAAATGACTGGATCATGG - Intronic
932907021 2:75765177-75765199 GTCAATAAATGACTGGATGACGG + Intergenic
932963873 2:76447422-76447444 GTGTAAAAAAGAAAGGAGGGAGG - Intergenic
933569892 2:83997789-83997811 GTTTTATAATGAATGGGTGAAGG - Intergenic
935136476 2:100307884-100307906 TTTTAAAGAAGAATGGATGAAGG + Intronic
935954832 2:108365620-108365642 GGGTAAAAAGTAATGGATGCTGG - Intergenic
937049668 2:118878301-118878323 GTGAAGGAATGAATGAATGATGG + Intergenic
938304596 2:130243471-130243493 TTGAAAAAAGGAAGGGATGAAGG + Intergenic
938615896 2:132998092-132998114 GTTTAAAAATGAATGCAATAAGG - Intronic
939363059 2:141198632-141198654 GTGTAAAAGTGAGTGGAAGGAGG - Intronic
939514654 2:143151583-143151605 AGGTAAGAAAGAATGGATGATGG + Intronic
940076096 2:149743764-149743786 GTGAAAAAAAGAAGGGATGGTGG + Intergenic
940456093 2:153902604-153902626 GGATAAGAATGAAGGGATGAGGG + Intronic
941458475 2:165737692-165737714 GTTAAAAAATCAATGGATGCGGG - Intergenic
943164420 2:184301357-184301379 TTGAAGAAATGAATGAATGAAGG + Intergenic
943359414 2:186899973-186899995 GGCTCAAAATGAAGGGATGAAGG - Intergenic
943688035 2:190840068-190840090 AGGTAAGAAAGAATGGATGAAGG + Intergenic
943949426 2:194111770-194111792 ATGTTAAAATGAATGCATAATGG - Intergenic
944404815 2:199371947-199371969 CTGTGAAAAAGAAAGGATGAGGG + Intronic
944789351 2:203108725-203108747 GTGTAAAAGTGAAAGGAAAAAGG + Intronic
945889028 2:215408936-215408958 TTGGAAAAATGAAAGGAAGAAGG - Intronic
945992285 2:216406110-216406132 ATATAAGAATCAATGGATGAAGG + Intergenic
946219765 2:218216721-218216743 TTGGAGAAATGAATGCATGATGG + Intergenic
946349650 2:219141546-219141568 TTAGAAAACTGAATGGATGATGG + Intronic
947075517 2:226340243-226340265 GTGTCAACTTGAATGGATAAAGG + Intergenic
947704479 2:232263124-232263146 GTGTATGGATGAATGGCTGAAGG + Intronic
948626264 2:239270235-239270257 GTGTAAAAATGAATGGATGACGG + Intronic
1169294270 20:4379449-4379471 ATGTAAAAATGAAAGGAAAAAGG - Intergenic
1170203537 20:13770999-13771021 TTTTAAAAATGCATGGAGGAAGG - Intronic
1171046999 20:21818224-21818246 GTGGAAAAATAAATGGAACAAGG + Intergenic
1172184908 20:33025436-33025458 ATGGATGAATGAATGGATGATGG - Intergenic
1173080639 20:39863672-39863694 GTTTAAGAATAAAGGGATGAGGG + Intergenic
1173465899 20:43281119-43281141 GTGTATAGATGAATGATTGAGGG - Intergenic
1174577323 20:51545728-51545750 ATGGAAGAATGGATGGATGATGG + Intronic
1175063802 20:56268091-56268113 TTGAATGAATGAATGGATGAAGG - Intergenic
1176047150 20:63098702-63098724 ATGGATAAATGAATGGATGATGG + Intergenic
1177351039 21:19942036-19942058 GTGTCAGGATGAATGAATGAGGG - Intergenic
1177392956 21:20499894-20499916 ATTTAAAAATTAATGCATGATGG - Intergenic
1177820831 21:26029274-26029296 GGGAAAACATGAATGGATGCTGG + Intronic
1178725800 21:35050657-35050679 GTGTGAAATTAAGTGGATGAGGG - Intronic
1178776479 21:35556108-35556130 GTGTAATAGAGAATGGATAATGG - Intronic
1179129987 21:38627167-38627189 GTCTAAAAATGAATGTCTTAAGG + Intronic
