ID: 948627224

View in Genome Browser
Species Human (GRCh38)
Location 2:239276590-239276612
Sequence GCCTGTGTCTGGAGAGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 508
Summary {0: 1, 1: 0, 2: 8, 3: 48, 4: 451}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948627224_948627229 5 Left 948627224 2:239276590-239276612 CCATCTGCTCTCCAGACACAGGC 0: 1
1: 0
2: 8
3: 48
4: 451
Right 948627229 2:239276618-239276640 CCTGGACATTGCCTGCTGCCTGG 0: 1
1: 0
2: 5
3: 28
4: 240
948627224_948627232 23 Left 948627224 2:239276590-239276612 CCATCTGCTCTCCAGACACAGGC 0: 1
1: 0
2: 8
3: 48
4: 451
Right 948627232 2:239276636-239276658 CCTGGACACTGCCCGCTGCCTGG 0: 1
1: 0
2: 1
3: 25
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948627224 Original CRISPR GCCTGTGTCTGGAGAGCAGA TGG (reversed) Intronic
900037732 1:431400-431422 GCCTATGTGTGGAGATGAGAGGG - Intergenic
900059362 1:667143-667165 GCCTATGTGTGGAGATGAGAGGG - Intergenic
900360032 1:2284018-2284040 GTCTGGGTCTGGGGAGAAGATGG - Intronic
900670532 1:3851067-3851089 GCCTGTGGCTGGAGGGCAGGAGG - Intronic
900689373 1:3970945-3970967 ATCTGTATCAGGAGAGCAGACGG + Intergenic
900881160 1:5382334-5382356 CCTTGTGTCTGCAGAGTAGAGGG + Intergenic
901886717 1:12228831-12228853 CACTCTGTCTGGAGTGCAGAGGG + Intergenic
902404117 1:16173782-16173804 GCCTGTGACTGGGGGGCAGGTGG + Intergenic
902744504 1:18464456-18464478 GTGTGTGTGTGCAGAGCAGAGGG - Intergenic
902868255 1:19295456-19295478 CCCTTGGTCTGGAGAGCACATGG - Intergenic
903107008 1:21089950-21089972 GCCTGTATCTTGAGCTCAGAGGG - Intronic
903801240 1:25969959-25969981 GCCTGTGTTTGGAGACCTTAGGG - Intronic
903929450 1:26854008-26854030 ACCTGGGTTTGGGGAGCAGAGGG - Exonic
904447628 1:30587670-30587692 TACTATGACTGGAGAGCAGAGGG - Intergenic
904535787 1:31198654-31198676 GCCCCACTCTGGAGAGCAGAAGG - Intronic
905527263 1:38648504-38648526 GTGAGTGTCTGGAGTGCAGATGG - Intergenic
905914449 1:41675166-41675188 GCCTTTGTCTTAATAGCAGAAGG - Intronic
905933460 1:41806149-41806171 GTGTTTGTCTGGAGAGCAGAGGG - Intronic
906009698 1:42511799-42511821 CCCTTAGTCTGGAGAGCACATGG - Intronic
906009782 1:42512402-42512424 CCCTTAGTCTGGAGAGCACATGG - Intronic
906202954 1:43971645-43971667 CCCTGTATCTGGACAGCAGGAGG - Exonic
907581593 1:55577220-55577242 CCCCGTGTCTGGAGAGAAGGGGG - Intergenic
907631228 1:56084214-56084236 GGCTGTGTCTGGAGTTCAGGGGG + Intergenic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
908460460 1:64343999-64344021 GCCTTTGGCTGGAGGGCAGATGG - Intergenic
909315538 1:74213147-74213169 GCCTTTTTCTGGAGAGGATATGG - Intronic
910555117 1:88523031-88523053 GCCTGTGTGACTAGAGCAGAGGG - Intergenic
910649481 1:89550209-89550231 GCCTGAGTGTGAAGAGAAGAGGG - Intronic
910693624 1:89989976-89989998 GCCTGTGTTGTTAGAGCAGAAGG + Intergenic
911660919 1:100500331-100500353 GCCTGCTTCTGTAGAGAAGAGGG + Intronic
914684585 1:149967241-149967263 GCCTGTAGGTGGAGAGTAGAGGG + Intronic
915106958 1:153540754-153540776 GCCAGAGTCTGGAGACCAGCTGG - Intronic
915910184 1:159910189-159910211 CCCTAAGTCTAGAGAGCAGAGGG + Intergenic
918313601 1:183304467-183304489 GCCAGTGACTGGCCAGCAGAAGG + Intronic
920323642 1:205144086-205144108 CCCTGTGCCTAGAGAGCTGATGG - Exonic
920430353 1:205914792-205914814 TCCTGGGTGTGGAGAGCACATGG + Exonic
920748218 1:208649044-208649066 TCCTCTGACTGGAGAGAAGATGG - Intergenic
921067704 1:211634222-211634244 GCCACAGACTGGAGAGCAGAGGG + Intergenic
921604356 1:217137483-217137505 GCCTGGGGCTCGAGAGCTGACGG + Intronic
924073847 1:240312188-240312210 GTGGGTGGCTGGAGAGCAGAGGG - Intronic
924314019 1:242776932-242776954 ACCTGTGACCTGAGAGCAGAGGG + Intergenic
924710932 1:246529487-246529509 CCCTTGGTCTGGAGAGCACATGG + Intergenic
1062977386 10:1694864-1694886 GCCTGTGGGTGGGAAGCAGAGGG + Intronic
1064096385 10:12427426-12427448 GACACTGTCAGGAGAGCAGAGGG - Intronic
1064103895 10:12485281-12485303 GGCTGTCCCTGGGGAGCAGAAGG + Intronic
1066389690 10:34968898-34968920 TCCTGTCTCTGAAGAGCAGGAGG + Intergenic
1066415044 10:35213957-35213979 GCTTGGGTCTGGAGGACAGAGGG + Intergenic
1067242517 10:44508584-44508606 GCCTGTGTCTGCTGGGGAGAAGG + Intergenic
1067925624 10:50505504-50505526 ACCTGAGGCTGGAGAGGAGAAGG - Intronic
1068411979 10:56667744-56667766 GCCTCTGTCTTGAGACCAGCAGG + Intergenic
1068468733 10:57431940-57431962 GCCTCTCTCTGGCTAGCAGATGG - Intergenic
1068496327 10:57789162-57789184 CCCTTGGTCTGGAGAGCATATGG + Intergenic
1068945185 10:62722808-62722830 GCCTGTGCATGGGGAGCTGACGG - Intergenic
1069184542 10:65406850-65406872 GCCTGTGTGTGCAGATCACATGG - Intergenic
