ID: 948628325

View in Genome Browser
Species Human (GRCh38)
Location 2:239284364-239284386
Sequence CTGGGTCAGCACAGTGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 506
Summary {0: 1, 1: 0, 2: 9, 3: 63, 4: 433}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948628325_948628340 28 Left 948628325 2:239284364-239284386 CCTGAGCCACTGTGCTGACCCAG 0: 1
1: 0
2: 9
3: 63
4: 433
Right 948628340 2:239284415-239284437 GGACCCTCCGCGGGGCCTCGGGG 0: 1
1: 0
2: 1
3: 9
4: 141
948628325_948628339 27 Left 948628325 2:239284364-239284386 CCTGAGCCACTGTGCTGACCCAG 0: 1
1: 0
2: 9
3: 63
4: 433
Right 948628339 2:239284414-239284436 GGGACCCTCCGCGGGGCCTCGGG 0: 1
1: 0
2: 2
3: 15
4: 183
948628325_948628333 7 Left 948628325 2:239284364-239284386 CCTGAGCCACTGTGCTGACCCAG 0: 1
1: 0
2: 9
3: 63
4: 433
Right 948628333 2:239284394-239284416 CAACAGCATGCTCCATCACGGGG 0: 1
1: 0
2: 0
3: 8
4: 49
948628325_948628332 6 Left 948628325 2:239284364-239284386 CCTGAGCCACTGTGCTGACCCAG 0: 1
1: 0
2: 9
3: 63
4: 433
Right 948628332 2:239284393-239284415 CCAACAGCATGCTCCATCACGGG 0: 1
1: 0
2: 0
3: 11
4: 130
948628325_948628330 5 Left 948628325 2:239284364-239284386 CCTGAGCCACTGTGCTGACCCAG 0: 1
1: 0
2: 9
3: 63
4: 433
Right 948628330 2:239284392-239284414 GCCAACAGCATGCTCCATCACGG 0: 1
1: 0
2: 1
3: 5
4: 109
948628325_948628336 19 Left 948628325 2:239284364-239284386 CCTGAGCCACTGTGCTGACCCAG 0: 1
1: 0
2: 9
3: 63
4: 433
Right 948628336 2:239284406-239284428 CCATCACGGGGACCCTCCGCGGG 0: 1
1: 0
2: 1
3: 8
4: 70
948628325_948628338 26 Left 948628325 2:239284364-239284386 CCTGAGCCACTGTGCTGACCCAG 0: 1
1: 0
2: 9
3: 63
4: 433
Right 948628338 2:239284413-239284435 GGGGACCCTCCGCGGGGCCTCGG 0: 1
1: 0
2: 0
3: 17
4: 192
948628325_948628337 20 Left 948628325 2:239284364-239284386 CCTGAGCCACTGTGCTGACCCAG 0: 1
1: 0
2: 9
3: 63
4: 433
Right 948628337 2:239284407-239284429 CATCACGGGGACCCTCCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 100
948628325_948628334 18 Left 948628325 2:239284364-239284386 CCTGAGCCACTGTGCTGACCCAG 0: 1
1: 0
2: 9
3: 63
4: 433
Right 948628334 2:239284405-239284427 TCCATCACGGGGACCCTCCGCGG 0: 1
1: 0
2: 0
3: 9
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948628325 Original CRISPR CTGGGTCAGCACAGTGGCTC AGG (reversed) Intronic
900223532 1:1522320-1522342 CTGGCTGGGCACAGTAGCTCAGG - Intronic
900360141 1:2284369-2284391 CTGGGTCAGCACAGTAGAGGCGG + Intronic
900654082 1:3746654-3746676 CTGATTGAGCACAGTGACTCTGG - Intergenic
901930164 1:12592035-12592057 ATGGGTCAGCACAGTGCCCAGGG + Intronic
902047882 1:13539518-13539540 GTGGCTGGGCACAGTGGCTCAGG - Intergenic
902360235 1:15938395-15938417 CTGGCCAGGCACAGTGGCTCAGG - Intronic
903064260 1:20689906-20689928 GTGGGTGAGAACACTGGCTCTGG + Intronic
903138915 1:21326940-21326962 CTGTGTTTGCACAGTGGCTCTGG + Intronic
903863052 1:26376906-26376928 CTGGATCAGCAGAGTGACTCTGG + Intergenic
904647329 1:31977743-31977765 TAGGGACAGCACAGTGGCCCGGG + Intergenic
904659334 1:32073048-32073070 ATGGGTGAGCAGAGCGGCTCAGG + Exonic
904825500 1:33271430-33271452 CTGGGTCAGGTCCCTGGCTCTGG + Intronic
905206529 1:36345797-36345819 CCAGGTCAGGACAGAGGCTCGGG - Intronic
905431056 1:37924057-37924079 TTGGCTGGGCACAGTGGCTCAGG - Intronic
905934319 1:41811630-41811652 ATGGTTCAGGACAGTGTCTCTGG - Intronic
907237676 1:53062865-53062887 CTGGGGCGGCACAGTGGCCGGGG - Intronic
907333422 1:53685854-53685876 ATGGCTCAGCACAGTGGCAGCGG - Intronic
907554674 1:55333899-55333921 GTGGGTCAGCTGAGTGTCTCGGG - Intergenic
908573594 1:65435646-65435668 TTGGCTGGGCACAGTGGCTCAGG - Exonic
908842374 1:68293201-68293223 GTGGGGCGGCTCAGTGGCTCTGG - Intergenic
910272299 1:85409997-85410019 TTAGCTGAGCACAGTGGCTCAGG + Intronic
910652129 1:89581008-89581030 CTGGCCAGGCACAGTGGCTCAGG + Intronic
911594544 1:99785397-99785419 CTGGCTGGGCACAGTGGCTCAGG - Intergenic
912555164 1:110510767-110510789 CTGGGACAGCAGAGTGGCTGAGG - Intergenic
912558126 1:110530779-110530801 ATGGTTCAGCACATAGGCTCTGG + Intergenic
912797262 1:112700775-112700797 CAGGGTCAGCTTAGGGGCTCAGG - Intergenic
912810324 1:112789436-112789458 CTGGGTCAGCAAAGGAGCTGAGG - Intergenic
912986069 1:114432503-114432525 CTGGCCGGGCACAGTGGCTCAGG + Intronic
913113548 1:115677059-115677081 CTGAGTCTGCACAGAGGCTGTGG - Intronic
914244393 1:145874930-145874952 CCGCGTCAGCTCCGTGGCTCAGG + Exonic
915314893 1:155022940-155022962 CTGTGTCAGCACCGTGGCCCAGG - Intronic
915806964 1:158864422-158864444 CTGGTTCATCACATTGGGTCCGG + Intergenic
916094527 1:161337160-161337182 GTGGGCAGGCACAGTGGCTCAGG - Intronic
916732900 1:167582106-167582128 CTAGGTCAGAAAACTGGCTCAGG + Intergenic
917412335 1:174772294-174772316 TTTGGTCAGGGCAGTGGCTCAGG + Intronic