1179357754 21:40677106-40677128 GTTTGAAAATGACTTGATGAAGG + Intronic
1179474765 21:41636110-41636132 GTGGATGAATGGATGGATGATGG - Intergenic
1179644134 21:42765230-42765252 GTGGACAAATGGATGGGTGATGG + Intronic
1180025128 21:45156476-45156498 GTGGATGGATGAATGGATGATGG - Intronic
1181042606 22:20199348-20199370 GTGTTTAGATGAATGGATGGTGG - Intergenic
1182383570 22:29915412-29915434 ATGAACAAATGAATGAATGAAGG - Intronic
1182579860 22:31300423-31300445 GGCTAAAAATGTATGGATTATGG + Intergenic
1182723405 22:32422999-32423021 GTGGATAAATGAGCGGATGAAGG + Intronic
1183270000 22:36855953-36855975 GTGAATAAATGAATGAATGAGGG + Intergenic
1183902684 22:41018381-41018403 GTGAATGAATGAATGAATGAAGG - Intergenic
1184172641 22:42768920-42768942 GTGAGAACCTGAATGGATGAGGG + Intergenic
1184315520 22:43685230-43685252 GTGTCAACTTGACTGGATGAAGG + Intronic
1184321289 22:43743991-43744013 ATGGATGAATGAATGGATGAAGG + Intronic
1185193492 22:49453432-49453454 GTGAATGAGTGAATGGATGATGG + Intronic
949663344 3:6307524-6307546 GTCTATAAATGGATGCATGAGGG - Intergenic
949916117 3:8965894-8965916 TTGTTAAAATGAATGGAGGAAGG - Intergenic
950574019 3:13820273-13820295 ATGAAAGAATGAATGGAGGAAGG + Intronic
950807696 3:15621252-15621274 GTGTCAACTTGAATGGATTAAGG - Intronic
951048076 3:18063444-18063466 TTGAATAAATGAATGAATGATGG - Intronic
951282183 3:20765162-20765184 GTGTAAGAATGAATGAATTGTGG - Intergenic
951635149 3:24766212-24766234 GTGGAAGAAAGAATTGATGATGG - Intergenic
952494008 3:33900346-33900368 CTGAAAAAATGAATGAATGAGGG + Intergenic
953772048 3:45785249-45785271 GTGTCAAATTGATTGGATAAAGG + Intronic
953888476 3:46733548-46733570 GTGAATAAAGGAATGAATGAAGG + Intronic
954994125 3:54866202-54866224 GTGAACAAATGAGTGAATGAGGG + Intronic
955587497 3:60496790-60496812 AGGTAAAAATGAAAGAATGAGGG + Intronic
956151447 3:66247311-66247333 ATTTACAAATGAATGAATGATGG + Intronic
956493786 3:69802573-69802595 GGTGAAAAATGAATGGATGGCGG - Intronic
956753152 3:72360815-72360837 ATGTAAAAATGAATGGCTCTTGG + Intergenic
957143306 3:76388769-76388791 ATGGAAAGATGAATGGATGATGG - Intronic
957223584 3:77414724-77414746 GTGAAATAATGAATGCATCATGG - Intronic
957280748 3:78148086-78148108 GTGTACAAATGAATAATTGAGGG + Intergenic
957298055 3:78357208-78357230 GTGTAAAACTGAGTTGATCATGG - Intergenic
957396757 3:79649633-79649655 GTGTCAACTTGAATGGATGAAGG + Intronic
957442986 3:80276002-80276024 GTTTAAAGCTAAATGGATGAAGG + Intergenic
957480452 3:80786409-80786431 GTGTTAAGATAAATGGAAGAGGG - Intergenic
957602794 3:82359649-82359671 GTGTAAAATTGAAGGGATGGTGG - Intergenic
959231265 3:103654986-103655008 GATTGAAAAAGAATGGATGATGG + Intergenic
960476567 3:118137386-118137408 GAGAAAAAAGGAATGGATAATGG - Intergenic
960804275 3:121567817-121567839 ATGAACAAATGAATGAATGAAGG + Intergenic
961554263 3:127687336-127687358 GTGAGAAAATGAATGAGTGAGGG - Intergenic
961554308 3:127687796-127687818 GTGAGAAAATGAATGCATGATGG - Intergenic
962396569 3:135019657-135019679 ATGTAATATTCAATGGATGAAGG - Intronic
