ID: 948627847

View in Genome Browser
Species Human (GRCh38)
Location 2:239280042-239280064
Sequence GCCTGTGTTTCCTAGCACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 189}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948627841_948627847 -8 Left 948627841 2:239280027-239280049 CCCCAACCCCAAAGTGCCTGTGT 0: 1
1: 0
2: 0
3: 22
4: 285
Right 948627847 2:239280042-239280064 GCCTGTGTTTCCTAGCACCCTGG 0: 1
1: 0
2: 0
3: 9
4: 189
948627838_948627847 13 Left 948627838 2:239280006-239280028 CCTGCGGAAGAGGACAGCACCCC 0: 1
1: 0
2: 0
3: 10
4: 113
Right 948627847 2:239280042-239280064 GCCTGTGTTTCCTAGCACCCTGG 0: 1
1: 0
2: 0
3: 9
4: 189
948627834_948627847 23 Left 948627834 2:239279996-239280018 CCCTTCCACTCCTGCGGAAGAGG 0: 1
1: 0
2: 1
3: 7
4: 127
Right 948627847 2:239280042-239280064 GCCTGTGTTTCCTAGCACCCTGG 0: 1
1: 0
2: 0
3: 9
4: 189
948627843_948627847 -10 Left 948627843 2:239280029-239280051 CCAACCCCAAAGTGCCTGTGTTT 0: 1
1: 0
2: 0
3: 23
4: 248
Right 948627847 2:239280042-239280064 GCCTGTGTTTCCTAGCACCCTGG 0: 1
1: 0
2: 0
3: 9
4: 189
948627840_948627847 -7 Left 948627840 2:239280026-239280048 CCCCCAACCCCAAAGTGCCTGTG 0: 1
1: 0
2: 0
3: 33
4: 313
Right 948627847 2:239280042-239280064 GCCTGTGTTTCCTAGCACCCTGG 0: 1
1: 0
2: 0
3: 9
4: 189
948627836_948627847 22 Left 948627836 2:239279997-239280019 CCTTCCACTCCTGCGGAAGAGGA 0: 1
1: 0
2: 3
3: 9
4: 151
Right 948627847 2:239280042-239280064 GCCTGTGTTTCCTAGCACCCTGG 0: 1
1: 0
2: 0
3: 9
4: 189
948627837_948627847 18 Left 948627837 2:239280001-239280023 CCACTCCTGCGGAAGAGGACAGC 0: 1
1: 1
2: 1
3: 11
4: 107
Right 948627847 2:239280042-239280064 GCCTGTGTTTCCTAGCACCCTGG 0: 1
1: 0
2: 0
3: 9
4: 189
948627839_948627847 -6 Left 948627839 2:239280025-239280047 CCCCCCAACCCCAAAGTGCCTGT 0: 1
1: 0
2: 0
3: 25
4: 285
Right 948627847 2:239280042-239280064 GCCTGTGTTTCCTAGCACCCTGG 0: 1
1: 0
2: 0
3: 9
4: 189
948627842_948627847 -9 Left 948627842 2:239280028-239280050 CCCAACCCCAAAGTGCCTGTGTT 0: 1
1: 0
2: 2
3: 28
4: 290
Right 948627847 2:239280042-239280064 GCCTGTGTTTCCTAGCACCCTGG 0: 1
1: 0
2: 0
3: 9
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948627847 Original CRISPR GCCTGTGTTTCCTAGCACCC TGG Intronic
900344344 1:2203997-2204019 GCCTGGCTCTCCGAGCACCCTGG + Intronic
901568163 1:10136343-10136365 GCCTGTGTTCCCAGCCACCCAGG + Intronic
901646926 1:10721834-10721856 GCCTCTGCTTCCTAGCAGGCAGG - Intronic
902777122 1:18682275-18682297 GCCAATGCTTCCTAGCCCCCAGG + Intronic
903219930 1:21863967-21863989 GCCTGTGGTTCAAAGCACCTGGG - Intronic
903282195 1:22256354-22256376 GCCTGTGTGTTCTTGCACCTTGG - Intergenic
905494507 1:38374196-38374218 GCCTGTGTTGCCAAGCTCTCAGG - Intergenic