917817064 1:178721939-178721961 TAGGGCCGGCACAGTGGCTCAGG - Intergenic
918068760 1:181119656-181119678 CTGGATTAGGACAGTGGCCCAGG + Intergenic
918068925 1:181120896-181120918 CTGGATTAGGACAGTGGCCCAGG - Intergenic
918304060 1:183229657-183229679 CTGGGTGTCCAGAGTGGCTCTGG - Intronic
919061755 1:192642606-192642628 TAGGCTCAGCACTGTGGCTCAGG - Intronic
920969379 1:210730092-210730114 CTGTGTCATCACAGTTGCTCTGG - Intronic
921094562 1:211875184-211875206 CTGCTGCAGCACACTGGCTCTGG - Intergenic
921254748 1:213329326-213329348 CTGGGTGAGCAGCTTGGCTCTGG + Intergenic
921343176 1:214154513-214154535 CTGGGTCATCTTAGTGGCTCTGG + Intergenic
922149018 1:222980801-222980823 TTGGCTGGGCACAGTGGCTCAGG + Intronic
922818581 1:228469158-228469180 CAGGTGCAGCACGGTGGCTCAGG + Intergenic
922989008 1:229889213-229889235 CTGGGTCTGATAAGTGGCTCAGG - Intergenic
924221859 1:241885384-241885406 CTTGCTCAGCCCACTGGCTCTGG - Exonic
924421239 1:243912112-243912134 CTGGCTGGGCACAATGGCTCAGG + Intergenic
924614985 1:245605406-245605428 CCGGGTCACCACAGTGGCTGCGG - Intronic
924771598 1:247085214-247085236 CTGGGCCATCAAAATGGCTCTGG - Intergenic
1063012192 10:2034683-2034705 CTAGGCCAGCACAGTGGCTCAGG - Intergenic
1063125557 10:3133710-3133732 TTGGCTGGGCACAGTGGCTCAGG - Intronic
1063877967 10:10499596-10499618 CTGGCTGGGCACAGTGACTCAGG + Intergenic
1064458759 10:15512811-15512833 CAAGTCCAGCACAGTGGCTCTGG - Intergenic
1065000416 10:21333174-21333196 TTGGCTGCGCACAGTGGCTCAGG + Intergenic
1065054717 10:21833188-21833210 CTGGCTGGGCGCAGTGGCTCAGG + Intronic
1065116491 10:22488253-22488275 CTAGCTGGGCACAGTGGCTCAGG - Intergenic
1065302524 10:24335938-24335960 TTGGCTGAGCGCAGTGGCTCAGG + Intronic
1065316570 10:24469891-24469913 CTGCCTGGGCACAGTGGCTCAGG - Intronic
1065561491 10:26968414-26968436 CAGGGTGAGCACAGGGGCTGTGG - Intergenic
1066043018 10:31570199-31570221 GTGGCTGGGCACAGTGGCTCAGG + Intergenic
1066616707 10:37302118-37302140 CTGTGTCAGCGCAGTGCCTCAGG + Intronic
1067182250 10:43997148-43997170 CAGGCTGGGCACAGTGGCTCAGG + Intergenic
1067524373 10:47029332-47029354 CTGGGGCTGCACAGAGGCTGTGG - Intergenic
1067836763 10:49646299-49646321 CTGGGGTAGGACAGAGGCTCAGG + Intronic
1068665505 10:59671243-59671265 CTGGGTCAGAAAACAGGCTCAGG - Intronic
1069437660 10:68400059-68400081 TTGGCCCAGCGCAGTGGCTCAGG - Intronic
1069873305 10:71546374-71546396 CTTGCTCACCACAGTAGCTCCGG - Intronic
1070191633 10:74116803-74116825 CTTGGTCAGCAAAGGGACTCAGG - Intronic
1070384592 10:75913175-75913197 CTGGCTGGGTACAGTGGCTCAGG + Intronic
1071109847 10:82143048-82143070 TTGGCTGGGCACAGTGGCTCAGG - Intronic
1072094805 10:92167623-92167645 CAAGGTGGGCACAGTGGCTCAGG + Intronic
1072124017 10:92429706-92429728 CTGGCCCAGCACGGTGGCTCAGG - Intergenic
1072214941 10:93280274-93280296 CTGGGTCAGCTCAGTTTCTCTGG + Intergenic
1072218065 10:93304769-93304791 CTGGCCAGGCACAGTGGCTCAGG + Intergenic
1072453042 10:95554381-95554403 GTGGGGGTGCACAGTGGCTCAGG + Intronic
1072469699 10:95701073-95701095 CTGGCTGGGCACGGTGGCTCAGG - Intergenic
1072708517 10:97699774-97699796 CTGGCTGGGCATAGTGGCTCAGG - Intergenic
1072840875 10:98772392-98772414 CTGGATCTGCAAATTGGCTCGGG - Intronic
1072924848 10:99608191-99608213 CTGGCTCTCCACAGAGGCTCTGG + Intergenic
1074136703 10:110633780-110633802 TTGGCTGGGCACAGTGGCTCAGG + Intergenic
1074986610 10:118665128-118665150 CTAGGTCAGCAGTGTGTCTCTGG + Intergenic
1075689242 10:124384697-124384719 GTGGGGCAGCACACTGGCTACGG - Intergenic
1076874144 10:133207771-133207793 CTCGGTGTGCACACTGGCTCAGG + Intronic
1077661385 11:4071619-4071641 ATGGCTGGGCACAGTGGCTCAGG - Intronic
1078399386 11:11010655-11010677 CTGGGACAGGACAGAGGCTCCGG + Intergenic
1079310592 11:19362006-19362028 GTGAGTGAGGACAGTGGCTCTGG + Intronic
1080483460 11:32677995-32678017 CAGGCCGAGCACAGTGGCTCAGG + Intronic
1080845183 11:36020760-36020782 CTGGGTCAGCAGAGGTGCCCTGG - Intronic
1080875979 11:36274597-36274619 CTGGGTCATGGCAGTGGCCCTGG + Exonic
1081740002 11:45432332-45432354 CTGGGCCAGCACATGGGGTCAGG - Intergenic
1081756497 11:45548524-45548546 CCAGCCCAGCACAGTGGCTCAGG + Intergenic
1081945216 11:46986747-46986769 CTGGCCAGGCACAGTGGCTCAGG - Intronic
1083404213 11:62445570-62445592 CTGGCCAGGCACAGTGGCTCAGG + Intronic
1083585852 11:63858632-63858654 CTGGCCAGGCACAGTGGCTCAGG - Intronic
1084470672 11:69357309-69357331 CTGGGTCAGATAAGTGTCTCAGG + Intronic
1085122410 11:73975545-73975567 CTGGGCCAGTACAGTAGCGCTGG - Exonic
1085317244 11:75553054-75553076 CTGGCTCGGAACAGTTGCTCAGG + Intergenic
1085721496 11:78915969-78915991 GTGGGTAAGCACTGTGGCTCAGG + Intronic
1085750416 11:79156180-79156202 CTGGGCTTGCACTGTGGCTCCGG + Intronic
1087900329 11:103633059-103633081 TAGGCTGAGCACAGTGGCTCAGG - Intergenic