1070764057 10:79046350-79046372 GCCTGAATCTGGAAGGCAGAGGG + Intergenic
1071523719 10:86346404-86346426 GCCTGTGTTTGGAGGGCAGCTGG + Intronic
1071525043 10:86353693-86353715 GCCTGGGCCTGGAGAGCTGAGGG - Intronic
1072374850 10:94804012-94804034 GCCTGGGTGTGGAGCACAGAGGG + Intronic
1072404072 10:95133220-95133242 ACCCTTGTCTGGAGAGCACATGG - Intergenic
1072404077 10:95133262-95133284 CCCTTGGTCTGGAGAGCATATGG - Intergenic
1072968004 10:99991427-99991449 GCCTAGGGCTGGAGAGGAGAGGG - Intronic
1074293682 10:112161669-112161691 GCCTGTGTCTGTAGAGGAGCAGG + Exonic
1075467893 10:122665030-122665052 CCCAGAGTCTGGAGAGCGGACGG + Intergenic
1075648559 10:124112410-124112432 GACTGGGCCTGCAGAGCAGAGGG + Intergenic
1076131580 10:128017514-128017536 GCCTGTGTGGGGAGGGCATATGG - Intronic
1076676971 10:132152135-132152157 GCCTGAGTCAGGAGTGCAGCTGG + Intronic
1076726441 10:132416310-132416332 GCCGGTGGGTGGAGAGCACAGGG - Intronic
1076964459 11:69323-69345 GCCTATGTGTGGAGATGAGAGGG - Intergenic
1077009628 11:374428-374450 GCCTGTGTCTGGTGTGTGGAGGG + Intronic
1077129992 11:966735-966757 GCCTCTGGCTGGTGACCAGATGG + Intronic
1077332336 11:1989137-1989159 GGGTGTGTCTGGAGAGAAGGGGG + Intergenic
1078142038 11:8699857-8699879 GCCTCTGGCTGGAGAGGGGAGGG - Intronic
1078451864 11:11446520-11446542 TCCTGGGTCTGGAGAGGAGCTGG - Intronic
1078475066 11:11622537-11622559 GCCGGTGGCTGAAGGGCAGAGGG - Intergenic
1079128483 11:17734749-17734771 GCCCGTGTCCGGAGAGCGGCGGG + Intergenic
1080019594 11:27546108-27546130 GTCTGTGTGAGGAGAGGAGATGG + Intergenic
1080250368 11:30226850-30226872 ACTTGAGTCTGGAAAGCAGAGGG + Intergenic
1081042257 11:38226346-38226368 GCCAGTCTCTAGAGAGGAGAGGG - Intergenic
1081781916 11:45719005-45719027 GCCGGTGGCAGGAGAGCAGGTGG - Intergenic
1083997062 11:66277989-66278011 GCCGGTGGCTGGAGTGCCGAGGG + Intergenic
1084953376 11:72678822-72678844 GCCTTTCTCCGGAGAGCTGAGGG - Intergenic
1085283721 11:75346714-75346736 GCCTGGGTATGGAGAGAAGAGGG - Intronic
1085467827 11:76736229-76736251 GCCGGTGTCTGGAGGGCATGGGG + Intergenic
1086404712 11:86489736-86489758 ACCTGTGAAGGGAGAGCAGAAGG - Intronic
1086955346 11:92929747-92929769 GCCTGCTTCTGGAGTGCACAAGG - Intergenic
1087015605 11:93551650-93551672 GTCAGTGCCTGGAGAGCGGATGG + Intergenic
1087149868 11:94849645-94849667 GCCTGAGGCTAGACAGCAGAGGG - Intronic
1088462250 11:110093563-110093585 GCCTGGGCCTGGAGATCACACGG - Intronic
1088952654 11:114586991-114587013 CCCTTGGTCTGGAGAGCACATGG + Intronic
1089387399 11:118077318-118077340 TCCTGTGTCTTGGGAGCAGAGGG - Intronic
1089602624 11:119624743-119624765 GCAGGTGTCTGCAGAGGAGAAGG + Intronic
1089680969 11:120118712-120118734 GCCTGGGGCAGGAGAGAAGATGG - Intronic
1090292050 11:125554225-125554247 CCCTTGGTCTGGAGAGCACATGG - Intergenic
1090413964 11:126528152-126528174 GTCTGGGTCTGTAGAGCAGGAGG - Intronic
1090457938 11:126866075-126866097 GCCTGTCTTTGGAGCACAGAAGG + Intronic
1090807472 11:130211353-130211375 GCCAGTGTCAGGAGGGCAGAAGG + Intergenic
1091065075 11:132502157-132502179 GCCCGTGTCAGCAGAGCAGAGGG - Intronic
1091338798 11:134794582-134794604 AACTGAGTCTGGAGAGCAGAGGG + Intergenic
1202815318 11_KI270721v1_random:44313-44335 GGGTGTGTCTGGAGAGAAGGGGG + Intergenic
1091613750 12:2033404-2033426 GCCTGGGTTTGGAGAGAAAATGG - Intronic
1091853036 12:3715987-3716009 GCCCTTGTCTGAAGAGAAGAAGG + Intronic
1092259235 12:6943789-6943811 GTATGTGTTTGGAGAGAAGATGG - Intronic
1094069040 12:26392569-26392591 GGCAGTGTCTGGAGAACAGTAGG + Intronic
1094297961 12:28928896-28928918 GCCTGTGTATGGAGTGGAGAGGG + Intergenic
1095334846 12:41012134-41012156 CCCTTGGTCTGGAGAGCACATGG - Intronic
1095915689 12:47475488-47475510 GCCTGGGTGTGGAGTGTAGAGGG - Intergenic
1096578760 12:52570973-52570995 GGATGTGTCTGCAGAGCTGAGGG + Intronic
1096636157 12:52960906-52960928 GCCTGTGTTTAAAGGGCAGATGG - Intergenic
1096801867 12:54115718-54115740 GGCTGTGTCTGAAGGGCAGCAGG + Intergenic
1097158553 12:57029668-57029690 GCTGGCATCTGGAGAGCAGATGG - Intronic
1098465785 12:70784196-70784218 TCCTGTCTCCGGAGAGCACAGGG + Intronic
1100633263 12:96409099-96409121 GCCTGTGTCTGAAGAAGGGAAGG + Intergenic
1101962732 12:109262039-109262061 GACTGTGGCTGGAGAGCAGGAGG + Intronic
1102227285 12:111237707-111237729 GGCAGGGGCTGGAGAGCAGATGG - Intronic
1102302324 12:111779845-111779867 CCCAGTGCCTGGAAAGCAGAGGG + Intronic
1102573284 12:113840627-113840649 GGCCGTGGCCGGAGAGCAGACGG + Intronic
1102819717 12:115897407-115897429 CCCTGAGTCTGGAGACCAGGTGG + Intergenic
1102874079 12:116436265-116436287 GCCTGTGGCTGTAGAGCTCAGGG - Intergenic