907579475 1:55558667-55558689 GCCTGCATCTCCTAGCTCCCCGG + Intergenic
909752968 1:79187255-79187277 GCATATGTTTTCTAGCATCCTGG + Intergenic
910763868 1:90761512-90761534 GCCTGACTTTCCTAGATCCCAGG - Intergenic
912269511 1:108194494-108194516 GCCTGTTTTCCTTATCACCCTGG - Intronic
913609115 1:120493284-120493306 GCCTTTGCTGCCTAGCACCTGGG + Intergenic
914204713 1:145517165-145517187 GCCTTTGCTGCCTAGCACCTGGG - Intergenic
914343795 1:146781285-146781307 GCTCTTGTTTCCTAGCATCCTGG + Intergenic
914370848 1:147023062-147023084 GCCTTTGCTGCCTAGCACCTGGG + Intergenic
914483836 1:148090352-148090374 GCCTTTGCTGCCTAGCACCTGGG - Intergenic
915477301 1:156160801-156160823 GCCTGTGTGTCCTGGCCTCCAGG + Intronic
917444511 1:175095832-175095854 GCCTGTATTTCCCAGCACTTTGG - Intronic
920423962 1:205858451-205858473 GCCTGTGGTTCCTAGAACAAGGG + Intergenic
923437540 1:233982045-233982067 GCCTGTGGTTCCAACCACTCAGG - Intronic
1065255990 10:23868410-23868432 GCCTGTCTTTCTTAGAGCCCTGG - Intronic
1065381439 10:25095583-25095605 GCCTGTGTTCCCCAGGACACAGG + Intergenic
1066470181 10:35690277-35690299 ACCTGTGTGTCCTAAAACCCTGG - Intergenic
1067266072 10:44746467-44746489 GCCTGTGATTCCCAGCACTTTGG + Intergenic
1067468404 10:46518494-46518516 GGCAGTGTTTCCTAGTGCCCAGG + Intergenic
1068655386 10:59569560-59569582 GCCTGTGAGTCCTAGCTACCAGG + Intergenic
1070344317 10:75526729-75526751 GCCTGTGGTTCCTATTACTCTGG + Intronic
1071167741 10:82826479-82826501 ATGTGTGTTTCCTAACACCCAGG - Intronic
1072984742 10:100129794-100129816 GCCTGTCTTTCCTAGCTTTCGGG + Intergenic
1074546726 10:114407107-114407129 GCCTGTATTTCCCAGCACTTTGG + Intergenic
1074903605 10:117840587-117840609 AACTGTGTTTCCTAGCCTCCTGG - Intergenic
1077130218 11:968318-968340 GCCTAAGTTTCCCAGCACCCGGG + Intronic
1077344766 11:2041516-2041538 GCCTGTGCTGCCCAGAACCCTGG - Intergenic
1077432331 11:2522030-2522052 TCCTGTGTTCCCGGGCACCCGGG + Intronic
1081859313 11:46323452-46323474 GCCTGTAATCCCAAGCACCCTGG + Intergenic
1082078892 11:47996696-47996718 GCCAGTGTTGCCATGCACCCAGG + Intronic
1084083090 11:66842070-66842092 GCCTGTGGTTCCTGGTACTCTGG + Intronic
1084639797 11:70418409-70418431 GCCTGTGCTCCCTGGCTCCCTGG - Intronic
1088909908 11:114183073-114183095 GCCTGTCTTTGCTCTCACCCTGG + Intronic
1090081274 11:123614488-123614510 GCCTGTGTATCCTAGCTACATGG + Intronic
1090865317 11:130695387-130695409 GCCTGTGGTTCAGGGCACCCTGG + Intronic
1091195396 11:133726663-133726685 ACCTGGGTTTCCCAGCACCTTGG - Intergenic
1202827752 11_KI270721v1_random:96706-96728 GCCTGTGCTGCCCAGAACCCTGG - Intergenic
1092673058 12:10884897-10884919 GCCTGTGTTGTATAGCACCAAGG - Intronic
1092925923 12:13272117-13272139 GCCTATATTTCCTAGTACACAGG - Intergenic