1088214352 11:107491532-107491554 CTGGGTCTGTAAACTGGCTCAGG + Intergenic
1088246973 11:107828153-107828175 CTGGCTGGGCACAGTGGCTCAGG + Intronic
1088963645 11:114696053-114696075 CAGGCTGAGCTCAGTGGCTCAGG + Intronic
1089666670 11:120024973-120024995 CTGGCTGGGCACAGTGGCTCAGG + Intergenic
1089931000 11:122311993-122312015 TTGGCTGAGCACAGAGGCTCAGG + Intergenic
1090258094 11:125299811-125299833 CTGGCTCAGAACCGAGGCTCAGG - Intronic
1090650427 11:128801306-128801328 CTGGGTCAGCTCCCTGGTTCAGG + Intronic
1091147145 11:133289876-133289898 CTGGGTCTGCACAGGTGCTGGGG + Intronic
1091172176 11:133528969-133528991 CTTGGGCAGCACTGTGCCTCAGG + Intronic
1091470377 12:721115-721137 ATGGCCCAGCCCAGTGGCTCAGG - Intergenic
1091963195 12:4716802-4716824 CTGGCTGGGCACGGTGGCTCAGG - Intronic
1092192818 12:6533230-6533252 CTGGGCCAGCAAAGAGGCCCGGG + Intergenic
1092381119 12:7998015-7998037 CTGGGTCTGTAAACTGGCTCAGG - Intergenic
1094011496 12:25814868-25814890 CAGGCTGGGCACAGTGGCTCAGG - Intergenic
1094529779 12:31263284-31263306 CTGGCTGGGCACAGTTGCTCAGG + Intergenic
1095213362 12:39520497-39520519 CTGGCTGGGCACAGGGGCTCAGG + Intergenic
1095497150 12:42797170-42797192 ATGGGTAGGCACGGTGGCTCAGG - Intergenic
1095894123 12:47263487-47263509 ATGGCTAGGCACAGTGGCTCAGG - Intergenic
1096319513 12:50599006-50599028 TTGGCTGGGCACAGTGGCTCAGG + Intronic
1096632616 12:52938493-52938515 CAGGCCAAGCACAGTGGCTCAGG + Intronic
1097256710 12:57682019-57682041 TTGGCTGAGCACAGTGGCTCAGG - Intergenic
1097269268 12:57764416-57764438 CTGGGACAGAACAGTGGCTGAGG + Exonic
1097582598 12:61476132-61476154 ATGGCTGGGCACAGTGGCTCAGG - Intergenic
1097813467 12:64044959-64044981 CTGGCCAGGCACAGTGGCTCAGG - Intronic
1097907842 12:64938632-64938654 CTTGGCTAGCACAGTGGCTCTGG - Intergenic
1099226144 12:79971853-79971875 CAGGCTGGGCACAGTGGCTCAGG + Intergenic
1099295872 12:80827104-80827126 CAGGGCTGGCACAGTGGCTCAGG + Intronic
1100427204 12:94498440-94498462 CTGGTTGGGCTCAGTGGCTCAGG - Intergenic
1100878801 12:98993448-98993470 CAGGCTGGGCACAGTGGCTCAGG - Intronic
1102127209 12:110493641-110493663 TGGGGTGGGCACAGTGGCTCAGG - Intronic
1102356466 12:112240730-112240752 TTGGCTAGGCACAGTGGCTCAGG - Intronic
1103274579 12:119700954-119700976 CTGGCTCAGCAGAGGGCCTCTGG - Exonic
1103964458 12:124629807-124629829 CTGCCTCAGCATGGTGGCTCTGG + Intergenic
1104320238 12:127743812-127743834 CTGGCCTGGCACAGTGGCTCAGG + Intergenic
1105049087 12:133031707-133031729 CTGGCCAGGCACAGTGGCTCAGG - Intergenic
1105481751 13:20784659-20784681 CTGGCCAAGCATAGTGGCTCAGG + Intronic
1105844370 13:24281686-24281708 CTGGGTCTGCTCATGGGCTCTGG - Intronic
1106066034 13:26350712-26350734 CTGGCTGGGCTCAGTGGCTCAGG - Intronic
1107327904 13:39264721-39264743 CTGGCTGGGCGCAGTGGCTCAGG - Intergenic
1107514961 13:41120118-41120140 TTGGCTGGGCACAGTGGCTCAGG + Intergenic
1110513810 13:76385043-76385065 TTGGCTAGGCACAGTGGCTCAGG + Intergenic
1113406769 13:110047999-110048021 CTGGGTAACCACAGGAGCTCTGG - Intergenic
1115087920 14:29539336-29539358 CAGGATCAGCAGAGTGGATCTGG + Intergenic
1115602432 14:34968207-34968229 CTGGCTGGGCACAGTGGCTCAGG - Intergenic
1116344932 14:43780945-43780967 GTGGGAGATCACAGTGGCTCAGG + Intergenic
1117019159 14:51551451-51551473 ATGACCCAGCACAGTGGCTCAGG + Intronic
1117682280 14:58216408-58216430 TTGGCTGGGCACAGTGGCTCAGG - Intronic
1118114547 14:62760706-62760728 CTGGGTCATCTGAGTGTCTCTGG + Intronic
1119073823 14:71615723-71615745 TTGGCCCGGCACAGTGGCTCAGG + Intronic
1119640736 14:76312942-76312964 CTGGGCCTGCACAGTGGGCCAGG - Intronic
1119749597 14:77068004-77068026 GTGGCTCAGCACATGGGCTCTGG - Intergenic
1121282211 14:92707107-92707129 CTGGCCAGGCACAGTGGCTCAGG + Intronic
1122176693 14:99926007-99926029 CTGGGCCAGCACAGCGGTCCTGG - Intronic
1122274761 14:100585896-100585918 CGGGCTCAGCACACGGGCTCTGG - Intronic
1122678014 14:103433366-103433388 CTGGCTGAGCACGGTGGCTCAGG - Intronic
1122882438 14:104696181-104696203 GTGGGTCCTCACAGTGGCCCGGG + Intronic
1122891245 14:104733227-104733249 CCAGTTCAGGACAGTGGCTCTGG - Intronic
1123672598 15:22674809-22674831 TTGGCTGGGCACAGTGGCTCAGG + Intergenic
1124252168 15:28114003-28114025 GTGGGTCAGCACAGTGTCTCGGG - Intronic
1124324648 15:28748098-28748120 TTGGCTGGGCACAGTGGCTCAGG + Intergenic
1124636372 15:31367338-31367360 CTGGGTCAGGACCATGTCTCTGG + Intronic
1124871551 15:33548383-33548405 CAGAGTCAACACAGTGGCTTTGG - Intronic
1125314817 15:38419615-38419637 TCGGCTGAGCACAGTGGCTCAGG - Intergenic
1125617202 15:41025431-41025453 CAGGCTGGGCACAGTGGCTCAGG + Intronic
1125860217 15:42992031-42992053 AAGGCTGAGCACAGTGGCTCAGG - Intronic
1126876386 15:53045983-53046005 CAGGGCAGGCACAGTGGCTCAGG - Intergenic