1102957128 12:117066050-117066072 GCCGGTGTGTGAAGAGAAGAGGG - Intronic
1103360082 12:120348173-120348195 GCCTGTGTCTGAAGAGGAGATGG - Intronic
1103385465 12:120528949-120528971 GACTGTGTCGGAAGAGGAGAAGG - Exonic
1103551768 12:121743133-121743155 GACTGTGTCTGGAGTGGGGAGGG + Intronic
1104605989 12:130188144-130188166 TCCTGTGTCTGGAGATTACAAGG - Intergenic
1104969814 12:132526192-132526214 GCCTGTGGGTGGAGGGCAGGCGG + Intronic
1106596825 13:31149846-31149868 ACCTGTGTCTAGGTAGCAGAAGG - Intronic
1106699106 13:32209889-32209911 GCCTGTGTCTAGGGGGCAGAAGG - Intronic
1107783424 13:43929456-43929478 GCTTGTATTTGGAAAGCAGAAGG - Intergenic
1110176828 13:72567235-72567257 TCCTGTGTTTGCAGAGCTGAAGG + Intergenic
1110253849 13:73409986-73410008 GCCTGTGTTCTGAGAGCAGAGGG + Intergenic
1110763111 13:79252385-79252407 GCCTGGGTCTGGGGAGGACAAGG + Intergenic
1111011795 13:82324181-82324203 TCCTTGGTCTGGAGAGCACATGG + Intergenic
1113767078 13:112888374-112888396 TCTTCTGTCTGGAGAGCAGGGGG - Intergenic
1113866923 13:113532519-113532541 GCCTCTGTGTGGAGAGCAGATGG + Intronic
1114832731 14:26164401-26164423 GCCTGGGTGTGGAGTGTAGACGG + Intergenic
1117568596 14:57022566-57022588 TCCTGTGGCAGGAGAGAAGAAGG - Intergenic
1119427561 14:74545726-74545748 GCCAGAGTCTGGAGAACACACGG - Intronic
1119730597 14:76948588-76948610 GCAGGTGACTGGAGGGCAGAAGG + Intergenic
1119772005 14:77225879-77225901 CTCAGTGCCTGGAGAGCAGAGGG + Intronic
1120946763 14:90005150-90005172 GAGTGTGGCTGCAGAGCAGATGG - Intronic
1121232053 14:92365294-92365316 GACTGGGTCTGCAGAGCAGCTGG + Intronic
1121660671 14:95632766-95632788 GACTGGGGCTGTAGAGCAGAGGG + Intergenic
1122959673 14:105088589-105088611 GCCTGGGTCCGGAGCACAGAGGG - Intergenic
1122959815 14:105089337-105089359 GCCTGTGCCCTGAGAGCAGATGG + Intergenic
1124497120 15:30193354-30193376 TCCTGAGTGTGCAGAGCAGAAGG - Intergenic
1124632180 15:31344246-31344268 GCCTGTGTCAGGAGGGGAGTGGG + Intronic
1124652525 15:31484136-31484158 GCCGGTGGCTGGTGAGCAGCAGG + Exonic
1124746456 15:32345293-32345315 TCCTGAGTGTGCAGAGCAGAAGG + Intergenic
1127670102 15:61186973-61186995 GATTGTATCTGGAGAGCACACGG + Intronic
1129703771 15:77782999-77783021 GGCTGTGTCTGGAGACCAGGAGG - Intronic
1129748794 15:78044985-78045007 GACTGTGCCTGGAGAGCTGGTGG - Exonic
1130036654 15:80367259-80367281 CCCTTGGTCTGGAGAGCACATGG + Intronic
1131284399 15:91045121-91045143 CCCTGGGTTTGGAGAGCAGGAGG + Intergenic
1132444091 15:101895860-101895882 GCCTATGTGTGGAGATGAGAGGG + Intergenic
1132586253 16:706778-706800 GCAGGTGTGGGGAGAGCAGAGGG + Intronic
1132744641 16:1431597-1431619 GCCTGTGGCAGGAGGGCGGAGGG - Intergenic
1132845389 16:1998845-1998867 GCCTGGGTCTGGGGGTCAGAAGG + Exonic
1133074350 16:3268495-3268517 GTCTGTGTCTGCAGAGCTCAAGG + Intronic
1133263795 16:4570844-4570866 GCCTGGCTCTGGAGGGCAAAAGG - Intronic
1134411098 16:14003733-14003755 GCCTTTGCCTGGAGACTAGAGGG + Intergenic
1134882746 16:17759941-17759963 GCCCGTCTCTGGAGGGCTGAGGG + Intergenic
1135101903 16:19613407-19613429 GCCAGTGTCTGGAGAGGCCAGGG + Intronic
1135724734 16:24845798-24845820 GCCTCTGTCTGAAGAGTATATGG + Intergenic
1135868064 16:26123092-26123114 TCCTTTGTCTACAGAGCAGATGG + Intronic
1137251989 16:46747627-46747649 GCCAGTGTTTGGAGAGCTGGAGG - Intronic
1137547667 16:49415682-49415704 GCCTGTGTGGCCAGAGCAGAGGG + Intergenic
1137762624 16:50952827-50952849 GCCTGGGTATGGAAAGCAAAGGG + Intergenic
1138202423 16:55100204-55100226 GCCTGGGTCAGGAGAGCAGCAGG + Intergenic
1138542875 16:57699058-57699080 GCCTGGGGCTGGAGAGCAGAGGG + Intronic
1139342563 16:66278024-66278046 GCCTGGGTGTGGAGAAGAGAGGG - Intergenic
1139342618 16:66278346-66278368 GCCTGGGTGTGGAGTGGAGAGGG - Intergenic
1140263397 16:73399858-73399880 GTGTGTGTCTAGATAGCAGAGGG + Intergenic
1141177294 16:81729558-81729580 GCCTAGGCCTGGAGAGCAGCTGG + Intergenic
1141254700 16:82390225-82390247 TCCTGTGTCTGGAAAGCAAGAGG + Intergenic
1141506471 16:84481600-84481622 CCCTGTTTCTGCAGAGCTGAGGG - Intronic
1142026779 16:87818635-87818657 GGCTCTGTCTGGAAAGCAGTGGG + Intergenic
1142121789 16:88390156-88390178 CCCTCTGCCTGGAGAGCACAGGG - Intergenic
1142126299 16:88412196-88412218 GCCTGGGACTGGAGAGGGGATGG - Intergenic
1142201355 16:88762500-88762522 GGATGTGTCTGGGGAGGAGAAGG + Intronic
1142598677 17:1042055-1042077 GCTTGGGTCTGGAGAGAAGGAGG + Intronic
1142804275 17:2363310-2363332 GTCCGTGGCTGGAGAGCAGAGGG + Intronic
1143790676 17:9292887-9292909 CCTTGTGTTTGGAGAGAAGATGG - Intronic
1143839823 17:9723338-9723360 GCCTGAGTCTGTAGAACAAAAGG - Intronic
