ID: 948627316

View in Genome Browser
Species Human (GRCh38)
Location 2:239277040-239277062
Sequence GAGTCCCAGGTGCCACCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 225}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948627316_948627319 26 Left 948627316 2:239277040-239277062 CCTGCTGGTGGCACCTGGGACTC 0: 1
1: 0
2: 0
3: 21
4: 225
Right 948627319 2:239277089-239277111 TCTTAACCATTCTTGAAAGCAGG 0: 1
1: 0
2: 1
3: 14
4: 207
948627316_948627320 27 Left 948627316 2:239277040-239277062 CCTGCTGGTGGCACCTGGGACTC 0: 1
1: 0
2: 0
3: 21
4: 225
Right 948627320 2:239277090-239277112 CTTAACCATTCTTGAAAGCAGGG 0: 1
1: 0
2: 1
3: 13
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948627316 Original CRISPR GAGTCCCAGGTGCCACCAGC AGG (reversed) Intronic
900485038 1:2918611-2918633 GACTCCCCAGGGCCACCAGCGGG - Intergenic
900757144 1:4443913-4443935 GAGGCCCAGGAGCCAGCAGCAGG - Intergenic
900952282 1:5864786-5864808 CGGCCCCTGGTGCCACCAGCTGG - Intronic
900970351 1:5989199-5989221 GAGCCCCAGGAGCCACCACAGGG + Intronic
901498636 1:9637649-9637671 GAGTGCCTGGAGCCACCAGAAGG - Intergenic
901941390 1:12664964-12664986 AAGACCCGGGTGCCAGCAGCTGG - Intronic
901960493 1:12822783-12822805 GAGCCCCAGGAGCCAGCAGGGGG - Intergenic
901967087 1:12877393-12877415 GAGCCCCAGGAGCCAGCAGGGGG - Intronic
901974878 1:12936529-12936551 GAGCCCCAGGAGCCAGCAGGGGG - Intronic
901982487 1:13047651-13047673 GAGCCCCAGGAGCCAGCAGGGGG - Intronic
901986533 1:13079683-13079705 GAGCCCCAGGAGCCAGCAGGGGG + Intergenic
901995279 1:13147084-13147106 GAGCCCCAGGAGCCAGCAGGGGG - Intergenic
901999600 1:13181268-13181290 GAGCCCCAGGAGCCAGCAGGGGG + Intergenic
902010296 1:13265235-13265257 GAGCCCCAGGAGCCAGCAGGGGG + Intergenic
902018078 1:13324393-13324415 GAGCCCCAGGAGCCAGCAGGGGG + Intergenic
902377256 1:16035621-16035643 GAGTCCCAGGTTCCTCCTCCAGG + Intergenic
902663229 1:17920037-17920059 GAGTCCCTGGGGCCAGCAGATGG + Intergenic
902919206 1:19656519-19656541 GACCTTCAGGTGCCACCAGCTGG - Intronic
903657471 1:24958144-24958166 GTGTACCAGGTGCCACATGCGGG + Intronic
904707279 1:32400991-32401013 GACACCCAGGTGCCACCAGATGG + Intergenic
905205201 1:36339445-36339467 TGGTGCCAGGTGCCACCCGCTGG + Intergenic
905473751 1:38211554-38211576 GACTCCAAGGTGTCACCAGAAGG - Intergenic
907074549 1:51566448-51566470 GAGCCCCAGCTGCCACCTGCTGG + Intergenic
914956460 1:152167136-152167158 GAGCCCCAGCTGTCACCAGCAGG + Intergenic
918313900 1:183306801-183306823 CTGCCCCAGGTGTCACCAGCTGG + Intronic
919907115 1:202085672-202085694 GAGGCCCCTGTGCCAGCAGCGGG - Intergenic