1127235443 15:57045825-57045847 ATGGCTAGGCACAGTGGCTCAGG - Intronic
1127997573 15:64162665-64162687 CTGGGTCAGGGCAGGGGCTGGGG + Intronic
1128172136 15:65522322-65522344 TTGGCTGGGCACAGTGGCTCAGG + Intergenic
1128265117 15:66259340-66259362 GTGGCTGAGCACAGTGGCTCAGG - Intergenic
1128358403 15:66944043-66944065 CCGGCCCAGCACAGTGCCTCTGG - Intergenic
1128783776 15:70379972-70379994 CTGGGTCAGGACCATGGCTCAGG + Intergenic
1130258384 15:82336479-82336501 CTCGGTCAGCACAGCGGGGCTGG - Intergenic
1130596541 15:85253481-85253503 CTCGGTCAGCACAGCGGGGCTGG + Intergenic
1131027679 15:89158508-89158530 CTGGGTCAGGAGACAGGCTCTGG + Intronic
1131052477 15:89357953-89357975 CTGGGGCTGCATTGTGGCTCCGG + Intergenic
1131598967 15:93827868-93827890 CTGGGTGTGCACAGTGGCTCAGG + Intergenic
1132112330 15:99110863-99110885 GTGGGTCAGGACAGAGGCACTGG - Intronic
1132533179 16:463830-463852 CTGGTTCACCACAGAGGCCCCGG - Intronic
1133083856 16:3346113-3346135 CAGGCTGAGCACAGTGGCTCAGG - Intergenic
1133731651 16:8583461-8583483 CTGGCCGAGCACAGTGGTTCAGG + Intronic
1133772741 16:8877113-8877135 GTGGGGCAGCACAGGGGCCCAGG - Intergenic
1133996971 16:10755718-10755740 CAGGTTCACCAGAGTGGCTCAGG + Exonic
1135106259 16:19652463-19652485 TTGGTTGAGCACAGTGGTTCAGG - Intronic
1135728214 16:24873347-24873369 CTGGCTGGGCACAGTGGCTCAGG + Intronic
1136099165 16:27980599-27980621 CTGGCTGGGCACGGTGGCTCAGG + Intronic
1136284512 16:29233254-29233276 CTGGGTCAGCACTGGGGGTGAGG + Intergenic
1136403428 16:30030516-30030538 CGGGGTCAGCATGGTGGCTCAGG + Exonic
1138658632 16:58504621-58504643 CTTGGCCAGCACATAGGCTCCGG - Exonic
1138664109 16:58549005-58549027 CTGGCCGGGCACAGTGGCTCAGG + Intronic
1139549003 16:67663238-67663260 CCAGCTCAGCACGGTGGCTCTGG + Exonic
1139585801 16:67902575-67902597 CTGGCTGGGCGCAGTGGCTCAGG - Intronic
1139795827 16:69482206-69482228 CTGGCGCAGCACGCTGGCTCCGG + Intergenic
1139822175 16:69729323-69729345 CTGGCCGGGCACAGTGGCTCAGG + Intergenic
1140406603 16:74715571-74715593 ATGGCTGAGCGCAGTGGCTCAGG - Intronic
1140891657 16:79290136-79290158 CAGGCTGAGCACAGTGGCTCAGG - Intergenic
1142089547 16:88202767-88202789 CTGGGTCAGCACTGGGGGTGAGG + Intergenic
1142570493 17:870459-870481 CTGGCTGAGTTCAGTGGCTCAGG + Intronic
1143166372 17:4899179-4899201 ACGGGTGAGCACAGTGGCCCTGG - Exonic
1143584635 17:7845039-7845061 TTGGGTCGGCCCAGTGGCTCCGG + Intronic
1143692154 17:8577811-8577833 TTGGCTGGGCACAGTGGCTCAGG - Intronic
1143957686 17:10685944-10685966 CTGGCTGGGCGCAGTGGCTCAGG + Intronic
1144589128 17:16508941-16508963 CTGGCTGAGTGCAGTGGCTCAGG - Intergenic
1144669973 17:17127339-17127361 CAGTGGCAGCAGAGTGGCTCGGG - Intronic
1145125716 17:20298478-20298500 CTGGATCAGCACAGCCTCTCTGG - Intronic
1145826007 17:27877757-27877779 CTGTGGCAGCACAGGGGCTGGGG + Intronic
1146202135 17:30867884-30867906 CAGGGCAGGCACAGTGGCTCAGG - Intronic
1146545714 17:33736282-33736304 GTGGGTCAGCACAGTGCCCGAGG + Intronic
1146792366 17:35759418-35759440 CTGGCTGGGCGCAGTGGCTCAGG + Intronic
1147169947 17:38612244-38612266 CTGGCTGGGCACCGTGGCTCAGG + Intergenic
1147284952 17:39394838-39394860 CTGGCCAGGCACAGTGGCTCGGG - Intronic
1147623874 17:41886558-41886580 TTGGCCCGGCACAGTGGCTCAGG + Intronic
1148057350 17:44808461-44808483 ACGGCCCAGCACAGTGGCTCTGG + Intronic
1148201366 17:45752114-45752136 CTGGGCCAGCACCTGGGCTCTGG + Intergenic
1148267728 17:46239843-46239865 TAGGCTGAGCACAGTGGCTCAGG - Intergenic
1148277256 17:46316203-46316225 CTGGCTGGGCGCAGTGGCTCAGG - Intronic
1148299372 17:46533781-46533803 CTGGCTGGGCGCAGTGGCTCAGG - Intronic
1148363989 17:47038973-47038995 CTGGTTGGGCGCAGTGGCTCAGG - Intronic
1148783235 17:50133230-50133252 CTGGCCCAGCACAGGGGCTGGGG + Intergenic
1148809808 17:50283243-50283265 CTGGGTGAGCACAGTGAATGGGG - Intergenic
1148902434 17:50888389-50888411 CTAGGTCAGCACAGGTGCTCAGG + Intergenic
1149969132 17:61198419-61198441 CGGGCTGGGCACAGTGGCTCAGG - Intronic
1150001915 17:61445762-61445784 TTAGGCCAGCACAATGGCTCAGG - Intergenic
1150403142 17:64875505-64875527 CTGGCTGGGCGCAGTGGCTCAGG + Intronic
1150490897 17:65573589-65573611 ATGGTTCAACACAGAGGCTCTGG + Intronic
1150988468 17:70227017-70227039 CTGGCTAGGCACGGTGGCTCAGG - Intergenic
1151463320 17:74268710-74268732 CTGGGTCACCACAGGGCATCCGG - Intergenic
1151981769 17:77515678-77515700 CTGGCTGGGCACAGTGGCTCAGG + Intergenic
1152320659 17:79607459-79607481 CGCGTTCAGCACTGTGGCTCTGG + Intergenic
1152347645 17:79763225-79763247 CTGGCTGGCCACAGTGGCTCAGG + Intergenic
1152636312 17:81431918-81431940 CTGGGTGTGCGCAGGGGCTCGGG - Intronic
1153670695 18:7409242-7409264 CTGGCTGGGCACAGTGGCTCAGG - Intergenic
1154193991 18:12253135-12253157 CTGTGTCCGCTCAGTGCCTCTGG + Intergenic
1154380968 18:13849491-13849513 CTGGCTGGGCACAGTGGCTCAGG + Intergenic