1144043396 17:11432885-11432907 GCCTGGGGCTGGAGAGCAGGAGG + Intronic
1144399980 17:14886742-14886764 GCCTGAGTATGGAGTGGAGAGGG + Intergenic
1144901805 17:18600767-18600789 ACATGCGTCTAGAGAGCAGATGG + Intergenic
1144955274 17:19015875-19015897 GGCTGTGTCTGGAGAACAGGTGG + Intronic
1145739143 17:27257678-27257700 GCCTGTGGCTGGAGTGGAGATGG - Intergenic
1146288280 17:31589580-31589602 GCTTGTGTCTGGAGTACAGCTGG - Intergenic
1148110918 17:45144357-45144379 GCCTCTGTGTGGAGGGGAGAGGG + Intergenic
1148453900 17:47800752-47800774 GCCTGTGCCTGGAGCGGCGAAGG - Intergenic
1148813344 17:50309036-50309058 GCCGGTGTCTGGAGAGAAGCAGG + Intergenic
1148823018 17:50371565-50371587 GGCTGTGTCTGGAGACCTGCAGG - Intronic
1149773238 17:59337883-59337905 GCCTGGGTCTGGGAAACAGAAGG - Intronic
1150075758 17:62190733-62190755 GACTGTGTGTGGAGAGTGGAGGG + Intergenic
1150149661 17:62798849-62798871 GGCAGGGGCTGGAGAGCAGAGGG + Intronic
1150455868 17:65306037-65306059 GCCTGTTTCTGCACAGCAGGAGG - Intergenic
1150474627 17:65465535-65465557 TTCTGTCTCTGAAGAGCAGAGGG + Intergenic
1151725623 17:75882102-75882124 GGCTGTGGGTGGGGAGCAGAGGG - Intronic
1151821719 17:76500547-76500569 GGGTGTGTCTGAGGAGCAGAAGG - Intronic
1154126619 18:11697858-11697880 GGCAGTGGCTGGAGAGCAGCTGG + Intronic
1154476865 18:14768663-14768685 GACTGTGGCATGAGAGCAGAGGG + Intronic
1155140825 18:23043062-23043084 GCAGGTGTCTGGTGAGCAAAAGG - Intergenic
1155205871 18:23557348-23557370 TCCTGAGACTGGTGAGCAGAGGG - Intronic
1157305462 18:46513902-46513924 GCCTGGGGCTGGTGAGCAGCAGG + Intronic
1157574683 18:48735781-48735803 GCCTGGGTCTGGTGAGAAGGAGG + Intronic
1157585957 18:48801275-48801297 GCCTGCCTCTGGAGACCATATGG - Intronic
1157661369 18:49447926-49447948 CCCTTGGTCTGGAGAGCACATGG + Intronic
1157792717 18:50546788-50546810 GCCGGTCTCTCGAGGGCAGATGG - Intergenic
1158155075 18:54416696-54416718 CCCAGTGTCTGGAATGCAGAAGG - Intergenic
1158395687 18:57077160-57077182 GCCTGAGTCTGTGGGGCAGAGGG + Intergenic
1158611000 18:58940671-58940693 GCCTGTGTCTGGAGCATGGAGGG + Intronic
1160018745 18:75164332-75164354 TGCTGTTTCTGGAGCGCAGAGGG + Intergenic
1160035361 18:75296712-75296734 ACCTGTGTGTGCAGAGCAGGGGG + Intergenic
1160048121 18:75406683-75406705 GCCTGTGTCAAGAGATCCGAGGG + Intergenic
1160179039 18:76618686-76618708 GGCTGTGTCTTGAGGGAAGAAGG + Intergenic
1160440286 18:78884334-78884356 GCCTGGGTGTGGAGTGGAGAGGG - Intergenic
1160641262 19:138955-138977 GCCTATGTGTGGAGATGAGAGGG - Intergenic
1160728645 19:630327-630349 GCGTGTGTCTGGAAAGCAGCGGG - Intronic
1160905807 19:1451285-1451307 GCCTGGGTTTGGGGAGCAGGAGG + Exonic
1160991392 19:1861748-1861770 GCCTGAGGGTGGAGAGCAGGAGG - Intronic
1161271177 19:3390175-3390197 CCAGGTGTCTGGACAGCAGAGGG + Intronic
1161683096 19:5690306-5690328 GGCCGTCTCTGGAGAGCAGCAGG + Exonic
1161912521 19:7205182-7205204 GCTTGTATCTGGAGCTCAGATGG - Intronic
1163245548 19:16091732-16091754 GCCTGACTCTGGAGTGCAGTGGG - Intronic
1163953214 19:20610422-20610444 CCCTTTGACTGGAGAACAGAGGG - Intronic
1164593388 19:29518315-29518337 CCATGGGTCTGGAGAGCACAAGG + Intergenic
1165333442 19:35154109-35154131 CCCTGGGTCTGGGGTGCAGACGG - Exonic
1166991511 19:46695607-46695629 GCTTGTGTGCGGAGGGCAGATGG + Intronic
1167710763 19:51109079-51109101 CCCTGTGTCTAGGGTGCAGACGG - Intergenic
1168179355 19:54650356-54650378 GGCACTGTCAGGAGAGCAGAGGG + Intronic
1168179878 19:54654698-54654720 GGCACTGTCAGGAGAGCAGAGGG + Intronic
1168640170 19:58025875-58025897 GCCTGAGGCTGGGGAGCAGGTGG + Intergenic
925462417 2:4074913-4074935 GCCTGTGTCTTGGGATCACAGGG + Intergenic
925692168 2:6536639-6536661 ACCTATGTATGGAGAGGAGATGG - Intergenic
925754428 2:7120179-7120201 GCCTGGAGCTGGAGACCAGATGG + Intergenic
926296753 2:11574477-11574499 GCCTGTGGGTGGAGGGCAGTGGG + Intronic
926690402 2:15729262-15729284 GTCTGTGACTGGAAGGCAGAAGG + Intronic
927696916 2:25245325-25245347 GCAGATGTCTGGAAAGCAGAGGG + Exonic
927967893 2:27283020-27283042 TGTTGTGGCTGGAGAGCAGAAGG + Intronic
928111844 2:28516895-28516917 GCGTGTGTATGGAGGGGAGAGGG + Intronic
928672772 2:33619411-33619433 GTCTGGATCTGGAGAGCTGATGG + Intergenic
929142157 2:38676117-38676139 GACTGTGCCTGGCAAGCAGAAGG - Intronic
929964596 2:46524783-46524805 GTCTGCGTGTGGAGAGCAGGTGG + Intronic
931559597 2:63545503-63545525 GCCTGATGCTGGAGAACAGAGGG - Intronic
932735335 2:74250484-74250506 GCCTGTGTCTGGATATCAAGAGG - Exonic
932739754 2:74282612-74282634 CACTGGGTCTGGAGTGCAGAGGG + Intronic
933647343 2:84823460-84823482 GCCTGAGTCTGCAGGGCACAAGG - Intronic
935160522 2:100525866-100525888 ACCTGTCTCAGGTGAGCAGAAGG - Intergenic