921263261 1:213402289-213402311 GCCTCCCAGATGCCGCCAGCTGG + Intergenic
922462855 1:225826516-225826538 GTGTCCCACGTGTCTCCAGCAGG + Intronic
923260024 1:232259523-232259545 AAGTCCCAGGTGCCACAAAAGGG - Intergenic
923280534 1:232439057-232439079 AGGGCCCAGGTGGCACCAGCAGG + Intronic
923436200 1:233970150-233970172 CAGTCCCAGGTGTCACCATAAGG - Intronic
923892954 1:238235867-238235889 GACTCCCATGTGACAACAGCAGG + Intergenic
1063947651 10:11192847-11192869 GGGTCCCAGGTGGCACCTGAAGG + Intronic
1064134277 10:12737073-12737095 GAGTCCCAGGGGCCAGGGGCTGG + Intronic
1064209937 10:13353085-13353107 GAGTCCCAGGTGCCCACGGTTGG - Intergenic
1065859357 10:29858618-29858640 GAGTCCACAGTGCCACCTGCAGG + Intergenic
1067557397 10:47282518-47282540 GAGTCCCAGGAGGCAGCACCTGG + Intergenic
1069737875 10:70669483-70669505 GAGTCCCAGATGCCCCCACAAGG - Intergenic
1069854591 10:71432923-71432945 GAGTCCCAGGTGCAAACACCAGG - Intronic
1070797453 10:79224924-79224946 GAGCCCCAGGTGTCCACAGCAGG - Intronic
1076861859 10:133141591-133141613 CAGGCCCAGGAGCCACCCGCAGG + Intergenic
1077006963 11:363013-363035 GTGTCCCAGGGTCCACCATCTGG + Intergenic
1077147110 11:1051253-1051275 GGGTGCCAGGTGCCACCTGCTGG + Intergenic
1077230375 11:1455899-1455921 GAGTCCCAGGAAGCCCCAGCAGG + Intronic
1077239294 11:1502306-1502328 GGGCCTCAGGTGCCACCAGAGGG + Intergenic
1077462051 11:2715582-2715604 GGGTCCCAGGGGACCCCAGCAGG - Intronic
1077531799 11:3100672-3100694 GGGTCCCAGGTGCGACCCTCAGG - Intronic
1078532729 11:12149505-12149527 GAGTTCCAGGTGACAGCAGGTGG + Intronic
1082767103 11:57179135-57179157 GAGCCCCAGGTGCCCCCACCTGG + Intergenic
1083633762 11:64109228-64109250 GAGGGCCAGGAGCCAGCAGCAGG + Intronic
1084154641 11:67306843-67306865 GAGGCCGGGGTGCCTCCAGCTGG - Exonic
1084548307 11:69825512-69825534 GAGTCCCTGGTGCCAGCCTCTGG - Intergenic
1084578807 11:70009383-70009405 GAGTCCCTGGTGGCATCACCTGG + Intergenic
1084666715 11:70580356-70580378 GTGTCCAGGGGGCCACCAGCAGG + Intronic
1084680404 11:70663278-70663300 GGGCCCCAGGTGCAGCCAGCTGG + Intronic
1084790633 11:71473413-71473435 CAGTCCCAGGTCCTCCCAGCTGG - Intronic
1086822617 11:91453284-91453306 CAGTGACAGTTGCCACCAGCAGG - Intergenic
1086861812 11:91933258-91933280 AAGTCCAAGTTGCCACCAACTGG - Intergenic
1088099684 11:106142115-106142137 GTGTCTCAGGTGCAACTAGCTGG - Intergenic
1088826663 11:113500992-113501014 GCCCTCCAGGTGCCACCAGCAGG - Intergenic
1088830458 11:113532177-113532199 ATGTGCCATGTGCCACCAGCAGG - Intergenic
1089595039 11:119573210-119573232 GAGTTCTTGCTGCCACCAGCAGG + Intergenic