962468451 3:135683134-135683156 GTCAAAAAATAAATAGATGATGG + Intergenic
962511142 3:136101832-136101854 GTGGAAAAATAAAGGGAAGAAGG + Intronic
963059815 3:141216309-141216331 ATGAATGAATGAATGGATGATGG + Intergenic
964642994 3:158929725-158929747 GTGTAAAAATAATTGGATGCTGG + Intergenic
964653591 3:159041357-159041379 GTGAAAAGATGTAGGGATGAGGG + Intronic
965624281 3:170671576-170671598 GTGAATAAATGAATGGACTAAGG + Intronic
967156649 3:186698473-186698495 GTGTGAACTTGATTGGATGAAGG - Intergenic
967528367 3:190520241-190520263 GGGCAAAATTGAACGGATGATGG + Intronic
968003487 3:195223858-195223880 ATGTAAAAATGAATTGCTGCCGG + Intronic
968610507 4:1554737-1554759 GGGCATAAATAAATGGATGACGG - Intergenic
968914205 4:3490085-3490107 GTGAAGAAAGGAATGAATGAGGG - Intronic
969185335 4:5470234-5470256 GTGTAAATGGGAATTGATGAGGG + Intronic
969424831 4:7118103-7118125 GTGGATAGATGCATGGATGATGG + Intergenic
969424879 4:7118333-7118355 ATGGATAAATGCATGGATGATGG + Intergenic
969424915 4:7118515-7118537 ATGGATAAATGCATGGATGATGG + Intergenic
969424958 4:7118718-7118740 ATGGATAAATGCATGGATGATGG + Intergenic
969612280 4:8234121-8234143 ATGGATAAATGGATGGATGATGG - Intronic
970263026 4:14249477-14249499 GTGAATAAATGAAAGAATGAAGG + Intergenic
970564693 4:17320390-17320412 GTGGAAAAAGGAATACATGAAGG + Intergenic
970700639 4:18733759-18733781 CTGTGAAAATGACTGAATGATGG - Intergenic
970867558 4:20776878-20776900 GGGTAATTATGAATAGATGAAGG + Intronic
971769237 4:30874980-30875002 CTGTAACAATAAATGGGTGAAGG - Intronic
971964963 4:33541919-33541941 GTGTAAGAAGGAAAGGAGGAAGG + Intergenic
973770986 4:54206220-54206242 GTGAATGAATGAATGAATGAAGG + Intronic
974268750 4:59621757-59621779 ATGTAAAAACGACTGAATGATGG + Intergenic
974272067 4:59662738-59662760 ATGCAACCATGAATGGATGATGG - Intergenic
974693046 4:65325916-65325938 TTGTAAAAATGAAGGGCTGGTGG - Intronic
974800584 4:66812450-66812472 ATGTAAACATGACTGGATTAAGG - Intergenic
975098560 4:70486035-70486057 GTGTCAAATTGACTGGATGGAGG - Intergenic
975364763 4:73516693-73516715 GTCTCAAAATAAAGGGATGAAGG - Intergenic
975832582 4:78385396-78385418 GTCCAAAAATGAAAGGATCATGG + Intronic
976253804 4:83080197-83080219 GTGTCAACTTGAATGGATTAAGG + Intergenic
976418235 4:84804542-84804564 GTGAAAACATGAATGGGTAAAGG - Intronic
977162036 4:93646857-93646879 CTGAACAAATAAATGGATGATGG + Intronic
977559673 4:98519531-98519553 GGAAAAAAATGAATGGATGAAGG + Intronic
977896403 4:102370293-102370315 GTGTTAACTTGAATGGATTAAGG - Intronic
977900833 4:102420568-102420590 TTCAATAAATGAATGGATGAGGG + Intronic
978220392 4:106265885-106265907 GTGTAAAAAAGAAGCAATGAGGG + Intronic
978671726 4:111256120-111256142 ATATAAAAATGAATGGGTGAAGG + Intergenic
978967315 4:114756506-114756528 GTTTAAAAATGTATGCAAGAAGG - Intergenic
979116566 4:116831537-116831559 GTCTCAAAATAAAAGGATGAAGG + Intergenic
979971000 4:127135177-127135199 ATGGATGAATGAATGGATGAAGG + Intergenic