1155308519 18:24501824-24501846 CCGGTTGAGCACAGTGGCTCAGG - Intergenic
1157381751 18:47224899-47224921 TTGGCTGGGCACAGTGGCTCAGG - Intronic
1157521179 18:48346611-48346633 CTGGGTAAGCAGAGTGTCACTGG + Intronic
1158597424 18:58828299-58828321 CCGGCTCAGCATAGGGGCTCAGG - Intergenic
1159908315 18:74118990-74119012 CTGGAACAGCACAGTGGCCTAGG + Intronic
1160213319 18:76902870-76902892 CAGGCTGGGCACAGTGGCTCAGG - Intronic
1160377992 18:78428722-78428744 TTGGCCCCGCACAGTGGCTCAGG - Intergenic
1160578203 18:79869029-79869051 CTGGGACAGCACAGTGCGTGCGG - Intronic
1160613254 18:80105539-80105561 CTGGGTCTGCACAGAGGCAGAGG + Intergenic
1160793847 19:934887-934909 CTGGCTGGGCACCGTGGCTCAGG - Intronic
1160913219 19:1484204-1484226 CTGGGCGGGCGCAGTGGCTCAGG + Intronic
1161014569 19:1977339-1977361 CTGAGTCACCACAGTGGGTGGGG + Intronic
1161053741 19:2179524-2179546 CTGGCTGGGCACGGTGGCTCAGG + Intronic
1161148469 19:2694127-2694149 CTGGGTAAGCACAGGGGATTTGG + Intronic
1161325500 19:3661835-3661857 CTGGGTGAGCCCTGAGGCTCCGG + Intronic
1161528072 19:4769682-4769704 CTGTTTCAGCACCGGGGCTCAGG + Intergenic
1162299707 19:9837433-9837455 CTGGCTGGGCGCAGTGGCTCAGG - Intronic
1162741185 19:12774814-12774836 CTGGTTCAGCACATAGGCTACGG + Exonic
1163624128 19:18378873-18378895 CTGGCTGAACACAGTGGCTCAGG - Intronic
1164464776 19:28478251-28478273 CTGGGAGAGCACACTGGCTTTGG + Intergenic
1164811813 19:31163448-31163470 GTGGCTGGGCACAGTGGCTCAGG + Intergenic
1165014195 19:32868925-32868947 CGGGCTGGGCACAGTGGCTCAGG + Intronic
1165719106 19:38066301-38066323 CTAGGCCAGGCCAGTGGCTCAGG - Intronic
1166806317 19:45489302-45489324 TAGGGTCAGGACAGGGGCTCAGG + Intronic
1167234327 19:48304342-48304364 CTGGCTGGGCACGGTGGCTCAGG + Intronic
1168094996 19:54109416-54109438 CAGGCTCGGCACAGTGGCCCAGG - Intronic
1168153272 19:54460396-54460418 CTGGGTCCCCACGGTGGCCCTGG + Intronic
1168261757 19:55199021-55199043 CTGGCAGGGCACAGTGGCTCAGG + Intronic
1168341005 19:55622893-55622915 CTGGCTGGGCACGGTGGCTCAGG + Intronic
1168389552 19:55994675-55994697 CTGGCTGGGCACAGTGGCTCAGG - Intergenic
926108279 2:10166046-10166068 CTGGGTCGTCACAGGGGCTCTGG + Intronic
926208430 2:10850515-10850537 CTGGCCGAGCGCAGTGGCTCAGG + Intronic
926294750 2:11560950-11560972 GTTGGGCAGCCCAGTGGCTCTGG - Intronic
926325429 2:11781276-11781298 CTGGGTCAGCACCATAGCTGTGG - Intronic
926572102 2:14541182-14541204 CTGGCTCAGCAGAGTCCCTCTGG - Intergenic
926710520 2:15875857-15875879 TAGGCTGAGCACAGTGGCTCAGG + Intergenic
927529476 2:23781381-23781403 CAGGCTGGGCACAGTGGCTCAGG + Intronic
927808479 2:26168950-26168972 CTGGGTCAACACTGGGCCTCTGG + Intergenic
927942641 2:27114803-27114825 CTGGGGCAGCTCAGAGGCTGGGG - Intronic
928318783 2:30266858-30266880 TTGGGTCAGCACAGGGCCTGGGG - Intronic
929226379 2:39515499-39515521 TTGGGTTATCACTGTGGCTCAGG - Intergenic
929291157 2:40193465-40193487 CTGTGTGAGCACAGTGGGTGGGG + Intronic
929598117 2:43188752-43188774 TTGGATCGGCGCAGTGGCTCAGG - Intergenic
932417720 2:71583883-71583905 CTGGGGGAGCCCTGTGGCTCTGG + Intronic
932967070 2:76488924-76488946 TTGGCTGGGCACAGTGGCTCAGG - Intergenic
933629292 2:84637946-84637968 TTGGCCAAGCACAGTGGCTCAGG + Intronic
934027512 2:88013577-88013599 CTGGCCCAGCTCAGTGGCTCAGG - Intergenic
934716671 2:96548814-96548836 CTGGGGCCACACAGAGGCTCGGG + Intronic
936074586 2:109393736-109393758 CTGGGTCAGTGCAGGGGCCCAGG + Intronic
937667670 2:124504985-124505007 CTGGCCAGGCACAGTGGCTCAGG - Intronic
937835628 2:126467953-126467975 CTGGCTGGGCACGGTGGCTCAGG + Intergenic
940089545 2:149900156-149900178 CTGGGTCTGAACACTGGTTCGGG + Intergenic
940203818 2:151180545-151180567 CTGGCTGGGCGCAGTGGCTCAGG + Intergenic
940304424 2:152210524-152210546 CTGGCTGGGCACAGTGGCTCAGG - Intergenic
941047792 2:160695935-160695957 CTGAGCCAGGACAGTGTCTCTGG - Intergenic
943855489 2:192784342-192784364 TAGGCCCAGCACAGTGGCTCAGG - Intergenic
944575612 2:201088460-201088482 ATGGCTGGGCACAGTGGCTCAGG + Intergenic
947290101 2:228563533-228563555 CTGGGTGAGCCAATTGGCTCTGG - Intergenic
947295683 2:228627973-228627995 GAGGCTAAGCACAGTGGCTCAGG + Intergenic
947452559 2:230221941-230221963 TTGGCTGGGCACAGTGGCTCAGG + Intronic
947574832 2:231264776-231264798 CAGGCTGGGCACAGTGGCTCAGG - Intronic
947759907 2:232596477-232596499 CTGGCTGGGCACAGTGGCTCAGG - Intergenic
948034495 2:234847184-234847206 CTGGGTCAGCACAGAAGGTCTGG + Intergenic
948400341 2:237680208-237680230 CTGGCCAGGCACAGTGGCTCAGG + Intronic
948628325 2:239284364-239284386 CTGGGTCAGCACAGTGGCTCAGG - Intronic
948908445 2:240991172-240991194 TGGGGACAGGACAGTGGCTCAGG - Intronic
1169712994 20:8585285-8585307 ATGGGACAGCATGGTGGCTCTGG - Intronic
1170448835 20:16460297-16460319 CTGGCTGGGCACAGTGGCTCAGG + Intronic