935591583 2:104850685-104850707 TGCTGTGTCTGGGGAGCAGGCGG - Intergenic
935714829 2:105930702-105930724 GCCTCTGTCTGGGGAGGAGGGGG + Intergenic
936057621 2:109272699-109272721 GGCTGTGTGTGGTCAGCAGAGGG + Intronic
936616866 2:114056796-114056818 GTCTGTGACTGGAGAATAGATGG + Intergenic
937059309 2:118969926-118969948 GCCTGAGTGTGGAGCGCACATGG + Intronic
937111721 2:119371765-119371787 GCCTCTCTCTGGGGAGAAGAGGG + Intronic
937672848 2:124557278-124557300 GCCTGTGGCTGCACAGAAGAAGG + Intronic
937917557 2:127106470-127106492 GCATGGGCCTGGAGAGCTGAGGG + Intronic
937933593 2:127224416-127224438 GCATGTGTCTTTATAGCAGAAGG + Intergenic
938247931 2:129793269-129793291 CCCTGTGTCTGGGTAGCACAAGG - Intergenic
938993935 2:136657792-136657814 ACAAGTGTCTGGAAAGCAGATGG - Intergenic
939124837 2:138165335-138165357 GCCTGTGTGTAGAGTGGAGATGG - Intergenic
940742569 2:157526319-157526341 GCCAGGGTCTGGAGAACAGGTGG + Intergenic
940990206 2:160088573-160088595 CCCTTGGTCTGGAGAGCACATGG - Intergenic
941587600 2:167379918-167379940 GCCTGTGCATGTAGAGGAGAGGG + Intergenic
942814794 2:180039829-180039851 GCCTTGGGCTGGAGAGCAGATGG - Intergenic
943984641 2:194603906-194603928 CCCTTGGTCTGGAGAGCATATGG + Intergenic
945310342 2:208305028-208305050 GCCTGTGTTTGGATTCCAGATGG - Intronic
945494934 2:210498785-210498807 GCCTGGGTGTGGAGTGTAGAGGG + Intronic
946346956 2:219118595-219118617 GGCTGTGTCTGTAAAGCGGATGG + Intronic
946814578 2:223563701-223563723 GGCTGTCTCTGGAAGGCAGATGG - Intergenic
948142719 2:235685586-235685608 GCGTCTGTCTGGACAGCCGAAGG + Intronic
948347730 2:237313244-237313266 GGATGTGTCTGGTGAGGAGAGGG - Intergenic
948556172 2:238813065-238813087 GGCGGTGTCTGGAGATCAGGGGG + Intergenic
948627224 2:239276590-239276612 GCCTGTGTCTGGAGAGCAGATGG - Intronic
948676214 2:239598333-239598355 GCCTGTGTCTGGACACCCCATGG + Intergenic
948775285 2:240284806-240284828 GCCTCGGTCAGGAGATCAGAGGG + Intergenic
949043771 2:241860960-241860982 GTCTGAGCCTGGAGAGCACAGGG + Intergenic
1168895647 20:1321582-1321604 GCTGCTGTCTGGAGAGCAGCAGG - Intronic
1169198716 20:3697335-3697357 GACAGTGGCTGGAGAGCAGGCGG + Exonic
1169566277 20:6856834-6856856 GCGTGAGTTTGGAGAGCTGATGG - Intergenic
1171084023 20:22219348-22219370 GCCTGTTACTGGAGAGATGAGGG - Intergenic
1171104145 20:22416392-22416414 TCCTCTCTCTGGAGAGGAGATGG - Intergenic
1171108915 20:22462600-22462622 ACCTGTATGGGGAGAGCAGAAGG - Intergenic
1171794844 20:29558748-29558770 GGCTGTGTCTGAAGGGCAGCAGG - Intergenic
1171853612 20:30325517-30325539 GGCTGTGTCTGAAGGGCAGCAGG + Intergenic
1172207999 20:33178132-33178154 GGCTGTGTCTGGAAAACACAGGG - Exonic
1174142992 20:48429870-48429892 GTCTGTGTCTGCAGAGCCAAAGG + Intergenic
1174285679 20:49471313-49471335 TGCTGTGTGTGGAGACCAGACGG + Intronic
1174404806 20:50296209-50296231 GCCTGTGTGTGGAGATGAGAGGG + Intergenic
1174438136 20:50526619-50526641 GGCTGTAACTAGAGAGCAGAAGG - Intronic
1174518443 20:51111515-51111537 TCCTGTGTCAGGAGAGAAGCAGG + Intergenic
1175251866 20:57614850-57614872 GCCTGTGTCTGGGCTGCAGAGGG - Intronic
1175281809 20:57808764-57808786 GCTGATGTCTGGAGAGCACAGGG + Intergenic
1175714091 20:61244036-61244058 GCCTGTGTCTGGAGGGGAAATGG + Intergenic
1176302719 21:5106225-5106247 GCCTCTGCCTGGTGGGCAGAGGG - Intergenic
1177173668 21:17680922-17680944 GCCTATAACTGGAGAGCAGAAGG + Intergenic
1178842717 21:36150765-36150787 CCCTGTGCCTGAGGAGCAGAGGG + Intergenic
1179726169 21:43342263-43342285 GCGTGTGTCTGTGGAGCAGTGGG - Intergenic
1179837700 21:44048217-44048239 GACTGTGTTAGGAGAGGAGAGGG - Intronic
1179854305 21:44155698-44155720 GCCTCTGCCTGGTGGGCAGAGGG + Intergenic
1180023331 21:45143248-45143270 GTCTGAGTTTGGAGAGCAGGGGG - Intronic
1180248248 21:46562659-46562681 GGCTGAGTGTGGGGAGCAGAAGG + Intronic
1180725980 22:17946881-17946903 GCCCTTTGCTGGAGAGCAGAGGG - Intronic
1181446134 22:22976320-22976342 CCCTTGGTCTGGAGAGCACATGG + Intergenic
1181446141 22:22976363-22976385 CCCTTGGTCTGGAGAGCACATGG + Intergenic
1183074414 22:35417729-35417751 GCCAGCATCTGGAGAGCAGAGGG - Exonic
1183317270 22:37143569-37143591 TCCTGTGTCTGGAGCCAAGATGG - Exonic
1183430425 22:37762522-37762544 ACCTGTGTCTGGAGTTCAGGCGG + Intronic
1183585072 22:38748686-38748708 GCCTGCATGGGGAGAGCAGAGGG - Intronic
1184301987 22:43566869-43566891 GGTTCTGTCTGGAGAGCCGAGGG - Intronic
1184925073 22:47630949-47630971 GCATGTCACAGGAGAGCAGACGG + Intergenic
1185005960 22:48277156-48277178 GCCAGGGTCTGGAGCGCAGCAGG - Intergenic
1185052205 22:48559762-48559784 GCCTGCCTTTGGGGAGCAGAGGG + Intronic