1091520175 12:1231685-1231707 GAGTCAGAGGTGCCATCAGAGGG - Intronic
1091526939 12:1312320-1312342 GAGTCAGAGGTGCCATCAGTGGG - Intronic
1091710099 12:2733847-2733869 AAGTCCCAGTGGCCAGCAGCTGG + Intergenic
1096807077 12:54147381-54147403 CAGTCCCTGCTGCCACCACCCGG + Intergenic
1096870338 12:54588636-54588658 GAGTCCCCGGAGCCGCGAGCTGG - Exonic
1100605721 12:96150539-96150561 GAGTTTAAGGGGCCACCAGCTGG - Intergenic
1101983378 12:109426917-109426939 GAGTCCCACATGGCAACAGCTGG - Intronic
1103567440 12:121823530-121823552 GAGGACCTGGTGCCACCTGCGGG + Exonic
1104759808 12:131290050-131290072 GTGACCCAGCTCCCACCAGCTGG + Intergenic
1108044664 13:46372255-46372277 CAATCTCAGGTGCCAGCAGCAGG - Exonic
1109723922 13:66314998-66315020 GACTCCCACCTGCCACCAGCTGG - Intronic
1111930696 13:94510228-94510250 AAGGCCCAGGTCCCACCTGCAGG + Intergenic
1113711727 13:112469598-112469620 AAGTTCCAGGAGGCACCAGCTGG - Intergenic
1113888638 13:113725025-113725047 GAGCCCCAGGTGCTCACAGCAGG + Intronic
1113942223 13:114024383-114024405 GAGACCGCGGTGCCACCAGGCGG + Intronic
1116774923 14:49168011-49168033 GATTCCCAGTTTCCACCAGCAGG - Intergenic
1118890462 14:69904055-69904077 GGGGCCCAGGTGAAACCAGCAGG + Intronic
1120215534 14:81677917-81677939 GAGTGCCAGCTGCCAGCACCAGG - Intergenic
1120246274 14:82010952-82010974 GGATCCCAGGGGCCAGCAGCAGG - Intergenic
1122347126 14:101067514-101067536 GAGACCCAAGTGCCACAGGCTGG - Intergenic
1122715812 14:103696310-103696332 GAGTGCCCCGTGCCACCCGCGGG - Intergenic
1122889803 14:104727032-104727054 AAGTGCCAGGGGCCACCAGGGGG - Intronic
1123028904 14:105441328-105441350 GGGTCCCCGATGCCAGCAGCTGG - Intronic
1127715534 15:61645591-61645613 CAGTCCTGGATGCCACCAGCTGG - Intergenic
1130151325 15:81313773-81313795 GGGTCCCAGGAGCCCCCAGGAGG - Intronic
1130865656 15:87931205-87931227 CAGCCCCAAGAGCCACCAGCAGG - Intronic
1131097683 15:89666525-89666547 GAGTTCCAGGGGACAGCAGCAGG - Intronic
1131107579 15:89745273-89745295 ATGTGCCAGGTCCCACCAGCGGG + Intergenic
1131375494 15:91919486-91919508 GAGTGCCACGTGCCACCCACGGG - Intronic
1133787293 16:8983502-8983524 GTGTCCGTGATGCCACCAGCAGG + Intergenic
1137926546 16:52546817-52546839 GAGTCCCACGCGCCACCCCCGGG - Exonic
1138016783 16:53435188-53435210 GAGACCCAGGTGCCACAACCCGG - Intronic
1138245200 16:55462317-55462339 GAGTTCTAGGTGACACCATCGGG + Intronic
1140032315 16:71348561-71348583 GAGACCCAGGTGTCACTAACTGG + Intergenic
1142158231 16:88542721-88542743 AAGCACCAGGTGCCAGCAGCAGG + Intergenic
1142400352 16:89855348-89855370 GAGTCCCAGGTGCTAGAGGCTGG + Intronic
1145779615 17:27553580-27553602 CAGGCCCAGGTACCTCCAGCAGG - Intronic