1172017163 20:31883475-31883497 CTTGCTGGGCACAGTGGCTCAGG - Intronic
1172451192 20:35024540-35024562 CTGGCTTGGTACAGTGGCTCAGG + Intronic
1172467835 20:35169832-35169854 CAGGCTGTGCACAGTGGCTCAGG + Intergenic
1172545271 20:35755992-35756014 AGGGCTAAGCACAGTGGCTCAGG + Intergenic
1172625846 20:36346298-36346320 CATGGTCAGCACAATGGCTATGG - Intronic
1174204753 20:48830080-48830102 CAGGCTGGGCACAGTGGCTCCGG + Intergenic
1174359181 20:50017216-50017238 CTGGCTGGGCACGGTGGCTCAGG - Intergenic
1174393988 20:50234680-50234702 CTGGGGAAGCACCGAGGCTCTGG + Intergenic
1174818507 20:53707345-53707367 CTGGGTCAGAACAGTGATTGAGG - Intergenic
1175320122 20:58079585-58079607 CAGGCTCGGTACAGTGGCTCAGG + Intergenic
1175581896 20:60106257-60106279 TTGGCTAAGCACAGTGTCTCAGG - Intergenic
1175927067 20:62476097-62476119 CAGGGTCAGCGCTGGGGCTCCGG + Intergenic
1176623314 21:9072761-9072783 CTGGGCCAGCACTGTGGGTGTGG - Intergenic
1176715154 21:10343644-10343666 CTGGATCCGCACAGCGGCCCTGG - Intergenic
1176718407 21:10373783-10373805 GAGGGGCAGCACAGTGGCTCAGG + Intergenic
1177198071 21:17923740-17923762 CTGGCCAGGCACAGTGGCTCAGG - Intronic
1178599415 21:33983217-33983239 CAGGATCAACACTGTGGCTCTGG - Intergenic
1178823339 21:35994676-35994698 CTGGGTCAGGTCAGTGAGTCAGG - Intronic
1178977018 21:37228748-37228770 CTGGCCAGGCACAGTGGCTCAGG + Intronic
1179117491 21:38507443-38507465 CAGTGTCAGCACTGGGGCTCCGG - Intronic
1179342767 21:40528169-40528191 ATGGGTCAGGACTGTGGCTATGG - Intronic
1180299635 22:11026688-11026710 GAGGGGCAGCACAGTGGCTCAGG + Intergenic
1180603191 22:17036294-17036316 CTGGATCCGCACAGCGGCCCTGG + Intergenic
1180749284 22:18113279-18113301 GTGGCTCAGGACAGAGGCTCTGG - Intronic
1181594533 22:23905798-23905820 CTGGGTGAGCACAGAGCCTCGGG + Intergenic
1181618315 22:24070439-24070461 CTGGATGGGCACAGTGGCTCTGG + Intronic
1182269530 22:29144832-29144854 CTGTGACAGCACATTGGCTTGGG - Intronic
1182393567 22:30019519-30019541 CTGTGACAACACAGTGCCTCTGG + Exonic
1182680853 22:32078671-32078693 CTGGCTGAGCATGGTGGCTCAGG + Intronic
1183158420 22:36093467-36093489 CTGGCTGGGCACAGTGGCTCAGG - Intergenic
1183974473 22:41503025-41503047 CTTGCTGGGCACAGTGGCTCAGG - Intronic
1184394084 22:44222359-44222381 CTGAGTCAGGACACTGGGTCTGG - Intergenic
1185222182 22:49634640-49634662 CTGGGTCTCCACGGTGGCCCCGG - Intronic
949171564 3:1005015-1005037 TTGGTTGGGCACAGTGGCTCAGG + Intergenic
949813610 3:8035054-8035076 CTGGCCAGGCACAGTGGCTCAGG + Intergenic
950684756 3:14608518-14608540 CTGGGCCAGAACAAGGGCTCAGG + Intergenic
952368346 3:32695004-32695026 CATGGCCAGCACGGTGGCTCAGG - Intronic
953182234 3:40606707-40606729 GTGTATCATCACAGTGGCTCTGG + Intergenic
954377474 3:50202744-50202766 CTGGCTCTTCACAGTGACTCAGG + Intergenic
954420206 3:50414872-50414894 CTGGGCCTGCAAAGAGGCTCAGG + Intronic
956718394 3:72098218-72098240 CTGCCTCAGCACCATGGCTCAGG - Intergenic
958977632 3:100684547-100684569 CTGGCCAGGCACAGTGGCTCAGG - Intronic
961232528 3:125330181-125330203 CAGGCTGAGCGCAGTGGCTCAGG + Intronic
961641673 3:128368660-128368682 CTGGGTCAGCTCACTGCCTTTGG + Intronic
961851405 3:129823042-129823064 TTAGGCCAGCGCAGTGGCTCAGG + Intronic
962378803 3:134880337-134880359 CTGGGTCAACAAAGGGGCTTTGG + Intronic
962889051 3:139655170-139655192 CAGGGTCAACAGAGTGGCTAAGG + Intronic
963515359 3:146301556-146301578 CTGGGGTAGCACAGTGGCTATGG + Intergenic
963740023 3:149069188-149069210 TTGGCTGGGCACAGTGGCTCAGG + Intronic
964444266 3:156742220-156742242 CTGGGACAGGACAGTGGTTTAGG - Intergenic
965789756 3:172374672-172374694 CTGGCCGGGCACAGTGGCTCAGG - Intronic
965918468 3:173881376-173881398 CTGGCTGGGCGCAGTGGCTCAGG - Intronic
966189533 3:177259607-177259629 GTGGCTGGGCACAGTGGCTCAGG - Intergenic
966208362 3:177427505-177427527 CTGGGTAGGGACAGTGACTCAGG + Intergenic
966598796 3:181753536-181753558 CAGGGTCAGGAAAGTGGCTATGG + Intergenic
966720291 3:183055613-183055635 CAGGCTGAGCACAGTGGCTCGGG + Intronic
966773207 3:183522042-183522064 CTGGCTGGGCACGGTGGCTCAGG + Intronic
967426432 3:189332711-189332733 TTTGGCCAGCACAGTGGCTCAGG - Intergenic
967481612 3:189979678-189979700 TGGGCTGAGCACAGTGGCTCAGG + Intronic
968761303 4:2443841-2443863 AGGGGTCAGCACAGTTGCTAGGG + Intronic
969085582 4:4653701-4653723 TTGGCTGGGCACAGTGGCTCAGG - Intergenic
969270384 4:6095585-6095607 CTGAGTCAGGACAATGACTCAGG - Intronic
969515406 4:7645222-7645244 CTGGGTCATCCGAGTGACTCAGG - Intronic
969608395 4:8213535-8213557 CTGGGTCAGCATGCTGGCTCCGG + Intronic
971320217 4:25599556-25599578 CTGGCAGGGCACAGTGGCTCAGG - Intergenic
971440098 4:26676434-26676456 CAGGCTGGGCACAGTGGCTCAGG + Intronic
972696971 4:41456771-41456793 CTGGGTCAGCTCAGAGGTTTGGG + Intronic