980171062 4:129290935-129290957 GGCTAAAAATAAAGGGATGAAGG - Intergenic
980383686 4:132059374-132059396 GTGTAAAAATGAATTAATACAGG + Intergenic
980478885 4:133358610-133358632 CTGTAAAAAATAATGGAAGATGG + Intergenic
980666283 4:135940609-135940631 GTGTAAACATGAATATATGTAGG - Intergenic
981757374 4:148155098-148155120 TTGTAAAAATGAATGAAAGAAGG - Intronic
983706955 4:170673305-170673327 TTGAATAAGTGAATGGATGATGG + Intergenic
983774688 4:171592900-171592922 GGGTCAAAATAAAGGGATGAAGG - Intergenic
983857677 4:172665491-172665513 AAGTAAAAAAGAATTGATGATGG + Intronic
985749274 5:1665097-1665119 GTGAATGAATGAATGAATGAAGG + Intergenic
989514179 5:42322473-42322495 GTGTTCAAATGAAAGGATAAAGG - Intergenic
989831535 5:45925615-45925637 GTCTCAAAATGAATTGATGGAGG - Intergenic
990049850 5:51484185-51484207 GTTTATAAATGGATGCATGAAGG + Intergenic
990084186 5:51954009-51954031 GGCTAAAAATGAAGGGATGGAGG + Intergenic
991534300 5:67649606-67649628 CTTTAAAAAGGGATGGATGAGGG + Intergenic
992304455 5:75421833-75421855 CTGTAGAAAAGAATGCATGAAGG - Intronic
993103741 5:83574308-83574330 GTGTCAACATGACTGGATTAAGG - Intronic
994019802 5:95009884-95009906 GTGTAGAAATGGAAGAATGATGG + Intronic
994448377 5:99907601-99907623 GAGTAAAAATGAATGAGTCAGGG - Intergenic
994699568 5:103116460-103116482 ATGTAAAAATTAATTCATGATGG + Intronic
994960686 5:106598004-106598026 AAGTAAAAAAGAATGGAGGAGGG + Intergenic
996244546 5:121245184-121245206 TTGTCAACATGAATGGATCATGG + Intergenic
996480078 5:123965984-123966006 TTTTATAAATGAATGAATGAAGG - Intergenic
996971624 5:129376225-129376247 ATGTAAAAATGAAAAAATGATGG + Intergenic
997252535 5:132400371-132400393 GTCTCAAAATGAAGGGATGGAGG + Intergenic
997339082 5:133128501-133128523 GTGAAAAGATGAATGAATGAAGG + Intergenic
997386437 5:133476515-133476537 GTGTAAATATTCATGCATGATGG + Intronic
997648797 5:135499545-135499567 TGGTAACAAGGAATGGATGATGG + Intergenic
998027218 5:138828708-138828730 CTGTAAAAGTTAATGGGTGATGG + Intronic
999032403 5:148308396-148308418 ATGTAAAAATAAATGAATGCCGG + Intergenic
999085651 5:148886744-148886766 GTGATAAAATGGATGGATTAGGG + Intergenic
1000008245 5:157207689-157207711 GTGTCAAATTGACTGGATTAAGG - Intronic
1000686509 5:164256061-164256083 TTGAATAAATGAATGAATGAAGG - Intergenic
1001763587 5:174227052-174227074 CAGTAAGAATGAATGGATGTTGG - Intronic
1002046975 5:176547280-176547302 GTTTTAAAATGGATGGATGCTGG + Intronic
1002472294 5:179442768-179442790 GTGGGTGAATGAATGGATGAAGG + Intergenic
1002472321 5:179442930-179442952 GTGGGTGAATGAATGGATGAAGG + Intergenic
1002853727 6:1020022-1020044 GTGTGAAAGAGAATGGGTGAGGG + Intergenic
1002862013 6:1087752-1087774 ATGTTAAAATAAAAGGATGATGG - Intergenic
1003314200 6:4997165-4997187 GTGTCAACCTGACTGGATGAAGG + Intronic
1003351764 6:5324533-5324555 GTGAGAAAATAAAGGGATGATGG - Intronic
1003467475 6:6394579-6394601 GAGTGAAAATGATTGGGTGAAGG + Intergenic
1003971689 6:11306280-11306302 TTGCATGAATGAATGGATGATGG - Intronic
1004796805 6:19095403-19095425 GGGTAGATATGAATGGAGGAAGG - Intergenic