1146261980 17:31427834-31427856 AATGCCCAGGTGCCACCTGCAGG - Intronic
1147982047 17:44280712-44280734 GCATCCCAGGTGCCATCAGAGGG + Intergenic
1148587285 17:48790164-48790186 GAGGCCGAGGTGCCACCTCCAGG + Intronic
1149421145 17:56511540-56511562 CAGTCATAGGTGCCACCAACAGG - Intronic
1151187554 17:72375065-72375087 GAAGGCCTGGTGCCACCAGCTGG - Intergenic
1151978121 17:77493650-77493672 GAATGCCAGGCGCCACCAGAAGG - Intronic
1153045784 18:854655-854677 GAGGCGCAGGTGCTAGCAGCTGG + Intergenic
1153378192 18:4405763-4405785 GAATCACTGGTGCCACCAACAGG + Intronic
1154151290 18:11908500-11908522 GAGACCCGGGAGCCACCCGCCGG - Exonic
1157560342 18:48640992-48641014 GAATCCCAGTTGCCGGCAGCTGG - Intronic
1158399066 18:57104502-57104524 GTGTTCCAGGTGCCACCAGGGGG + Intergenic
1160526781 18:79543153-79543175 GGGTCCCAGGAGGCACCCGCAGG + Intergenic
1160710492 19:548981-549003 GAGTCCCTGCTGCCACCACCTGG - Exonic
1161427288 19:4210486-4210508 GAGGCCCAGGTGGCTGCAGCAGG - Intronic
1161480680 19:4508854-4508876 GGGTCCCAGCTTCCGCCAGCGGG - Exonic
1161885074 19:6988319-6988341 GAATCCTAGGAGGCACCAGCTGG - Intergenic
1162030709 19:7916206-7916228 GAGTCCCAGGGGTCGCCAGGGGG + Exonic
1162119755 19:8456376-8456398 TAGTCCTAAGTGCCACCAGCAGG - Intronic
1163448280 19:17360549-17360571 GAGTCCCAGAGGCCCCCTGCAGG - Exonic
1163522547 19:17800010-17800032 TAGCCCCAGGTGGTACCAGCAGG + Intronic
1165715769 19:38044866-38044888 TAGTGCCTGGTGCCACCAACAGG + Intronic
1166344353 19:42156133-42156155 GAGCCCCAGGTGCCGAGAGCAGG - Intronic
1166781744 19:45346766-45346788 GAGAGCCAGGTGCCACGGGCAGG + Exonic
1166910980 19:46157163-46157185 GATTCTCAGGTGCAACCATCTGG - Intronic
1168243688 19:55099376-55099398 GATTCCAAGGTGGCAGCAGCGGG + Intronic
925358259 2:3258107-3258129 GAGACCGAGCAGCCACCAGCAGG - Intronic
925428715 2:3772770-3772792 GAGACCCAGGTGACAGAAGCTGG - Intronic
934861205 2:97764803-97764825 GTGGCTCAGGTGCCACCAGGTGG + Intronic
935202603 2:100870913-100870935 AAGTCCAAGGTGCCACTAGAGGG - Intronic
935694590 2:105760520-105760542 TAGAGCTAGGTGCCACCAGCAGG - Intronic
935713658 2:105920535-105920557 AATTCCCAGGTTCCCCCAGCAGG + Intergenic
936344221 2:111662969-111662991 GGGTGCCAGGAGCCCCCAGCAGG + Intergenic
937304418 2:120862404-120862426 GAGTCCCTGGAGCCCCCAGACGG - Intronic
938262112 2:129903665-129903687 AAAGCCCAGGTGCCACAAGCTGG + Intergenic
938537334 2:132257098-132257120 GAGCCCCAGGTCCCGCCATCAGG + Intronic
942402879 2:175622071-175622093 GTGTCCATGGTCCCACCAGCAGG - Intergenic
945331541 2:208545602-208545624 CAATCGCAGGTGCCTCCAGCTGG - Intronic