974093084 4:57333011-57333033 CTTGGTAAGCACAGTAGCTGAGG + Intergenic
975262323 4:72318062-72318084 GGGGGTCAGGACAGTGGGTCAGG - Intronic
976106309 4:81622185-81622207 ATGAGTCAGCACTGTGGATCCGG + Intronic
976405054 4:84653818-84653840 CTTGCTGGGCACAGTGGCTCAGG + Intergenic
976639907 4:87327470-87327492 CTGGCTGGGCACGGTGGCTCAGG + Intergenic
978298844 4:107242257-107242279 CTGGCTGAGCACAGTGGCTCAGG + Intronic
978433759 4:108660933-108660955 TTGGCTGGGCACAGTGGCTCAGG + Intronic
979939346 4:126740321-126740343 CTGGCCAGGCACAGTGGCTCAGG - Intergenic
980768913 4:137346214-137346236 CTGGCTGGGCGCAGTGGCTCAGG + Intergenic
981869967 4:149474281-149474303 CTGGTTGAGCACAGTGGCTCAGG + Intergenic
982691987 4:158559157-158559179 CTGGCTGGGCACAGTGGCTAGGG + Intronic
982847562 4:160272780-160272802 CTGGGTCTGTAAACTGGCTCAGG - Intergenic
983737829 4:171085985-171086007 ATGGTTGGGCACAGTGGCTCAGG + Intergenic
984067034 4:175061899-175061921 CAGGCTGGGCACAGTGGCTCAGG + Intergenic
985206084 4:187538606-187538628 GTGGCTGGGCACAGTGGCTCAGG + Intergenic
985707230 5:1408562-1408584 CTGGGGCAGCACAATGGGCCAGG + Intronic
985777383 5:1851843-1851865 CGGGGTCTGCACGGTGGCGCGGG + Intergenic
986280528 5:6318412-6318434 CTGGCTGGGCACGGTGGCTCAGG + Intergenic
987270758 5:16306039-16306061 CTGGACCAGCACAGAGGCCCTGG + Intergenic
987954353 5:24718339-24718361 TAGGGCCGGCACAGTGGCTCAGG - Intergenic
988980408 5:36562619-36562641 CTGGCCGGGCACAGTGGCTCAGG - Intergenic
990937565 5:61166545-61166567 CTGCCTGGGCACAGTGGCTCAGG - Intergenic
991040424 5:62169439-62169461 CTGGCTCAGAGCTGTGGCTCTGG - Intergenic
991519691 5:67482149-67482171 CAGGGTCAGCTCTGAGGCTCAGG + Intergenic
991674717 5:69079579-69079601 CAGGCTGGGCACAGTGGCTCAGG + Intergenic
992147805 5:73869623-73869645 CTGGCTGGGCACGGTGGCTCAGG + Intronic
992694108 5:79267694-79267716 CTGGGTGGGCACTGTGGCCCAGG - Intronic
993776418 5:92003978-92004000 CTGGGAATGCACAGTGACTCCGG - Intergenic
994054623 5:95401307-95401329 CTGGGCCAGCACAGAGCATCAGG - Intronic
994132838 5:96250298-96250320 CTGGGTCACCACATTGGCTCTGG - Intergenic
995352850 5:111201415-111201437 TTGGGTCATCACAGTGACTGGGG - Intergenic
995542811 5:113201102-113201124 CTGGCTGGGCACAGGGGCTCAGG + Intronic
996643006 5:125780027-125780049 CTGGCTTATCACAGAGGCTCAGG - Intergenic
998521645 5:142806374-142806396 CATGGCCAGCACAATGGCTCAGG - Intronic
998586295 5:143431161-143431183 CTGGGTAAGAAATGTGGCTCAGG + Intronic
999050080 5:148513269-148513291 CTGGTCAGGCACAGTGGCTCAGG - Intronic
1000068564 5:157718528-157718550 CTGGGACAACACAGTGTCCCAGG + Intergenic
1000150637 5:158497313-158497335 CTGGCTCAGCCAAGAGGCTCTGG - Intergenic
1000390767 5:160720805-160720827 CTTGGTCAGCACTGTAGCTTTGG + Intronic
1001049177 5:168400665-168400687 GTGGCTGGGCACAGTGGCTCAGG + Intronic
1002561155 5:180083204-180083226 CTGGCTCAGCTCAGGGGCCCAGG - Intergenic
1002619216 5:180475068-180475090 CAGAGCCAGCACAGTGGCTCAGG + Intergenic
1005943083 6:30575786-30575808 CTGGCCAGGCACAGTGGCTCAGG + Intronic
1007145738 6:39628445-39628467 CTGTGTCTTCACTGTGGCTCTGG - Intronic
1007456505 6:41981803-41981825 TTGGCTGGGCACAGTGGCTCAGG - Intronic
1007576196 6:42926591-42926613 CTGAGAGAGCACAGAGGCTCAGG - Intergenic
1008366191 6:50683210-50683232 TTGGCTGGGCACAGTGGCTCAGG + Intergenic
1008589275 6:52976799-52976821 CTAGGTCAGCACTGTTCCTCAGG + Intergenic
1009057765 6:58358644-58358666 CTGAGTCAGCACAGTGACTCTGG - Intergenic
1009233060 6:61088445-61088467 CTGAGTCAGCATAGTGACTCTGG + Intergenic
1009638713 6:66302321-66302343 CAGGCCCAGCACAGTGGCTCTGG + Intergenic
1010451294 6:76006108-76006130 CTAGGTGGGCACAGTGGCTCAGG - Intronic
1012374452 6:98544633-98544655 CTGGGGCAGCAGAGTAGCTATGG + Intergenic
1012867385 6:104634372-104634394 CAGGGCTGGCACAGTGGCTCAGG - Intergenic
1013054417 6:106569502-106569524 CTGGCTGGGCGCAGTGGCTCAGG - Exonic
1013554611 6:111243220-111243242 CAGGGTCCACAGAGTGGCTCTGG - Intergenic
1014079767 6:117272485-117272507 CTGGGTCAGCAGATCAGCTCAGG - Exonic
1014919926 6:127202086-127202108 CAGGGACAGCACAGTGCCCCAGG - Intergenic
1015529556 6:134207689-134207711 CTGGGTTAGCACATGGGCGCTGG + Intronic
1016956489 6:149632110-149632132 CTGGCTGGGCACGGTGGCTCAGG + Intronic
1019468389 7:1203227-1203249 CAGGCTGGGCACAGTGGCTCAGG - Intergenic
1019608661 7:1923755-1923777 CTGGGTGCTCAGAGTGGCTCTGG + Intronic
1020078570 7:5274524-5274546 CTTGGGAAGGACAGTGGCTCGGG + Intronic
1020255523 7:6501067-6501089 AGGGCTAAGCACAGTGGCTCAGG + Intronic
1022109349 7:27219085-27219107 CTGGGTAGGGACAGTGGCCCAGG + Intergenic
1022456004 7:30559077-30559099 CTGGCCTAGCACAGTGGCTCAGG + Intergenic
1023450323 7:40277488-40277510 CTTGCTCAGCACAGTGGCTCTGG - Intronic
1025077548 7:55956038-55956060 CCGGCTGGGCACAGTGGCTCAGG - Exonic