1097197997 12:57254883-57254905 GGCTGTGTTCCCCAGCCCCCTGG - Exonic
1097412121 12:59268135-59268157 GCCTGTGGTTCCTAGCATGCTGG - Intergenic
1098261167 12:68672659-68672681 GCCTGTGGTTCCAGCCACCCAGG + Intergenic
1100633044 12:96407427-96407449 GCCTGTAATTCCCAGCACCTTGG + Intergenic
1101886371 12:108666670-108666692 GCCTGTGTCTTCTGACACCCAGG - Intronic
1103887575 12:124214394-124214416 GCCTGAGTTTCCTAGACCTCAGG + Intronic
1105547386 13:21360786-21360808 CCCTGTGTTGCCTGCCACCCTGG + Intergenic
1106136665 13:26978680-26978702 GCCTGTCTCTCTCAGCACCCAGG + Intergenic
1106411807 13:29515823-29515845 GCCTGTGCCTCCTGGCCCCCTGG - Intronic
1108370049 13:49760288-49760310 GCCTGTGATTCCAACTACCCAGG + Intronic
1112609293 13:100940222-100940244 CTCTGTGTTTCCTAGAACCAAGG - Intergenic
1112799995 13:103100026-103100048 GCCTGAGGATCCTAGAACCCTGG + Intergenic
1121303739 14:92891925-92891947 GCCTGGGACTCCTGGCACCCTGG + Intergenic
1121539945 14:94718062-94718084 GCCTGTATTCCCTAGCACTTTGG + Intergenic
1127707715 15:61563645-61563667 TCCTTTGTTTCCAATCACCCTGG + Intergenic
1128392045 15:67188915-67188937 GGCTGTGTTCCCTGACACCCTGG - Intronic
1132107295 15:99072182-99072204 GCCTGTGTTTCTTTGTACCTGGG + Intergenic
1132844551 16:1993804-1993826 GCTTGTCTTGCCTGGCACCCAGG - Exonic
1134494556 16:14722298-14722320 GTCTCTGTTTCCTAGCATTCTGG + Intronic
1135740755 16:24973362-24973384 TCCTGTGTTTTCTAGAGCCCTGG + Intronic
1135815788 16:25632199-25632221 GCCTGTGATTTCTAGCCACCTGG - Intergenic
1136048233 16:27632278-27632300 GGCTGTGTTTCCTAGCCTGCCGG - Intronic
1138683925 16:58708145-58708167 GTCTCTGTTTCCTCGCACCAGGG + Exonic
1141453258 16:84119831-84119853 CCCTTTCTTTCCCAGCACCCTGG - Intergenic
1142247678 16:88977286-88977308 GCATGTGTTTCCTCGGCCCCAGG + Intergenic
1143268035 17:5655164-5655186 GGATGTGTTTCCTACCAACCAGG + Intergenic
1144060172 17:11576161-11576183 GCATGTGTTGACCAGCACCCTGG - Intergenic
1144802490 17:17939930-17939952 GCCTGTAAATCCTAGCACTCTGG + Intronic
1145806829 17:27740305-27740327 GCCTGTGTCTCCTTGGGCCCTGG + Intergenic
1147536414 17:41325465-41325487 GCCTTGCCTTCCTAGCACCCGGG + Intergenic
1147907698 17:43833383-43833405 GCCTGTGTCCCCCCGCACCCTGG + Intergenic
1148984454 17:51609567-51609589 GTCTGTGTTTCCTGTGACCCAGG - Intergenic
1149902585 17:60493895-60493917 GCCTGTAGTTCCTAGCACTTTGG - Intronic
1149966851 17:61173188-61173210 GCCTGTTATTCCTAGCACTTTGG + Intronic
1150725810 17:67650419-67650441 GCCTATGGTTTCTAGCCCCCAGG - Intronic
1152608839 17:81305918-81305940 ACCTGTGCTTCCCAGCACCTCGG - Intergenic
1154486012 18:14871630-14871652 GCCTGTAAATCCTAGCACCTGGG + Intergenic
1155206861 18:23566270-23566292 GCCTGTGGTTCCAACTACCCAGG + Intronic