1185131102 22:49039327-49039349 ACCAGGGTCTGGAGAGCAGCGGG - Intergenic
1185215870 22:49599773-49599795 GCTGGTGTCTGGAGAGCAGGAGG + Intronic
1185315330 22:50176556-50176578 GGCTGTGTGTGGATAGAAGAAGG + Intronic
1185399348 22:50607913-50607935 GCCTGTGCCTGGAGGGAAGCTGG - Intronic
949380908 3:3444681-3444703 GCCAGTGCCTGGTAAGCAGAAGG - Intergenic
949565221 3:5238115-5238137 GCCTTTCTCTGGAGAGCACTGGG + Intergenic
949663014 3:6303706-6303728 GTCTGTGTGTGGAGTGTAGAGGG - Intergenic
949825238 3:8157933-8157955 GATAGTGTCTGGAGAGCAGTTGG - Intergenic
950216462 3:11163212-11163234 GCCTGTGTTGGGTGTGCAGAAGG - Intronic
950773141 3:15328179-15328201 GCCTGGCTCTGGAGAGCATTTGG - Intronic
950796059 3:15511575-15511597 CCCTGTCTCTAGAGAGCAGCAGG - Intronic
951194159 3:19804857-19804879 GCCTGTGTCTCCAGATGAGAAGG + Intergenic
952899507 3:38100146-38100168 GCCTGTTTCTGGATCCCAGATGG + Intronic
952954580 3:38549188-38549210 CTCTGTGTCTGGAGAGGAGCTGG + Exonic
954366348 3:50148200-50148222 GCCTGTCCCTGGAGAGCTCACGG + Intergenic
954804828 3:53211850-53211872 GCCTGTGTGGGGTGAGGAGAGGG + Intergenic
954929738 3:54271138-54271160 CCATGTGTCTAGAGAGCAGTGGG + Intronic
955195396 3:56801257-56801279 GCCTGGGTTGTGAGAGCAGAGGG - Intronic
955876557 3:63496033-63496055 GACTGTGCCTGGGGAGGAGAGGG + Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
958735723 3:98007345-98007367 GCCAGTGTCGGGAGAGTAGCAGG + Intronic
959166145 3:102780781-102780803 TCCTGTGACTGGAGAGGAAATGG - Intergenic
960208975 3:114937084-114937106 GCATGTGTCTTTATAGCAGAAGG + Intronic
960949330 3:122988924-122988946 GCCTGCTTCTCCAGAGCAGAAGG - Intronic
961331089 3:126138792-126138814 GCCAATGTCTAGACAGCAGATGG + Intronic
962990582 3:140573828-140573850 CCCTGTTTCTGGGGAACAGAAGG + Exonic
964444672 3:156746261-156746283 GCCTGTTTCTGGCAAGCAGTGGG + Intergenic
965470612 3:169085727-169085749 TCCAGTGTCTGCTGAGCAGAAGG + Intronic
965534087 3:169806465-169806487 GCCAGGGGCTGGAGAGCAGGGGG + Intronic
966217421 3:177517986-177518008 GCCTGGGTCTGCAGATTAGATGG + Intergenic
966431406 3:179834543-179834565 GACTGTGGCTAGTGAGCAGAGGG + Intronic
967414833 3:189204664-189204686 TCCTGTGCCTGGAAAACAGAGGG - Intronic
967911296 3:194544663-194544685 GCCTGAGTGTGCAGATCAGATGG - Intergenic
967959963 3:194912542-194912564 TCCTGGGTCAGGGGAGCAGAGGG + Intergenic
968220194 3:196931910-196931932 GCAGGTGGCTGGAGAGAAGAGGG + Exonic
968228503 3:196990716-196990738 GCCCATGTCTGTAGAGCAGCAGG - Intronic
968474143 4:795259-795281 GTCTGTGCCGGGAGAGCAAATGG - Intronic
968575985 4:1366421-1366443 GCCTGAGTATGGTGAGCAGTGGG + Exonic
969457813 4:7310144-7310166 GCTTGTGCGTGGAGAGCTGACGG + Intronic
969699936 4:8762416-8762438 GTCTGTGGCTGGAGGGCAGAGGG - Intergenic
970806206 4:20037002-20037024 GCCTGGGACTGGAAAGGAGAGGG - Intergenic
971298917 4:25425850-25425872 GCCTGTTTCCGCAGAGCCGATGG - Intergenic
974123259 4:57665119-57665141 GCCTATGTCAGCAGAGTAGAAGG - Intergenic
975276328 4:72505909-72505931 GCCTGGGTGTGGAGTGGAGATGG + Intronic
977057298 4:92209474-92209496 GGCTGTGTCAGGAGATCATAGGG - Intergenic
978019087 4:103786202-103786224 CCCTTGGTCTGGAGAGCATATGG + Intergenic
978216121 4:106206190-106206212 ACCTGTTTCTGGACAGCATAAGG + Intronic
979536158 4:121823284-121823306 GCCAGGGTCTGGAGTGCAGTTGG - Intronic
980095287 4:128483792-128483814 GCCTTTGTCTGGATAGGAAAGGG - Intergenic
980137231 4:128870313-128870335 GTCTGTGTCTGGTGAGCACTAGG + Intronic
981646669 4:147006077-147006099 GCCTCTCTTTGGAGAACAGAAGG + Intergenic
981667681 4:147247895-147247917 GTCAGAGTCTGGAGAGCACATGG + Intergenic
981679615 4:147381674-147381696 GCCTGAGTGTGGAGTGAAGAGGG - Intergenic
982002145 4:151030928-151030950 GGCTGTGTGTGAAGAACAGATGG + Intergenic
982843733 4:160223945-160223967 GCCTGGGTGTGGAGTGGAGAGGG + Intergenic
983422642 4:167539531-167539553 GCATGTGTCTCTAGAGCAGAAGG - Intergenic
983631313 4:169852405-169852427 TCCTGTAAGTGGAGAGCAGAGGG - Intergenic
984906201 4:184628337-184628359 GCCTGTAACTTGAGAGTAGATGG - Exonic
985127653 4:186711317-186711339 GACTTTATCTGGAGAGGAGAAGG - Intronic
985945222 5:3177150-3177172 GCCTGTGTCTCAAGAGGAAAGGG + Intergenic
986030215 5:3886382-3886404 GCCTGTGTGGGGGGAGCAGAAGG - Intergenic
986300327 5:6473473-6473495 GCCAGTGGGTGGTGAGCAGAAGG - Intronic
986621943 5:9685090-9685112 GTATGTATCTGGAGAGCAGAAGG + Intronic
986688626 5:10295683-10295705 GCCTGTTTCTGGTTTGCAGATGG - Intronic
987569678 5:19639708-19639730 GCATGTGTCTGTGGAGCAAATGG - Intronic
987989402 5:25190878-25190900 TCCGGTGTCTGCAGGGCAGAGGG + Intergenic