1004889891 6:20090431-20090453 GAGAAAAAATGAAGGGAGGAAGG + Intergenic
1005353829 6:24962880-24962902 GTGGAAAAATGAATGACTCAAGG + Intronic
1005392600 6:25349059-25349081 GTTGAAAAATGAATGAAGGAAGG - Intronic
1005735837 6:28745000-28745022 CTGAAGAAATGAATGGAGGAGGG + Intergenic
1006233313 6:32604361-32604383 GTGACAACAGGAATGGATGATGG + Intergenic
1006338534 6:33433260-33433282 GTGGCTGAATGAATGGATGATGG + Intronic
1007261212 6:40564651-40564673 GTGGAAAACTGATTGGAGGATGG - Intronic
1008097471 6:47353785-47353807 GTGAATAAAGGTATGGATGATGG - Intergenic
1008652341 6:53576175-53576197 AAATAAAAATGAATGAATGATGG - Intronic
1010152576 6:72751797-72751819 GAGTAATAATGAATGAATAAAGG - Intronic
1010651956 6:78466357-78466379 TTGTAAAATTGAATGTATGATGG - Intergenic
1012084430 6:94806407-94806429 GTGTAAAAATAAGTGAATAACGG - Intergenic
1012745056 6:103076490-103076512 AAGTAAAAATGAAGAGATGAAGG - Intergenic
1012777609 6:103517595-103517617 GTGTAAAAGTCAATGCATTAGGG - Intergenic
1012938277 6:105390903-105390925 GTGTAAAAAAGCAGGGCTGAAGG + Intronic
1014601346 6:123417057-123417079 GTGAACAAATGAATTAATGAAGG + Intronic
1015482199 6:133724777-133724799 ATACAAAGATGAATGGATGAGGG + Intergenic
1015608261 6:134984282-134984304 ATAAAAAAATGAATGAATGAAGG - Intronic
1015686960 6:135875640-135875662 AAGTAAAAATGAATTCATGAAGG - Intronic
1016121671 6:140350315-140350337 GTGAATAAATGCATGAATGAAGG - Intergenic
1016229186 6:141781666-141781688 GTGTCAACTTGACTGGATGATGG - Intergenic
1016482887 6:144501185-144501207 GTGAAGAAAGGAATGTATGAGGG + Intronic
1016760854 6:147735194-147735216 GTCTGATAATTAATGGATGATGG + Intronic
1017237807 6:152135601-152135623 GTGAATAAATGAATGAATGAAGG - Intronic
1017337914 6:153283631-153283653 GTTTAAGAATGAATGAGTGAAGG + Intergenic
1017923559 6:158891520-158891542 GTTTAAAAATAAAAGGATGGAGG - Intronic
1018832477 6:167454792-167454814 GTGAAGAAATAAGTGGATGAGGG - Intergenic
1018840287 6:167511586-167511608 GTGCTAAAATCAATGGATGCTGG - Intergenic
1019115792 6:169761161-169761183 GCATAAAAATGAATGAATTAGGG - Intronic
1019567286 7:1690608-1690630 ATGGATAAATGGATGGATGAAGG + Intronic
1020174703 7:5872898-5872920 ATGTGAAAAAAAATGGATGATGG + Intergenic
1021262286 7:18472922-18472944 TTGTAAAAATGAATGAATTAAGG + Intronic
1022312458 7:29209928-29209950 GCGTAAAGATCACTGGATGAGGG + Intronic
1023333626 7:39145819-39145841 AAGTAAAAATGAATAGAGGATGG - Intronic
1024298192 7:47863119-47863141 CTTTATAAGTGAATGGATGAGGG + Intronic
1025196131 7:56935315-56935337 GTTCAAACTTGAATGGATGAGGG + Intergenic
1025675816 7:63641619-63641641 GTTCAAACTTGAATGGATGAGGG - Intergenic
1026275203 7:68870310-68870332 ATGGAAAGATGGATGGATGATGG + Intergenic
1027518486 7:79172105-79172127 GTGTAAGAAGGAAGGGAAGAGGG + Intronic
1028366192 7:90035631-90035653 GTGTATAAATGAAAAGAAGATGG + Intergenic
1029648073 7:101870588-101870610 GTCTAGAAATTAATGGATGAGGG + Intronic