1157076811 18:44475807-44475829 GCCTATGGGACCTAGCACCCTGG + Intergenic
1157146973 18:45173766-45173788 GGCTCTGTTTGCTAGCAACCTGG + Intergenic
1157661457 18:49448618-49448640 CCCTGTGTTTCCTGGGTCCCAGG - Intronic
1158198106 18:54910625-54910647 TGCTGTGGTTCATAGCACCCAGG + Intronic
1160027485 18:75230373-75230395 TCCTGTATTTCCTGGCACTCAGG - Intronic
1160754636 19:751066-751088 GCCTCTGTTCCCTGGCAACCTGG + Intergenic
1160858868 19:1229308-1229330 GCCTGTGCGTCCTACCATCCGGG - Exonic
1163713484 19:18860811-18860833 GCCTGGGTTTCTTAGGACCGAGG + Exonic
1163763746 19:19150990-19151012 GCCTGTGATCCCTAGCACTTTGG + Intronic
1166673734 19:44726606-44726628 ACCTGTATTTCCCAGCACTCTGG + Intergenic
1168255961 19:55165506-55165528 TCCTGGGTCTCCTAGGACCCAGG - Intronic
1168405594 19:56108620-56108642 CCATGTGGTCCCTAGCACCCAGG + Intronic
925871906 2:8278935-8278957 GCCTGGGTTTCCCAGCAGCCAGG + Intergenic
927775396 2:25899010-25899032 GCCTGTAATTCCTAGCACTTTGG + Intergenic
928084908 2:28339933-28339955 TCCTGTGTTCTCTGGCACCCAGG + Intergenic
929944229 2:46358296-46358318 GCCAGTGTACCCTAGGACCCAGG - Intronic
931264908 2:60652095-60652117 GCCTGGGTTTCCTCGCAGCATGG + Intergenic
931420431 2:62122049-62122071 GCCTATATTTCCTAGCACTTTGG - Intronic
933762321 2:85680805-85680827 GGCTGTGTCCCCTAGCACCCTGG - Intergenic
934579075 2:95424047-95424069 GCCTGTGTTGCTTGACACCCTGG - Intergenic
934600372 2:95652656-95652678 GCCTGTGTTGCTTGACACCCTGG + Intergenic
935197327 2:100825117-100825139 GCCTGTGTTTTCTGGAAGCCTGG - Intronic
936533734 2:113294718-113294740 GCCTGTGTTGCTTGACACCCTGG + Intergenic
937970541 2:127545831-127545853 GCCTGTGAATCCTTGGACCCTGG + Intronic
941664070 2:168226305-168226327 TCCTGGGTTTTCTAGCATCCTGG - Intronic
946415734 2:219538844-219538866 GCCTGCCTTTCCTTTCACCCGGG - Intergenic
947195152 2:227556808-227556830 GCCTGTGAGTCCTAGCTACCTGG + Intronic
947533735 2:230928176-230928198 GCGTGTGTTCCCTGGGACCCCGG - Intronic
948062043 2:235049241-235049263 ACCTGTGTTTCCCAGGACCTTGG + Intronic
948627847 2:239280042-239280064 GCCTGTGTTTCCTAGCACCCTGG + Intronic
1169367949 20:5006355-5006377 GCCTGTAATTCCTAGCACTTTGG - Intronic
1169416066 20:5417221-5417243 GCCTGTGATTCCAGGCACTCAGG + Intergenic
1170500882 20:16974600-16974622 GGCTGTGCTTCCTTGCAGCCTGG - Intergenic
1170537985 20:17360587-17360609 CCCTGTGTATCCCAGCTCCCAGG - Exonic
1172972174 20:38881544-38881566 GCCCCTGCTTCCAAGCACCCTGG - Intronic
1173642393 20:44613107-44613129 GACTGTGTTACCAAGCACCAGGG + Intronic
1174005289 20:47405997-47406019 GCCTGTGCTTCCTGGTACTCAGG - Intergenic
1175453605 20:59092371-59092393 GCCCCTGTTTCCAAGGACCCAGG + Intergenic
1175801866 20:61805530-61805552 GCCTGTGTTTCCTCGCAGGAGGG - Intronic