1025807048 7:64844102-64844124 CTTGGCCAGCGCAGTGGCTCAGG - Intergenic
1025846174 7:65200260-65200282 TTGGGTTAGTCCAGTGGCTCTGG + Intergenic
1025896394 7:65705992-65706014 TTGGGTTAGTCCAGTGGCTCTGG + Intergenic
1026689508 7:72539836-72539858 CTTGGTCAACGCATTGGCTCAGG + Intergenic
1027257566 7:76440888-76440910 CTGGCTTGGCATAGTGGCTCAGG + Intronic
1027281282 7:76611153-76611175 CTGGCTTGGCATAGTGGCTCAGG - Intronic
1027404368 7:77844273-77844295 ATGGTTGGGCACAGTGGCTCAGG - Intronic
1027756715 7:82223185-82223207 CTGGCTGAGCGCGGTGGCTCAGG - Intronic
1028439952 7:90848380-90848402 CTGGCTGGGCACTGTGGCTCAGG - Intronic
1029467967 7:100737818-100737840 TCGGCCCAGCACAGTGGCTCAGG + Intronic
1029737306 7:102472000-102472022 CTGGGTCACTACTGTGACTCGGG + Intronic
1031221526 7:118972519-118972541 CTGGCTGGGCACTGTGGCTCAGG - Intergenic
1031761898 7:125723776-125723798 CTGGGACAGCGCAGTGGCTCAGG + Intergenic
1032677644 7:134145989-134146011 CTGGCTGGGCACAGTGGCTGAGG + Intronic
1032863248 7:135901880-135901902 ATGGGACTTCACAGTGGCTCTGG - Intergenic
1033140324 7:138820747-138820769 CTGGCTAGGCACAGTGGCTCAGG - Intronic
1034540366 7:151754505-151754527 CTGGGCCAGCACTGGGGCTTAGG + Intronic
1034972013 7:155425090-155425112 ATGGGTCAGCCTAGTGGCCCTGG + Intergenic
1035019707 7:155793773-155793795 CTTGGACACCCCAGTGGCTCTGG + Intergenic
1035355746 7:158275176-158275198 CAGGGACAGCACCGTGGCTGTGG + Intronic
1035572940 8:685861-685883 CTGACTGGGCACAGTGGCTCAGG + Intronic
1037770163 8:21794133-21794155 CAGGCTGGGCACAGTGGCTCAGG - Intronic
1037878657 8:22561928-22561950 GTGGGTGAGCACAGTGGGGCGGG + Exonic
1038315402 8:26480442-26480464 TTGGCTGGGCACAGTGGCTCAGG + Intronic
1038540854 8:28388804-28388826 TTGGCTGGGCACAGTGGCTCAGG - Intronic
1039620505 8:38992865-38992887 CTGTGTCAGCACAGTGGATAAGG - Intronic
1039900387 8:41747971-41747993 CTGAGTCAGTACAGAGGCTTGGG + Intronic
1043558331 8:81460279-81460301 CTGGCTGGGTACAGTGGCTCAGG - Intronic
1044378494 8:91504146-91504168 CTGGGTCACTACAGCTGCTCAGG - Intergenic
1046470915 8:114672603-114672625 CTGGCCATGCACAGTGGCTCAGG - Intergenic
1048344742 8:133568200-133568222 TTGGCTGGGCACAGTGGCTCAGG - Intronic
1048420227 8:134270878-134270900 CTGGCCGGGCACAGTGGCTCAGG + Intergenic
1049153715 8:141054340-141054362 CTGGCTAGGCACAGTGGCTCGGG - Intergenic
1049270171 8:141691380-141691402 CTGGCTCAGCGGAGTGTCTCAGG + Intergenic
1049562079 8:143316966-143316988 CTGGGGCAGCACTGGGGCTGTGG - Intronic
1049573472 8:143380128-143380150 CTGCGGCAGCACAGGGCCTCGGG - Exonic
1049576929 8:143393850-143393872 CTGGGTCAGCAGATCCGCTCCGG - Intergenic
1049596487 8:143486342-143486364 CTGGGGCCGCACCGAGGCTCTGG + Intronic
1050895397 9:10880069-10880091 TTGGGTGGGCACAGTGGCTCAGG - Intergenic
1052691967 9:31826535-31826557 CTGGCTGGGCACGGTGGCTCAGG + Intergenic
1052979165 9:34435100-34435122 CTGGCCAGGCACAGTGGCTCAGG - Intronic
1053296949 9:36922129-36922151 AAGGGTCAGCACTGAGGCTCAGG - Intronic
1053419629 9:37969235-37969257 CTGGGTTAGGGCAGGGGCTCTGG + Intronic
1056116658 9:83447520-83447542 CTGAGCCATCACAGTGCCTCGGG - Intronic
1056548974 9:87635869-87635891 CTGAGTCAGCCCAGTGGTGCGGG + Intronic
1057312160 9:93949353-93949375 CTAGGTCAGCACGGGGTCTCCGG + Intergenic
1057484169 9:95469128-95469150 CTGCGTCAGCAGAGTGATTCAGG - Exonic
1058697638 9:107573121-107573143 GGGGCCCAGCACAGTGGCTCAGG - Intergenic
1059108600 9:111533398-111533420 CAGGCTGGGCACAGTGGCTCAGG + Intronic
1060405298 9:123370045-123370067 CTGGGTCAGTACTGTGATTCTGG + Intronic
1060666217 9:125433570-125433592 CTGGGGCAGCAGAGGGGCTCAGG + Intergenic
1061425082 9:130493609-130493631 CTGGGTCAGCCCAGGGGCTGCGG - Intronic
1061509110 9:131049711-131049733 CTGGGCCATGACAGTGGCTATGG - Intronic
1062141585 9:134961937-134961959 CAAGGTCCCCACAGTGGCTCCGG - Intergenic
1062544288 9:137054647-137054669 CTGGGTCAGCTGCGTGTCTCTGG - Intergenic
1186758723 X:12700899-12700921 GTGAGTGAGCACAGTGGCTTGGG - Intronic
1187004009 X:15213855-15213877 CTGGGACAGCACTGCGGCTGGGG + Intergenic
1188650491 X:32626187-32626209 CAGGCTGGGCACAGTGGCTCAGG + Intronic
1190041726 X:47077783-47077805 CAGGGCCGGCACAGTGGCTCAGG - Intergenic
1193065427 X:77254312-77254334 CTGGGCAGGCACAGAGGCTCAGG + Intergenic
1193325238 X:80172585-80172607 TTGGGTCACCAAAGTGACTCTGG - Intergenic
1193713221 X:84903659-84903681 CAGGCTGGGCACAGTGGCTCAGG - Intergenic
1195407883 X:104536700-104536722 CTGGGTCACCAAAGTGACTCTGG + Intergenic
1196200960 X:112885163-112885185 CGGGCTGGGCACAGTGGCTCAGG - Intergenic
1199514222 X:148657175-148657197 GTGAGTCAGCAGAGTAGCTCTGG - Intronic
1200151136 X:153952037-153952059 CTGTGTCAGCACAATGGGTATGG + Exonic
1200345008 X:155439405-155439427 CTGGGGGAGCGCAGTGGCACTGG - Intergenic