946813842 2:223555194-223555216 GCTTCCCAGGTGCAACCACCAGG - Intergenic
947642320 2:231713993-231714015 GGGTACCACGTGCCACCAGCAGG - Intergenic
947748881 2:232522798-232522820 GAGCCCCAGGAGCCCCCTGCCGG + Exonic
947759405 2:232592857-232592879 GAGTTCCAGCTGCCTCCTGCTGG + Intergenic
948200185 2:236124139-236124161 GCGTCCCAGGTGCGGCGAGCAGG - Exonic
948627316 2:239277040-239277062 GAGTCCCAGGTGCCACCAGCAGG - Intronic
948802405 2:240438848-240438870 CAGGCCTGGGTGCCACCAGCTGG + Intronic
948900924 2:240956580-240956602 GGGTCCCAGGTGACCCCCGCTGG - Intronic
1170379937 20:15747264-15747286 GGGACTCAGGTGCCATCAGCTGG - Intronic
1173580401 20:44142940-44142962 CAGTCCCAGGTGCCAGCACCTGG - Intronic
1175862581 20:62158085-62158107 GAGGCCCTGGTGCCCCTAGCTGG - Intronic
1180514961 22:16132117-16132139 CAGTGGCAGGTGCCACCTGCAGG + Intergenic
1181441204 22:22935973-22935995 GGGTCCCAGGGTCCACCAGAAGG + Intergenic
1181801467 22:25350595-25350617 GGGTCCCAGCGGCCACCAGGAGG - Intergenic
1182064481 22:27420784-27420806 CAGCCCCAGGTCCCACCAACAGG + Intergenic
1182277720 22:29201058-29201080 CAGTCCCGGGTGGCACCTGCCGG - Intergenic
1182841750 22:33396328-33396350 GAGTCCCAGGTAAAATCAGCAGG - Intronic
1183333475 22:37233794-37233816 GTCTCCCAGGTGGCCCCAGCAGG - Intronic
1183929993 22:41230400-41230422 GGGTCCCAGGAGACCCCAGCAGG - Exonic
1184503505 22:44887962-44887984 GTGCCCCAGGTGCCAGCAGAAGG - Exonic
1185082106 22:48715221-48715243 GAAGCCCACCTGCCACCAGCCGG + Intronic
950654395 3:14427721-14427743 GTGTCCCAGGGGCCAGCAGGTGG + Intronic
952506070 3:34007763-34007785 GAATCCCAGGAGAAACCAGCAGG - Intergenic
953702736 3:45209463-45209485 GAGTTACAGGTGCCAGCTGCTGG - Intergenic
954377850 3:50204464-50204486 AGGTCCCAGGTTCCACCAGTAGG - Intergenic
956149133 3:66222736-66222758 GACTCCCAGGTGACATCACCTGG - Intronic
957627452 3:82671977-82671999 GAGTCTCAGATGCCATCAGGAGG - Intergenic
958026706 3:88058571-88058593 GAGTCCCAGGTGCCAGCTGTGGG + Intronic
959674916 3:109023858-109023880 GAGTGACAAGTGCCACCTGCTGG - Intronic
961114045 3:124313653-124313675 GCTTCCCAGGTGACTCCAGCGGG - Intronic
968557144 4:1251340-1251362 GAGAGGCAGGTGCCACCCGCAGG - Intergenic
968664844 4:1815381-1815403 GGCTCCCCAGTGCCACCAGCTGG + Intronic
969688377 4:8689607-8689629 GGGTCCGAGGAGGCACCAGCAGG + Intergenic
969796741 4:9532899-9532921 GCGTCCTGGGTGCCCCCAGCAGG + Intergenic
970953881 4:21788052-21788074 AAGTCCCAGAAGCCAACAGCAGG + Intronic
971474429 4:27058828-27058850 CAGTCCCTGGTGTCACCACCAGG - Intergenic
973802891 4:54496381-54496403 GAGTCCCAGGTGACATCACTTGG + Intergenic