1179413156 21:41177718-41177740 TCCTTTGTTTACTAGCAGCCTGG - Intronic
1180672285 22:17562399-17562421 GCCTGTAATTCCTAGCACTTCGG - Intergenic
1181572420 22:23774820-23774842 CGCAGTGTTTCCTGGCACCCTGG + Intronic
1182089397 22:27583804-27583826 GAGGGTGTTTCCAAGCACCCTGG - Intergenic
1183812090 22:40266074-40266096 GCCAGTGTTTGAGAGCACCCTGG - Exonic
1184992502 22:48180359-48180381 GCCTTGGTTCCCTAGCTCCCGGG - Intergenic
1184999658 22:48237590-48237612 GCCTGTGCCTCCCAGCACCCAGG - Intergenic
1185012476 22:48322215-48322237 GCCTGTGAGTCCTAGGGCCCAGG + Intergenic
1185012564 22:48322517-48322539 GCCTGTGAGTCCTAGGGCCCAGG + Intergenic
1185072842 22:48666785-48666807 GCCTGTGTCTCCCAGCAGGCTGG - Intronic
1185248360 22:49785510-49785532 ACCTGGTTTTCCAAGCACCCCGG - Intronic
949943880 3:9175061-9175083 GCCTGTGTTCCTAAGCATCCCGG - Intronic
950186964 3:10951338-10951360 GCCTGGGATTCCAAGGACCCAGG - Intergenic
950468189 3:13167959-13167981 GCCTGTGTTCCCTTCCAGCCGGG - Intergenic
953657338 3:44864100-44864122 GACTGTGGTTGCTGGCACCCAGG - Intronic
955420306 3:58729756-58729778 GCCTGTAATTCCTAGCACTTTGG + Intronic
955624624 3:60904679-60904701 GCCTGTACTTCCTAGCACTTTGG + Intronic
956225438 3:66952217-66952239 GCCTGTCTTCCCTAGTGCCCTGG - Intergenic
958949089 3:100398121-100398143 GCCTGTAATTCCTAGCACTTTGG + Intronic
959580921 3:107981731-107981753 TGCTGTGTTTCCTGGCACACTGG + Intergenic
963353257 3:144178203-144178225 GTGTGTGTTTCCTAACTCCCTGG - Intergenic
966985454 3:185175837-185175859 GCCTGTGTTTCCCCGCAGGCAGG + Intergenic
971328166 4:25661343-25661365 GCGTGTTTTACCTACCACCCAGG - Intronic
972521236 4:39859304-39859326 GACTGGGTTTCCTGTCACCCAGG + Intronic
976564930 4:86542213-86542235 GCCTTTGTCTCTTGGCACCCTGG + Intronic
977088886 4:92643717-92643739 ACCTGTGATTCCTAGCACTTTGG - Intronic
977305649 4:95320159-95320181 GCCTGTGTATCCCAGCACTTTGG + Intronic
980140711 4:128913293-128913315 GCCTGTGTTTCCTGTCAACTTGG - Intronic
980894153 4:138845366-138845388 ACCTGTGTTTTCTAGCCCCTTGG - Intergenic
983500481 4:168493816-168493838 GCCTGAGTTTCCTAGCTTCATGG - Intronic
985048759 4:185969454-185969476 GCATGTGTATCCCAGCACCTGGG - Intergenic
986767661 5:10942201-10942223 GCCTGTGTTGCCCAGCCCTCGGG + Intergenic
988861726 5:35288078-35288100 GCCTGTGGTTCCTGGGAACCAGG + Intergenic
992957615 5:81926228-81926250 GCGTGTGTGTGCTAGCACCATGG - Intergenic
993179635 5:84535388-84535410 CCCTGTGTTTCCAATCACCCTGG - Intergenic
997623329 5:135314769-135314791 GCCTGTGTTTCCTATCACAGAGG - Intronic
999097307 5:148991450-148991472 TCCTGTATTTCCCAGGACCCAGG + Intronic
999976583 5:156917652-156917674 GCCAGTTTTTCCAAGTACCCAGG + Intergenic
1002301829 5:178261801-178261823 GCCTGTCCTTCTTAGCATCCTGG + Intronic