989460835 5:41696655-41696677 GCCTGGGTATGGAGAGGAGAGGG + Intergenic
991530951 5:67613556-67613578 CCATGTCTCTGGAGAGTAGATGG - Intergenic
991640134 5:68743744-68743766 GCCTGAGACTGGAGAGGAGCTGG + Intergenic
993417367 5:87651810-87651832 GCCTGTTTTTGGTAAGCAGATGG - Intergenic
993814193 5:92520660-92520682 ACCAGAGGCTGGAGAGCAGAGGG - Intergenic
994843700 5:104957910-104957932 GCCAGTGTTTGGTGAGCAGTTGG - Intergenic
995086239 5:108113208-108113230 GCCTCTGTCTGAAGACCACATGG + Intronic
996439807 5:123477486-123477508 GCCTGTTTCTCGATAGCACAAGG + Intergenic
996477434 5:123937400-123937422 CCCTTGGTCTGGAGAGCACATGG - Intergenic
997144178 5:131414123-131414145 TCCTGTGGCTGGGGAGCTGAGGG + Intergenic
997575836 5:134976576-134976598 TCTTGGGTCTGGAGAGCAGTGGG + Intronic
998343988 5:141444529-141444551 GACTGTGTCTAGTGAGCAAAAGG + Intronic
999289084 5:150411808-150411830 GCAGGTGTCTGTAGAGTAGATGG - Intronic
1000345720 5:160312142-160312164 CCCCGTGTCCGGCGAGCAGAGGG - Intronic
1001454274 5:171848702-171848724 GCCTGGCTCTGGAGGGCACATGG - Intergenic
1002576178 5:180175374-180175396 GGATGAGTCTGGAGAGCAGCAGG - Intronic
1002736089 5:181387466-181387488 GCCTATGTGTGGAGATGAGAGGG + Intergenic
1002748609 6:87358-87380 GCCTATGTGTGGAGATGAGAGGG - Intergenic
1002915104 6:1522686-1522708 CCCTGTGGCTGGTCAGCAGACGG - Intergenic
1002989763 6:2227837-2227859 GCCTATGTCTGGACAGCAAGGGG - Intronic
1004406080 6:15335106-15335128 GACTGTCTCTGGAAAGAAGAAGG - Intronic
1004893739 6:20126915-20126937 GGCTGTGTCTGGCCAGCAGAGGG - Intronic
1004924416 6:20403552-20403574 GCCTGTGACTGGGGAGGAGGCGG + Intronic
1005181877 6:23115513-23115535 CCCTTAGTCTGGAGAGCACATGG - Intergenic
1005834983 6:29702248-29702270 GCCTTGGTCCAGAGAGCAGAAGG - Intergenic
1006116219 6:31777409-31777431 CCCTGGTTCTGGAGGGCAGAGGG - Intergenic
1006211163 6:32396201-32396223 CCATGTGGCTGGAGAGCAGATGG - Exonic
1006213822 6:32421254-32421276 GCCTGGGTCTGTCGAGCACAAGG + Intergenic
1006608149 6:35274408-35274430 GCTTGTGTGTGGAGCGCAGTAGG + Intronic
1006932267 6:37695563-37695585 GCCTGTGCCTGGCAAGAAGAAGG - Intronic
1007169907 6:39855703-39855725 GCCTGGGTCTCCAGAGCAGGAGG - Intronic
1007341434 6:41193713-41193735 GTCTGTGGATGGAGAGGAGAGGG - Intronic
1007502157 6:42306553-42306575 GCCTGAGGCTGGGGAGCAGATGG - Intronic
1007932942 6:45708792-45708814 TCCCATGTCTGGGGAGCAGAGGG + Intergenic
1008521072 6:52362570-52362592 GCCTGAGCCTGGAGAGCTGGCGG + Intronic
1008642931 6:53483332-53483354 GCCAGTTTCTGGAGAGGGGATGG - Intergenic
1008876381 6:56334201-56334223 CCATGTTTCTGGAGGGCAGATGG - Intronic
1008907627 6:56697040-56697062 GCCTCTGTCTGCTGAGCAGTTGG - Intronic
1009657779 6:66568483-66568505 GCCTGGGTCTAGAGAGCTCATGG - Intergenic
1009787582 6:68358877-68358899 GCCTGTGGATGGAGTGGAGAGGG + Intergenic
1010574319 6:77512715-77512737 CCCTTAGTCTGGAGAGCACATGG - Intergenic
1010574330 6:77512801-77512823 CCCTTGGTCTGGAGAGCACATGG - Intergenic
1011580281 6:88855598-88855620 GCAGGTGTCTGGGGAGCAGATGG + Intronic
1013034729 6:106370303-106370325 GCCTGTGTCAGGGCAGAAGAAGG - Intergenic
1014198042 6:118580929-118580951 CCCTTGGTCTGGAGAGCACACGG + Intronic
1015471168 6:133607903-133607925 TCCTGTGTGTGAAGAGCAAAAGG - Intergenic
1017065617 6:150526509-150526531 GTCTGTCTCAGGTGAGCAGAGGG - Intergenic
1017993016 6:159506522-159506544 GCCTTCCTCTGGGGAGCAGAAGG - Intergenic
1018555780 6:165049471-165049493 CCCTTGGTCTGGAGAGCACATGG + Intergenic
1018800734 6:167220214-167220236 GCCTGTGATTGGACAGCTGAGGG + Intergenic
1019156999 6:170045904-170045926 GCCTGTGGCTGTAGAGGAGATGG - Intergenic
1019209412 6:170393198-170393220 ACCTCAGTCTGGAGAGGAGAGGG - Intronic
1019241186 6:170662994-170663016 GCCTATGTGTGGAGATGAGAGGG + Intergenic
1019485966 7:1289286-1289308 CCCTGAGTCGGGAGAGCAGGCGG + Intergenic
1019550513 7:1599937-1599959 GCCTGTGACTGGGGAGAACAGGG + Intergenic
1019708586 7:2508061-2508083 GCCTCTGTCTCCAGAGCAGGTGG - Intergenic
1019710484 7:2516123-2516145 GTCTGTGTCAGGAGAGGACAGGG + Intronic
1019878706 7:3839255-3839277 TCCTCTGTCTGGAAAGCAAAGGG - Intronic
1021351732 7:19602386-19602408 GCCTGAGGGTGGAGTGCAGAGGG + Intergenic
1021687971 7:23206050-23206072 CCCCGTGTCTGCAGGGCAGAGGG - Intergenic
1022259446 7:28690294-28690316 CTCTGTGTCTGGTGGGCAGAGGG - Intronic
1023922913 7:44643684-44643706 GTCTGAGTCTGGAGACCAGAAGG - Intronic
1024638535 7:51310494-51310516 GCCTCTGTCTGGAGAGAGGTGGG + Intronic
1026107497 7:67432771-67432793 GCTTGTTTCAAGAGAGCAGAGGG - Intergenic
1026291622 7:69011636-69011658 GCTTGTCTCAGGTGAGCAGAGGG + Intergenic