973951961 4:56025017-56025039 TAGTCCCAGGTACCAGCTGCTGG + Intronic
977890704 4:102308183-102308205 GATTCCCAGGAGGCTCCAGCTGG - Intronic
981004559 4:139861716-139861738 GAGTATCTGGAGCCACCAGCAGG - Intronic
985986580 5:3521436-3521458 AAGGCCCAGCTGCCACCACCTGG - Intergenic
986335391 5:6751221-6751243 TGTTCCCAGGGGCCACCAGCGGG - Intronic
986681343 5:10235587-10235609 GTGGCCCCGGTGCCACCAGCTGG - Intronic
990706528 5:58536040-58536062 GATTCCCAGCAGCCACCAGAAGG - Intergenic
991395832 5:66204305-66204327 GAGCCCCAGGTCCCACCATTAGG + Intergenic
991667822 5:69016943-69016965 AAGTCCCAGGTGACACCACCAGG + Intergenic
992199650 5:74370644-74370666 CAGGCCCAGGGCCCACCAGCTGG - Intergenic
996287799 5:121815367-121815389 GGGTCCTAGGAGCCACCAGCTGG - Intergenic
997629104 5:135353260-135353282 TTGTCCCAGGTGCCACCCACGGG - Intronic
998866947 5:146515092-146515114 GAGTCTCAGGAAACACCAGCTGG - Exonic
999102018 5:149033514-149033536 GAGTCCCAGCTGAAACCACCAGG - Intronic
999123378 5:149227594-149227616 GATTCCCAGGTCCCACCTCCAGG + Intronic
1001323468 5:170701798-170701820 GAGTCTCAGTTGCCAACAACAGG - Intronic
1001327260 5:170738122-170738144 GAGGCCCAGGTCCCACCTTCAGG - Intergenic
1002521412 5:179794943-179794965 GAGTCCCAGCTGCAACCTCCTGG + Intronic
1003514334 6:6805650-6805672 CACTTCCAGGTGGCACCAGCTGG - Intergenic
1006374150 6:33662686-33662708 GAGTCCGGGGTGCCAGAAGCAGG - Intronic
1008006869 6:46419735-46419757 GAGTCCCTGCTGCCATCTGCTGG - Intronic
1011495120 6:87929981-87930003 GGTTCCCATGTGCCACCTGCTGG - Intergenic
1011562620 6:88637053-88637075 CAGTCCCAGCAGCCACCATCTGG - Intronic
1013431024 6:110054901-110054923 GAACCCCAGGGGCCATCAGCTGG + Intergenic
1014251184 6:119117068-119117090 AACTACCAGGTGCGACCAGCAGG + Intronic
1014898101 6:126928614-126928636 GATTCCCAGGCACCACCAGTGGG - Intergenic
1014913532 6:127119630-127119652 GAGTCCCAAGTGCCTTCGGCTGG - Intronic
1016731412 6:147432031-147432053 GAGTCCCTAGTGCCAGCAGCAGG - Intergenic
1018895426 6:168013276-168013298 GACTGCCAGGTTCCTCCAGCTGG + Intronic
1019289073 7:241160-241182 CAGACCCAGGTGACCCCAGCAGG - Intronic
1019338994 7:499449-499471 GAGTCCCACGTGCCAGGAGGGGG + Intronic
1019496889 7:1344975-1344997 GAGTCACAGCTGTCATCAGCAGG + Intergenic
1019611682 7:1939973-1939995 GAGTCCGGGGTGGCACCAGGAGG - Intronic
1020142975 7:5622529-5622551 GAGGCCCAGGTGTGAGCAGCAGG + Intronic
1024974339 7:55099633-55099655 GAGTCCCAGGTGGACACAGCTGG - Intronic
1025615730 7:63114487-63114509 GGGTCCCAGGGGCCGCCATCGGG + Intergenic
1026380996 7:69799262-69799284 GACTCCCAGGTTCCACCAGGAGG - Intronic