1002917442 6:1540656-1540678 GCCTGTGTTTCTTATATCCCGGG - Intergenic
1003339150 6:5203179-5203201 GCCTGTATTTCCGAGCATCATGG - Intronic
1005894098 6:30163481-30163503 TCTTGTGTTCCCTAGAACCCTGG - Exonic
1006878611 6:37319776-37319798 GCCTGTCTAGCCTAACACCCAGG - Intronic
1009476804 6:64102116-64102138 ACCAGGGGTTCCTAGCACCCGGG - Intronic
1010615810 6:78010861-78010883 GCTTGTGTTTTCTCTCACCCAGG - Intergenic
1011370258 6:86629538-86629560 CTCTGTCTTTCCTAGCACCAAGG - Intergenic
1013088049 6:106873614-106873636 TGTGGTGTTTCCTAGCACCCAGG - Intergenic
1015090176 6:129346709-129346731 GCCTGTGTTTCCTAGCCTTCTGG + Intronic
1016769579 6:147834477-147834499 TCCTGTGTTTCTTATCACTCCGG - Intergenic
1025201276 7:56963290-56963312 GCCTGTATTTCCCAGCACTTTGG + Intergenic
1025670668 7:63613643-63613665 GCCTGTATTTCCCAGCACTTTGG - Intergenic
1025753635 7:64313983-64314005 GCCTTTGTCTCCTAGCTTCCGGG + Intronic
1030139509 7:106290629-106290651 TCCTGTGTCTCCTAGCCCTCCGG + Intergenic
1032635232 7:133699657-133699679 GCCTGTCTTTCATCGCATCCTGG + Intronic
1034896657 7:154880518-154880540 GCCTGTGACTCCAAGCACGCGGG - Intronic
1036682520 8:10885919-10885941 GCCTGTGTTTCCTGACACTCAGG - Intergenic
1037521810 8:19686995-19687017 GCTTGTGTTTCCTAGCATATGGG - Intronic
1040395635 8:46997551-46997573 GTCCGTGTTACCTGGCACCCAGG - Intergenic
1045200975 8:99980825-99980847 GCCTGGGTTTTCTAGTAACCAGG - Intronic
1045349563 8:101325828-101325850 ACCTGTATTTCCTAGCACTTTGG - Intergenic
1045351409 8:101344096-101344118 TCCTGGGTCTCCTAACACCCAGG + Intergenic
1046178686 8:110613587-110613609 GCATGTGGTTCCAAGAACCCTGG + Intergenic
1046220808 8:111211712-111211734 GCCTAGGTTTCCTTGCACCTTGG - Intergenic
1047367842 8:124228613-124228635 GCCTGATTCTCCTGGCACCCTGG - Intergenic
1048344900 8:133569142-133569164 GCCTTTGTTGCCTACCTCCCTGG - Intronic
1048419270 8:134261214-134261236 GACTGTCTTTAATAGCACCCAGG - Intergenic
1049320178 8:141992098-141992120 GCCTGTGTTTCAGAGGACTCTGG - Intergenic
1049340699 8:142111047-142111069 GGCTGTCTTTCCTATCAGCCTGG + Intergenic
1055250009 9:74292823-74292845 GCCTGTGGCTCCCAGCACCTTGG + Intergenic
1057006275 9:91563503-91563525 GCCTGTGGTTCCAAGTACCTGGG + Intronic
1057873181 9:98733346-98733368 GGCATTGTTTCCCAGCACCCAGG - Exonic
1061163079 9:128907096-128907118 GCCTGGCTTTCCTAGGACCAGGG - Intronic
1185630298 X:1511995-1512017 GCCTTTTTTTCCTAGCTCCTTGG + Intronic
1188916985 X:35923559-35923581 GCCTGTGATTCCCAGCACTTTGG + Intronic
1190240742 X:48655972-48655994 CCCTCTGTTGCCCAGCACCCAGG + Intergenic
1196706412 X:118721220-118721242 GCCTCTGTGTCTTAGCATCCAGG - Intergenic
1201474656 Y:14367210-14367232 TCCTGTGTGTCCTAGCTCCTGGG - Intergenic