1031282582 7:119822316-119822338 GTATAAAAGTTAATAGATGAAGG + Intergenic
1031648041 7:124251660-124251682 TTGGAAAAATTAATGAATGAAGG + Intergenic
1031755949 7:125643038-125643060 GTAGCAAAATGAATGAATGAAGG - Intergenic
1032381617 7:131489680-131489702 CTGTAAAAATAAATGGTGGAGGG - Exonic
1032531822 7:132627196-132627218 ATGTAAAAATAAATGGCAGAAGG - Intronic
1032686002 7:134234404-134234426 GAGTAAAAGTGAATGGACAAAGG + Intronic
1033850519 7:145488899-145488921 GAGCAAAAAGGAAAGGATGAAGG + Intergenic
1036724621 8:11208771-11208793 GTGTACAAATCAATGGACCAGGG - Intergenic
1036958623 8:13218116-13218138 GTTTCAAAATCAATGGGTGATGG + Intronic
1037841400 8:22247834-22247856 CTGGAAAAAAGAATGGATTAAGG - Intronic
1037973379 8:23191181-23191203 GTGTTAATTTGAATGGATTAAGG - Exonic
1038182045 8:25238445-25238467 GAGTTAGAATGAATAGATGACGG + Intronic
1038240011 8:25799662-25799684 TTTTGAAAATGATTGGATGAAGG - Intergenic
1038325133 8:26567254-26567276 GTGGATAAATGAATGGGTGGTGG - Intronic
1038330253 8:26602647-26602669 ATGAATAAATGAACGGATGAAGG - Intronic
1038395047 8:27240404-27240426 GTGAATGAATGAATGAATGATGG - Intronic
1038705808 8:29892787-29892809 ATCTAAAAAGGAATGGATAAGGG - Intergenic
1039322980 8:36453142-36453164 GAGTAGACATGAATGGATCAAGG - Intergenic
1040613467 8:49010186-49010208 ATATAAAAATGAATGATTGAAGG - Intergenic
1040673811 8:49725072-49725094 TTGAACAAATGAATGGACGATGG + Intergenic
1040898963 8:52397300-52397322 ATGTAAAAATAAATGAGTGAAGG - Intronic
1041841068 8:62272100-62272122 TTGTACAAATGAATAAATGAGGG + Intronic
1042978114 8:74493468-74493490 GTGCAAAAACAACTGGATGATGG + Intergenic
1043109343 8:76158900-76158922 ATGTATCAATGAATAGATGATGG - Intergenic
1044236293 8:89834530-89834552 GTTTATAAATGAATGGATAAAGG + Intergenic
1045323418 8:101098980-101099002 ATAAGAAAATGAATGGATGAGGG - Intergenic
1046735749 8:117775154-117775176 GGCTCAAAATAAATGGATGAAGG + Intergenic
1047306949 8:123660060-123660082 ATGTACAGATGAATGGATGATGG - Intergenic
1047382504 8:124376340-124376362 TCCTAAATATGAATGGATGAAGG + Intergenic
1047663236 8:127061692-127061714 GTTTAAAAATGGATGGATATGGG + Intergenic
1047703913 8:127478431-127478453 GTGAATAAATGAATGAATAATGG - Intergenic
1047821532 8:128526451-128526473 CTATATGAATGAATGGATGAGGG - Intergenic
1048299760 8:133242848-133242870 GAAGAAGAATGAATGGATGATGG + Intronic
1048598224 8:135889550-135889572 GTGAATAAATGAATGAATGGAGG + Intergenic
1049274587 8:141713484-141713506 GTGGATAAATGAATACATGAAGG - Intergenic
1049303738 8:141885954-141885976 GGGGAATGATGAATGGATGAGGG + Intergenic
1050419490 9:5448598-5448620 ATGGGAAAATGAATGGCTGAAGG + Intergenic
1050799024 9:9585658-9585680 CTTGAAAAATGATTGGATGAAGG - Intronic
1050836508 9:10086703-10086725 ATATAATAATGAATGGATTAGGG - Intronic
1050894075 9:10863528-10863550 GGGTAAAAAGTAAAGGATGAAGG + Intergenic
1051666706 9:19472887-19472909 GTGTCAAATTGGCTGGATGATGG + Intergenic
1052269089 9:26607688-26607710 CTGTAAAAATGCTTGGATAAGGG + Intergenic