1026687321 7:72522338-72522360 GATTCCCAGGCTCCACCACCTGG - Intergenic
1026739313 7:72968983-72969005 GAGAGCCACCTGCCACCAGCAGG - Intronic
1026790338 7:73327598-73327620 GAGAGCCACCTGCCACCAGCAGG - Intronic
1027104418 7:75396090-75396112 GAGAGCCACCTGCCACCAGCAGG + Intronic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1028925804 7:96355809-96355831 GAGTAGGAGTTGCCACCAGCAGG - Intergenic
1030259188 7:107544280-107544302 AGGTCCCAGGTGCCAGCAACTGG + Intronic
1032197927 7:129799917-129799939 GAGTCGCTCGTCCCACCAGCCGG + Intergenic
1033004914 7:137551216-137551238 GAGACCCAGATGCCAAAAGCTGG + Intronic
1033938171 7:146615596-146615618 GAGTCTCAGGTGCTTCCAGTTGG - Intronic
1035258407 7:157646683-157646705 GAGTCCCAGGAGCGTCAAGCAGG + Intronic
1035720250 8:1785946-1785968 GAGTCCCAGGTGTCAGCTGGTGG + Exonic
1036663731 8:10725814-10725836 GTCTCCCAGGTGACACCAACGGG - Exonic
1039581013 8:38666887-38666909 GAGCCCCAGGCTCCAGCAGCAGG - Intergenic
1039964122 8:42271489-42271511 GCGGCCCGGGTGCCACCTGCAGG + Intronic
1040073436 8:43206464-43206486 GAGTCCCGGCTCCCTCCAGCAGG - Intergenic
1041001569 8:53460017-53460039 GAGTCCAAGGACCCACCAGAAGG + Intergenic
1045185952 8:99838213-99838235 GAGCACCAGGTGCCACCTTCAGG - Intronic
1045491726 8:102675293-102675315 GAGTCTCAGTGGCCACCATCTGG + Intergenic
1047193292 8:122698388-122698410 GTTTCCCAGGTGCCCACAGCAGG + Intergenic
1049270373 8:141692530-141692552 GAGTCCCAAGTCCCAGCACCTGG - Intergenic
1050331411 9:4549812-4549834 GACTCCCAGGTTCTACAAGCAGG - Intronic
1056887638 9:90458691-90458713 GAGTCCCTGTGGCCACCTGCTGG + Intergenic
1060218334 9:121751677-121751699 AAGTCCCAGATGCCTCAAGCTGG - Intronic
1060404110 9:123364639-123364661 GAGGCCCAGCTGACTCCAGCTGG - Intronic
1061924065 9:133797381-133797403 GAGCCCCAGGTGCCATTTGCTGG - Intronic
1062029131 9:134354146-134354168 GGGTCCCAGCAGGCACCAGCAGG + Intronic
1062281028 9:135751714-135751736 GGGTCCCAGGGGACATCAGCAGG + Intronic
1062371636 9:136242299-136242321 GCTTCCCAGGAGCCTCCAGCTGG - Intronic
1062474083 9:136719017-136719039 GAGCCCCATGTGCCACCCTCCGG - Intronic
1187563726 X:20427639-20427661 GAGTCAGAGATGCCACCAGAAGG + Intergenic
1188243459 X:27815066-27815088 TGGTCCCAGGTGCCAGCACCTGG - Intronic
1188728103 X:33609668-33609690 GAGTCCTAGGGGCCACTATCAGG - Intergenic
1189291691 X:39890598-39890620 GTGTCCCAGGAGCCAGCAGAGGG + Intergenic
1198483385 X:137061860-137061882 CAGTTCCAGGTTCCACCTGCAGG + Intergenic
1201227711 Y:11834389-11834411 GAGTCCCAGCTCCCTCTAGCGGG - Intergenic
1202067957 Y:20960288-20960310 GAGTGCCAGGTGCTACATGCAGG - Intergenic