1026456496 7:70577016-70577038 GCCTCTATCTGCAGAGCATATGG - Intronic
1027192285 7:76003703-76003725 GCCTGTGTCTGGGAAGCAGAGGG - Intronic
1027934805 7:84589029-84589051 GCCTGGGTGTGGAGTGTAGAGGG - Intergenic
1027934848 7:84589275-84589297 GCCTGGGTGTGGAGTGAAGAGGG - Intergenic
1028351651 7:89857197-89857219 CCCTTGGTCTGGAGAGCACATGG + Intergenic
1028351657 7:89857240-89857262 CCCTTGGTCTGGAGAGCACATGG + Intergenic
1028351671 7:89857326-89857348 CCCTTGGTCTGGAGAGCACATGG + Intergenic
1028985261 7:97004202-97004224 GCGTGGGTCTGGAGACCGGAGGG + Intergenic
1029156542 7:98521508-98521530 GACTGTGTCTAGAAAGCTGAGGG - Intergenic
1030309601 7:108055952-108055974 GCCTGTGTCTGGATCACAGATGG + Exonic
1031237625 7:119196992-119197014 GCCTGGGTGTAGAGAGGAGAGGG - Intergenic
1031237667 7:119197302-119197324 GCCTGTGTGTGGAGTGAAAAGGG - Intergenic
1031805280 7:126300360-126300382 GCCTGTACCTGGTGAGCACACGG + Intergenic
1031908242 7:127485436-127485458 GCTTGTGTTTGGAGACCACAAGG - Intergenic
1032153688 7:129451379-129451401 GGCTGTGTGTGGAGGACAGAGGG + Intronic
1032925094 7:136595179-136595201 GCCTCTGTCTGTAGAGCCAAGGG + Intergenic
1033771470 7:144557392-144557414 TAGTGTGTGTGGAGAGCAGAAGG - Intronic
1034416302 7:150965945-150965967 GCCCAAGTCTGGACAGCAGATGG + Intronic
1035468116 7:159092917-159092939 GCCTGAGTCTTGAGAGCAGAAGG - Intronic
1035506930 8:145101-145123 GCCTATGTGTGGAGATGAGAGGG - Intergenic
1035698611 8:1620944-1620966 TTGTTTGTCTGGAGAGCAGAGGG - Intronic
1036502325 8:9325304-9325326 GCCTTTATCTCCAGAGCAGAGGG + Intergenic
1036731574 8:11270188-11270210 GCCTGTGTCTGAAATGCAGGAGG - Intergenic
1038412084 8:27366804-27366826 GGCTGTGTGTGGAGAGCAGAGGG + Intronic
1039183413 8:34891293-34891315 CCCTTGGTCTGGAGAGCACATGG + Intergenic
1039183418 8:34891336-34891358 ACCTTGGTCTGGAGAGCACATGG + Intergenic
1040489512 8:47906590-47906612 CACTGTGTCTGGAGTGCAGTGGG - Intronic
1040718853 8:50292563-50292585 GACTGTGTCTGGCGCCCAGATGG + Intronic
1043074579 8:75682313-75682335 ATCTGTGTCTGCACAGCAGAAGG - Intergenic
1044308585 8:90666282-90666304 GCCTGTGTATGGAGCAGAGAGGG + Intronic
1044820469 8:96152824-96152846 GCCTGGGTCTGGAGGCCTGAGGG - Intronic
1048052161 8:130828407-130828429 CCCTTGGTCTGGAGAGCACATGG + Intronic
1049979647 9:892429-892451 GCCTGGGTGTGTAGAGCAGAGGG - Intronic
1051255786 9:15211819-15211841 GCCTTTGGCTGGCGAGGAGAGGG - Intronic
1052108426 9:24548508-24548530 GCCTGTGTCTGGAAAGCAAAAGG + Intergenic
1053083122 9:35194064-35194086 CCCTTGGTCTGGAGAGCAAACGG - Intronic
1055490899 9:76804554-76804576 GCCTGGCTCTGGAGGGCACATGG - Intronic
1056846285 9:90040708-90040730 ACTTGTGTCCTGAGAGCAGATGG + Intergenic
1057181852 9:93034829-93034851 TCCTGTGACTGGCAAGCAGAGGG - Intronic
1057330101 9:94106313-94106335 AGCTCTGCCTGGAGAGCAGAAGG + Intronic
1058730045 9:107841001-107841023 GCCATTGACTGGAGAGCAAAGGG + Intergenic
1061652465 9:132062007-132062029 TCCTGTGTCTCCAGAGCACATGG - Intronic
1062283892 9:135764628-135764650 GCCTATGTCTGGGGGGCAGGTGG - Intronic
1203601377 Un_KI270748v1:12228-12250 GCCTATGTGTGGAGATGAGAGGG + Intergenic
1186516430 X:10169408-10169430 GCCTGTGGCTGGATATCAGGAGG + Intronic
1188702737 X:33284639-33284661 GCCTGTAACTGGAGACAAGAAGG - Intronic
1189170805 X:38907501-38907523 GCCAGTGTCTGGCCTGCAGAAGG + Intergenic
1189633093 X:42975737-42975759 CCCTTTGTCTGGAGAGCACAAGG - Intergenic
1190399230 X:50014906-50014928 CCCTGTGTGTGGACAGCAGGTGG - Intronic
1192571043 X:72205211-72205233 GCCTTTGTCTGGTGAACAGTTGG - Exonic
1192596593 X:72414743-72414765 TGCAGTGGCTGGAGAGCAGAAGG + Intronic
1192608370 X:72543384-72543406 GGCTGTGGCTGGAGAGCAGGTGG + Intronic
1193790777 X:85813167-85813189 CCCTTGGTCTGGAGAGCACATGG + Intergenic
1195734821 X:108001242-108001264 GCCTGGGTGTGGAGTGCAGAGGG - Intergenic
1195976481 X:110532887-110532909 GACTATGGCTGAAGAGCAGAAGG - Intergenic
1196613775 X:117743675-117743697 GCCTGGGTGTGGAGTCCAGAGGG - Intergenic
1197068679 X:122266928-122266950 TCCTGTGTGAGGAAAGCAGAGGG - Intergenic
1197751408 X:129966372-129966394 ACCTGTGGCTGGAGAGGTGAGGG - Intergenic
1198263306 X:134985999-134986021 CTCTGTACCTGGAGAGCAGAGGG + Intergenic
1198968164 X:142249973-142249995 GCCTGGGCGTGGAGAGGAGAGGG + Intergenic
1198968233 X:142250425-142250447 GCCTGTGTGTGGAGTGCAGAGGG + Intergenic
1199257176 X:145730074-145730096 GCATCTGTGTGGAGAGTAGAGGG - Intergenic
1199772207 X:150982489-150982511 GGGTGTGTCAGGAGAGCAGAGGG + Intronic
1199875126 X:151922584-151922606 CACTGTGTCTGTAGACCAGATGG - Intronic
1201718964 Y:17076641-17076663 GTCTGTCTCTGGAGAGCAATGGG - Intergenic