1052636458 9:31112302-31112324 AGGAAAAAATGAATGGAGGAAGG - Intergenic
1052708957 9:32029101-32029123 GTGAAGAAATGAATGGTTGTGGG - Intergenic
1055326566 9:75136690-75136712 ACCTAAAAATGAATGGATAAGGG - Intronic
1057821622 9:98335837-98335859 GTGCATGAATGAATGGATGATGG - Intronic
1058148969 9:101443295-101443317 GTGTAAAAAGGAATGAAGGAGGG + Intergenic
1059252245 9:112895855-112895877 GTGGACAGATGAATGGATGATGG - Intergenic
1059409075 9:114120756-114120778 ATGGATAGATGAATGGATGATGG + Intergenic
1059409101 9:114120926-114120948 ATAAATAAATGAATGGATGATGG + Intergenic
1059834480 9:118135745-118135767 GTGAAAAAATGATGGAATGAGGG - Intergenic
1060748347 9:126152477-126152499 GTGAAATCATGAATGGAAGATGG - Intergenic
1060748595 9:126154149-126154171 GTGGAAGGATGGATGGATGAAGG + Intergenic
1061078154 9:128354242-128354264 ATATGAAAATGAATGAATGAGGG - Intronic
1061244648 9:129395190-129395212 ATGAAAAAATGGATGGAGGATGG + Intergenic
1061950695 9:133934369-133934391 GTGTCAACTTGACTGGATGAAGG + Intronic
1062172221 9:135141217-135141239 GTGGATGGATGAATGGATGATGG + Intergenic
1062205470 9:135334385-135334407 TTGGATAAATGGATGGATGATGG + Intergenic
1062205489 9:135334505-135334527 TTGGATAAATGGATGGATGATGG + Intergenic
1062520725 9:136956815-136956837 ATGGATAAATGGATGGATGAAGG + Intronic
1185497296 X:565277-565299 GTGGACAAATGGATGGATGATGG + Intergenic
1185497532 X:566589-566611 ATGGATAAATGGATGGATGATGG + Intergenic
1185503923 X:618712-618734 ATGAAGGAATGAATGGATGAAGG + Intergenic
1185611452 X:1395783-1395805 ATGTATAGATGGATGGATGATGG + Intergenic
1185632783 X:1527655-1527677 GTGGATGAATGAATGAATGAAGG - Intronic
1185876639 X:3707264-3707286 ATAAATAAATGAATGGATGATGG - Intronic
1186206113 X:7202657-7202679 GTGTCAAATTGACTGGATTAAGG + Intergenic
1186902877 X:14076876-14076898 GAGAAAACATAAATGGATGATGG - Intergenic
1187039468 X:15578614-15578636 GCGTAAAAATGAGTGAATGTAGG + Intronic
1187296391 X:18005334-18005356 GTGTAAAATTTACTGGAAGATGG + Intergenic
1189871028 X:45382820-45382842 GTGTTAAAAAGGATGGAAGATGG - Intergenic
1190303391 X:49068914-49068936 CTGTAAACATAAATGGAGGAAGG - Intronic
1193336597 X:80297037-80297059 GTGGAAGAATAAATGGATTATGG + Intergenic
1195312096 X:103641633-103641655 GTGAAAAAGTGAATGGGTGGAGG + Intergenic
1196920965 X:120584813-120584835 CTGTAAAAAGTATTGGATGAGGG + Intergenic
1196921023 X:120585293-120585315 TTGTGCAAATGGATGGATGATGG + Intergenic
1197948600 X:131869641-131869663 GTTTGAAAATGAATGAAGGAAGG - Intergenic
1198229932 X:134679190-134679212 ATGCAAGAATGAATGAATGAAGG + Intronic
1198604977 X:138327353-138327375 GTGGTAAAATGACTTGATGATGG + Intergenic
1198681623 X:139189007-139189029 GGGCAAAAATGCAAGGATGAAGG + Intronic
1200174438 X:154103054-154103076 GTTTAAAAGAGAATGGAAGAAGG - Intergenic
1200788722 Y:7281139-7281161 ATAAATAAATGAATGGATGATGG + Intergenic
1201446402 Y:14060958-14060980 TTTTTAAAATGACTGGATGAGGG - Intergenic
1201586288 Y:15564610-15564632 GAGAATCAATGAATGGATGAGGG - Intergenic